Hypoxia increases macrophage motility, possibly ... - Semantic Scholar

Uncorrected Version. Published on April 27, 2009 as DOI:10.1189/jlb.0908536

Article

Hypoxia increases macrophage motility, possibly by decreasing the heparan sulfate proteoglycan biosynthesis ¨ stergren-Lundeń,* Germa Annika Asplund,* Gunnel O ń Camejo,*,† Pia Stillemark-Billton,* and Go¨ran Bondjers*,‡,1 *Wallenberg Laboratory for Cardiovascular Research, Sahlgrenska Academy at Go¨teborg University, Go¨teborg, Sweden; ‡Nordic School of Public Health, Go¨teborg, Sweden; and †AstraZeneca R & D, Mo¨lndal, Sweden RECEIVED SEPTEMBER 10, 2008; REVISED FEBRUARY 19, 2009; ACCEPTED MARCH 4, 2009. DOI: 10.1189/JLB.0908536

ABSTRACT

Introduction

Macrophages are recruited and retained in hypoxic sites in atherosclerotic lesions and tumors. Furthermore, macrophages are suggested to be a major source of HSPG synthesis in atherosclerotic lesions. HSPG are, among other things, known to regulate cell motility, cell adhesion, and receptor interaction. The aim of this study was to investigate the effect of hypoxia on HSPG expression and macrophage motility. We also explored the potential regulation of HSPG by the transcription factor HIF-1␣. The nondirected cell motility was increased in HMDM after 24 h exposure to hypoxia (0.5% O2) compared with normal cell culture condition (21% O2). Enzymatic degradation of HS GAG further increased the motility of the HMDM in hypoxia, indicating a role of reduced cell-associated HSPG in the increased HMDM motility. HMDM exposed to 24 h of hypoxia had lower mRNA expressions of syndecan-1 and -4 compared with cells exposed to normal cell culture conditions. Protein levels of syndecan-1 were also decreased significantly in response to hypoxia, and cells subjected to hypoxia had lower mRNA expression for key enzymes involved in HS biosynthesis. In addition, hypoxia was found to reduce the relative content of HS GAG. Transfecting THP-1 cells with siHIF-1␣ indicated that this transcription factor was not involved in the hypoxia-induced modifications of HSPG expression. Given the documented multiple functions of HSPG in macrophage behavior, the hypoxia-induced modifications of HSPG may be of relevance for the development of atherosclerotic lesions and tumor progression. J. Leukoc. Biol. 86: 000 – 000; 2009.

Macrophages are recruited and retained in hypoxic sites in atherosclerotic lesions [1, 2] and tumors [3, 4], where oxygen tension can be reduced from 20 to 70 mmHg (2.5–9% oxygen), the levels in healthy tissues, to below 10 mmHg (⬍1% oxygen) [5]. During the development of atherosclerotic lesions, hypoxia is exacerbated by thickening of the arterial wall and by increased oxygen demand by the retained macrophages [6, 7]. In solid malignant tumors, up to 70% of the cells are macrophages that have migrated into the growing tissue [8]. A number of earlier studies have indicated that hypoxia promotes tumor growth by altering the phenotype of the recruited macrophages (for review, see ref. [9]). Cell surface HSPG bind cytokines, chemokines, and growth factors and regulate a wide variety of biological activities, including cell migration, cell adhesion, proliferation, receptor interaction, coagulation, and lipoprotein binding and uptake (for reviews, see refs. [10 –12]). Macrophages synthesize the two major cell membrane HSPG—the transmembrane syndecans and the GPI-anchored— glypicans [13–16]. The syndecan family has four members, and syndecan-1 has been identified as the major HSPG in macrophages [17]. Syndecan has attachment sites for several HS GAG chains, which act as coreceptors to mediate growth factor interaction with its receptor [18 –20]. Small variations in the length and sulfation of GAG chains can modulate the functions of growth factors, cytokines, and lipoproteins [20 –23]. Little is known about the HS expression in pathological processes, but changes in HS have been associated with tumor progression, diabetes, lesion development, bacterial and viral infections, as well as with several inherited diseases (for review, see ref. [24]). Macrophages appear to play a role in the synthesis of HSPG in cardiovascular disease, as syndecan-1 expression has been demonstrated in macrophages within arterial lesions and in myocardial ischemic lesions [25–27]. Reduced expression of HSPG has been suggested to be an indicator of poor prognosis in certain cancers

Abbreviations: CS⫽chondroitin sulfate, DS⫽dermatan sulfate, ECM⫽extracellular matrix, EXT2⫽exostose 2, EXTL2⫽exostose-like 2, GAG⫽glycosaminoglycans, GLUT-1⫽glucose transporter-1, HIF-1␣⫽hypoxiainducible factor-1␣, HMDM⫽human monocyte-derived macrophages, HS2ST-1⫽heparan sulfate 2-O-sulfotransferase 1, HSPG⫽heparan sulfate proteoglycan(s), LDH⫽lactate dehydrogenase, NDST-1⫽N-deacetylase/Nsulfotransferase 1, si-control⫽50 nM scrambled small interfering RNA, siHIF-1␣⫽small interfering RNA for HIF-1␣

0741-5400/09/0086-0001 © Society for Leukocyte Biology

1. Correspondence: Nordic School of Public Health, Box 12133, 402 42 Go¨teborg, Sweden. E-mail: [email protected]

Volume 86, August 2009

Journal of Leukocyte Biology

Copyright 2009 by The Society for Leukocyte Biology.

1

by enhancement of cell invasion and metastasis (for review, see ref. [28]). The role of HSPG in cell migration has been investigated, and reduced cell-bound HSPG induced by heparitinase treatment increases cell migration in different cell types [29 –31]. Furthermore, overexpression of syndecan has been shown to decrease cell motility [32]. Is it possible then that hypoxia promotes macrophage motility by inducing changes in macrophage-derived HSPG? As recruitment of macrophages is a key step in the initiation and development of arterial lesions and tumor progression, further understanding of the links among hypoxia, HSPG expression, and cell motility may suggest new therapeutic targets for the treatment of atherosclerotic disease and certain tumors. In this study, we examined the effects of hypoxia on the nondirected motility of HMDM, the involvement of HSPG in this process, and the changes induced in its expression and structure by low oxygen levels. The transcription factor HIF-1␣ is up-regulated when macrophages are exposed to hypoxia [33] and has been shown to be required for hypoxic-induced cell migration in cancer cells [34], but its role in the biosynthesis of HSPG is unknown. Thus, we also investigated the potential role of HIF-1␣ in the regulation of HSPG expression.

monocytes were incubated for 7 days in RPMI 1640 supplemented with 10% heat-inactivated human serum (60°C for 1 h), 100 U/mL penicillin, 2 mM L-glutamine, 1⫻ nonessential amino acids, 2 mM sodium pyruvate, and 0.1% sodium bicarbonate. Every 3rd day, cells were washed three times with PBS, which contained calcium/magnesium to avoid detachment of the cells. Preparations with few cells attached were discarded. All attached cells in one culture dish were scraped and analyzed after 7 days of culturing, and ⬎95% purity for the differentiation marker CD68 was established by flow cytometry (data not shown). Others [36] have shown the ⬎95% purity of CD68-positive macrophages using this method for macrophage isolation and differentiation. The cell culture was also tested negative for the smooth muscle ␣-actin after 7 days of culturing (data not shown).

Macrophage cultures at different oxygen concentrations Differentiated HMDM were incubated in RPMI 1640 in the absence of serum at 37°C under normal (21% O2, 5% CO2, 74% N2) or hypoxic (0.5% O2, 5% CO2, 94.5% N2) conditions for 24 h. Before incubation in hypoxia, media were pre-equilibrated with 0% O2 and 5% CO2. After incubation for 24 h, the cells were washed three times in cold calcium/magnesium-free PBS and harvested. For cells incubated in hypoxia, these procedures were carried out in a chamber with a constant flow of 100% N2. To verify the actual oxygen concentration of the hypoxia incubators, we used an oxygen monitor (Dra¨ger Pac III, Dra¨ger Safety Sverige AB, Partille, Sweden). The viability of HMDM during hypoxic incubation was established by measuring the concentration of LDH [37, 38]. Cells did not detach or redifferentiate during the 24-h exposure to hypoxia.

MATERIALS AND METHODS

HMDM motility

Materials RPMI-1640 medium, penicillin, L-glutamine, nonessential amino acids, sodium pyruvate, human blood serum, and calf serum were from PAA Laboratories (Pasching, Austria). Sulfate-depleted MEM and all chemicals used for Western gel electrophoresis and blotting analysis were from Invitrogen Life Technologies (Carlsbad, CA, USA). RNeasy Mini protocol and all RNA isolation reagents were from Qiagen (Valencia, CA, USA). TaqMan RT reagents, TaqMan ABI Prism 7700 sequence detection system, Assays on Demand, and predesigned ␤-actin were from Applied Biosystems (Foster City, CA, USA). Ficoll-Paque, [35S]-sulfate, D-[6-3H]-glucosamine hydrochloride, peroxidase-conjugated donkey anti-rabbit IgG, ECL detection kit, and hyperfilm were from Amersham Bioscience (Buckinghamshire, UK). Chondroitinase ABC and heparitinase III were from Seikagaku (Tokyo, Japan). PMA and heparinase I, II, and III were from Sigma-Aldrich (St. Louis, MO, USA). Protein assay kits were from Pierce (Rockford, IL, USA), and Tween 20 and D (⫹)-glucose monohydrate were from Merck (Schuchardt, Germany). Complete Mini protease inhibitors were from Roche (Mannheim, Germany) and Centricon YM-3 from Millipore (Billerica, MA, USA). All reagents and materials used for transfection and electrophoresis were from Amaxa (Gaithersburg, MD, USA). siHIF-1␣ and si-control were from Ambion (Cambridgeshire, UK). Primary antibodies for rabbit anti-syndecan-1 and -4 were from Zymed (San Fransisco, CA, USA). Calcein was from Molecular Probes (Carlsbad, CA, USA). HTS FluoroBlok 24-Multiwell Insert System was from BD Bioscience (San Jose, CA, USA).

HMDM preparation Human buffy coats were obtained from the blood bank at Sahlgrenska University Hospital (Go¨teborg, Sweden) and Kunga¨lv Hospital (Kunga¨lv, Sweden), and monocytes were isolated by Ficoll-Paque density gradient centrifugation [35]. Cells were suspended in RPMI 1640 supplemented with 100 U/mL penicillin, 2 mM L-glutamine, 1⫻ nonessential amino acids, 2 mM sodium pyruvate, and 0.1% sodium bicarbonate and seeded into 100 mm plastic Petri dishes. Monocytes were obtained by allowing cells to adhere to plastic for 1 h at 37°C. Nonadherent cells were eliminated by washing three times with PBS containing calcium/magnesium. To induce macrophage differentiation (for all experiments except for HMDM motility),

2 Journal of Leukocyte Biology


Isolated primary monocytes (0.5⫻106 cells) in a total volume of 100 ␮L were seeded on the filter in HTS FluoroBlock 24-Multiwell Insert System plates. Macrophage differentiation was induced for 24 h incubation at normal cell culture conditions in RPMI 1640 in the presence of 10% human serum. Cells were washed three times in PBS containing calcium/magnesium and incubated under hypoxic or normal cell culture conditions for 24 h in RPMI 1640 without serum. Cells were labeled with Calcein-acetoxymethylester (5 ␮g/mL), as described [39], in hypoxia or normal cell culture conditions for 40 min. Cells were washed three times in PBS containing calcium/magnesium, and RPMI 1640 without serum was added to the cells and to the bottom of the 24-well plate followed by 6 h incubation in hypoxia or normal cell culture condition. After 4 h, maximum differences in random cell motility in hypoxia compared with normal cell culture conditions were reached and remained stable after 6 h. Fluorescence from cells that moved through the filter membrane was measured from the bottom of the plates with a Victor II plate reader (excitation at 485 nm and emission at 535 nm; Wallac, Waltham, MA, USA). To investigate the effects of degraded HS GAG, heparinase I, II, and III (2 U/mL) were added at the same time as Calcein.

Real-time PCR Cells were lysed in lysis buffer, and total RNA was prepared according to the RNeasy Mini protocol. RT was performed with TaqMan reagents at 25°C for 10 min, 48°C for 30 min, and 95°C for 5 min. Primer Express 1.5 (Applied Biosystems) and GenBank sequences were used to design the following primers and probes: syndecan-1 (NM_002997), forward GCCGCAAATTGTGGCTACTAA, reverse AGCCGGAGAAGTTGTCAGAGTC, and probe (5⬘ FAM) TTGCCCCCTGAAGATCAAGATGGCTC (3⬘ TAMRA); glypican (NM_002081), forward TGCCCTGACTATTGCCGAA, reverse CATGGAGTCCAGGAGGTTCCT, and probe (5⬘ FAM) AGGCCGACCTGGACGCCGA (3⬘ TAMRA). Primers and probe for glypican were placed in the N-terminal region containing a sequence identical for all glypicans [40]. Primers and probes were optimized, and amplification product sizes were estimated by standard PCR and electrophoresis. Primers and probe for syndecan-2 (IDs HS00299807), syndecan-4 (IDs HS00161617), HIF-1␣ (Hs00153153_m1), GLUT-1 (Hs00197884_m1), and enzymes for HS biosyn-

www.jleukbio.org

Asplund et al. Hypoxic changes in macrophage cell-associated proteoglycans thesis were predeveloped and ordered as a primer/probe mix by Assays on Demand. The following enzymes for HS biosynthesis were studied: NDST-1 (IDs 00155454), EXT2 (IDs 00181158), EXTL2 (Ids 00242124), HS2ST-1 (IDs 00202138), HS3ST-1 (IDs 00245421), and HS6ST-1 (IDs 00757137). During 40 cycles, mRNA content for PG core proteins was quantified with the ABI Prism 7700 sequence detection system (real-time PCR). mRNA expression for all samples was normalized to ␤-actin levels and assessed with a predesigned probe (Nr. 4310881E). Samples were run in triplicates and compared with a standard curve (template dilutions, 3125–200 ng). Samples not treated with RT were run to exclude amplification of contaminating genomic DNA.

Western blots for syndecan Protease inhibitors were added to cell lysates and medium [41]. Total cell protein was determined by the Lowry method with a Pierce protein determination kit. Samples from cell lysates (⬃50 ␮g) and medium were denatured and separated on 10% precast NuPAGE Bis-Tris gels with MOPS SDS running buffer. Samples were digested by adding 5 mU/mL chondroitinase ABC and 5 mU/mL heparitinase III (1:1 in ABC buffer containing 100 mM Tris, 10 mM EDTA, pH 7.3, and 6 mM CaCl2) at 37°C for 16 –18 h. Proteins were transferred to a nitrocellulose membrane with an X Cell II blot module. Membranes were exposed to antibodies in TBS containing 5% milk and 0.1% Tween 20. Primary antibodies, rabbit antisyndecan-1 and -4 (2 ␮g/mL), were used together with a HRP-conjugated secondary antibody. Protein bands were visualized with the ECL detection kit and developed on hyperfilm.

GAG biolabeling and analysis Differentiated HMDM were incubated in sulfate-depleted MEM supplemented with 100 U/mL penicillin, 2 mM L-glutamine, 1⫻ nonessential amino acids, 2 mM sodium pyruvate, and 0.1% sodium bicarbonate for 45 min. Cells were then incubated with 50 ␮Ci [35S]-sulfate and 20 ␮Ci D-[63 H]-glucosamine hydrochloride in sulfate-depleted MEM for 24 h under normal and hypoxic conditions. Cells were harvested in a lysis buffer containing 10% (v/v) Triton X-100, 10% (m/v) SDS, 10% (m/v) sodium deoxycholate, and protease Complete Mini protease inhibitors. Total cell protein was determined by the Lowry method with a Pierce protein determination kit. Cold carrier (CS-4, 100 ␮g/sample) was added, and samples were filtered through a Centricon YM-3 unit. To release the GAG, samples were digested with alkali-borohydrate (1 M NaBH4 and 0.2 M NaOH) overnight at room temperature. The reaction was stopped by adding an equal volume of 0.2 M NaOH. GAG were isolated by repeated precipitation in 9 vol 95% ethanol and cold carrier [42]. Isolated GAG were identified by agarose electrophoresis of aliquots containing equal amounts of incorporated D-[63 H]-glucosamine, as described [21]. Bands were visualized by autoradiography and normalized to cell protein.

fectorTM ADD-1001 (Program V-01) was performed according to the Amaxa manufacturer’s instructions in RPMI complemented with 2 mM L-glutamine, 1⫻ nonessential amino acids, and 2 mM sodium pyruvate. Transfected cells were transferred into six-well plates and incubated for 3 h under normal cell culture conditions. Media were removed carefully, and cells were differentiated into macrophage-like cells by incubation with 10 nM PMA [44] in RPMI with 5% calf serum for ⬃20 h. To remove PMA, cells were washed once with PBS containing calcium/magnesium and incubated for 24 h in RPMI containing 10% calf serum. After transfection, the fluorescence-labeled si-control (GFP) indicated that ⬃90% of the cells were transfected. Cells were exposed to hypoxia 40 h after transfection and harvested for mRNA after 1, 7, and 24 h.

Western blots for HIF-1␣ Cells transfected with siHIF-1␣ or si-control were incubated for 7 h under normal or hypoxic conditions. The HIF-1␣ protein was isolated by nuclear extraction followed by immunoprecipitation. Protein content was evaluated by immunoblotting [45].

Data analysis Autoradiographs of the gels were evaluated with a Bio-Rad molecular imager system and Quantity One software or with Fuji Image Reader FLA-3000 Fujifilm and Multi Gauge V2.2. Values are presented as mean ⫾ sem. Significance of differences was determined with paired t-tests or with Wilcoxon’s signed rank test. P ⬍ 0.05 was considered statistically significant.

RESULTS

Hypoxia increased the motility of HMDM The nondirected motility of HMDM after exposure to hypoxia was 16 ⫾ 9% higher than that of HMDM incubated in normal cell culture conditions. Furthermore, the motility of HMDM after exposure to hypoxia was increased additionally by 11 ⫾ 3% after degradation of heparan GAG by heparinase treatment, compared with HMDM exposed to hypoxia but not treated with the enzyme (Fig. 1).

HMDM incubation at increased glucose concentration To evaluate if the potential decrease in glucose concentration at hypoxia could be involved in the down-regulation of HSPG, cells were incubated in 22 mM D(⫹)-glucose monohydrate and compared with RPMI 1640 (11 mM glucose) after 24 h exposure to normal cell culture condition or hypoxia.

siHIF-1␣ targeting THP-1 cells (American Type Culture Collection, Manassas, VA, USA) were cultured in RPM1 1640 containing 10% calf serum, 100 U/mL penicillin, 2 mM L-glutamine, 1⫻ nonessential amino acids, 2 mM sodium pyruvate, and 0.05 mM 2-ME. Cells were split 3 days before use in experiments. Cell viability and potential cytotoxic effects of the hypoxic culture condition were established by measuring LDH leakage in a Cobas Bio autoanalyzer [43]. THP-1 cells (1⫻106/transfection) were dissolved in 100 ␮L nucleofector solution (Cell Line Nucleofector Kit V) and mixed with 50 nM validated siHIF-1␣, si-control, or 5 ␮g GFP pMax. Electrophoresis with Nucleo-

www.jleukbio.org

Figure 1. Hypoxia increased the nondirected motility of macrophages. HMDM were differentiated in HTS FluoroBlock 24-Multiwell Insert System plates and exposed to 24 h of 21% O2 (normal cell culture condition) or 0.5% O2 (hypoxia). Cells were labeled with Calcein followed by 6 h incubation at 21% O2 or 0.5% O2 (hypoxia). Fluorescence from cells that moved through the filter membrane during the 6 h was measured from the bottom of the plates with a Victor II plate reader (mean⫾sem, n⫽23). Heparinase I, II, and III (hep.) were added at the same time as Calcein (mean⫾sem, n⫽5).



3

and heparitinase showed a decrease in the intensity of the 100kDa band and increased intensity of the smaller bands (Fig. 3C). No protein bands for syndecan-1 were observed in the cell culture medium (data not shown). Western blots of cell lysates using antibodies against syndecan-4 showed one band at ⬃50 kDa and in some donors, a weaker band at ⬃37 kDa (a representative gel is shown in Fig. 3D). The intensity of the 50-kDa band was not affected by hypoxia in HMDM from 10 individual donors.

Hypoxia decreased cell-bound HS GAG

Figure 2. Hypoxia decreased mRNA expression of syndecan-1 and -4 core proteins. mRNA expression was measured after 24 h incubation at 21% O2 (normal cell culture condition) or 0.5% O2 (hypoxia). Data are normalized to ␤-actin expression. Values are mean ⫾ sem of n ⫽ 5–9. Concentration of lactate dehydrogenase measured in cell lysate and medium over time under normal (21% O2) or hypoxic (0.5% O2) conditions.

Hypoxia decreased syndecan-1 and -4 mRNA expression mRNA expression of cell-associated PG was measured. HMDM expressed syndecan-1, -2, and -4 and glypican mRNA under normal (21% O2) and hypoxic (0.5% O2) conditions. However, the expression of syndecan-1 and -4 was significantly lower in hypoxia (Fig. 2).

Hypoxia decreased cellular content of syndecan-1 protein Western blots of cell lysates using antibodies against syndecan-1 detected bands at ⬃100, ⬃70, and ⬃55 kDa (a representative gel is shown in Fig. 3A). The intensity of the 100-kDa band was 12 ⫾ 5% lower in lysates from hypoxic HMDM compared with cells cultured under normal conditions (Fig. 3B). Western blots of samples digested with chondroitinase ABC

In isolated, metabolically labeled GAG chains from cell lysates of HMDM exposed to hypoxia and normal conditions, we observed that hypoxia reduced the HS content significantly but did not affect the CS ⫹ DS content (Fig. 4, A and B). The ratio of (CS⫹DS):HS was 1.85 in hypoxic HMDM compared with 1.56 in normal, cultured cells (mean n⫽8, P⫽0.04).

Hypoxia decreased mRNA expression of enzymes involved in HS biosynthesis To explore if hypoxia affected the expression of enzymes involved in the biosynthesis of HS GAG chains, the mRNA expression of six key enzymes was evaluated. It was found that all enzymes, with the exception of EXTL2, were reduced in HMDM exposed to hypoxia compared with normal culture condition (Fig. 5).

Hypoxic effects on HSPG appear not to be regulated by glucose availability To explore if glucose availability was associated with the decreased HSPG synthesis in hypoxia, HMDM were exposed to 22 mM glucose and compared with 11 mM (glucose concentration in RPMI 1640). Measurements of mRNA expression of syndecan-1 and -4, EXT2, and HS6ST-1 showed no differences between the two glucose concentrations in hypoxia or normal cell culture conditions (data not shown).

Figure 3. Hypoxia decreased syndecan-1 protein synthesis. Cell lysates were separated on a 10% NuPAGE gel. Western blot analyses for syndecan-1 (A) were performed after 24 h incubation at 21% O2 (normal cell culture condition) and 0.5% O2 (hypoxia), and a representative gel for one donor is shown 21% O2 (21%) and hypoxia (0.5%). (B) The total amount of the 100-kDa band of syndecan-1 at 21% O2 and 0.5% O2. Values are mean ⫾ sem of n ⫽ 11. (C) Syndecan-1 after enzymatic cleavage with chondroitinase ABC and heparitinase and (D) syndecan-4 after 24 h incubation at 21% O2 (21%) and 0.5% O2 (0.5%).



www.jleukbio.org

Asplund et al. Hypoxic changes in macrophage cell-associated proteoglycans

Figure 4. Hypoxia decreased cell-associated HS GAG. PG were metabolically labeled with [35S]-sulfate and D-[6-3H]-glucosamine and isolated from cell lysates after 24 h incubation at 21% O2 (normal cell culture condition) or 0.5% O2 (hypoxia). Radioactive GAG were analyzed by agarose electrophoresis. One representative agarose gel (A) is shown at 21% O2 (21) and hypoxia (0.5). Total CS ⫹ DS and HS were calculated after autoradiography (B). Values are mean ⫾ sem of n ⫽ 8.

HSPG biosynthesis at hypoxia is not regulated by HIF-1␣ In silico analysis of syndecan-1 indicated potential binding sites for oxygen-sensitive transcription factors including HIF-1␣ in a region ⱕ6000 bases upstream of the start codon. To further investigate the potential involvement of HIF-1␣ in the hypoxic regulation of HSPG biosynthesis, we used THP-1 cells as a macrophage model. In these cells, the increase of LDH was ⬍12% in cell lysates and ⬍25% in culture medium after 24 h incubation in hypoxia, confirming that the cell viability of the THP-1 cells was not reduced after 24 h incubation in 0.5% oxygen (Fig. 6A). Expression of syndecan-1 and -4, EXT2, and HS6ST-1 was reduced significantly in THP-1 cells exposed to hypoxia (Fig. 6B). These results indicate that the effects of hypoxia on HSPG in THP-1 cells are similar to those in HMDM, confirming the suitability of THP-1 cells as a macrophage model for HSPG analysis. Transfection of THP-1 cells with siHIF-1␣ decreased the mRNA expression of HIF-1␣ by 61 ⫾ 4% after 1 h exposure to hypoxia and reduced the hypoxia-induced GLUT-1 expression by 42 ⫾ 6% after 7 h exposure to hypoxia (Fig. 6C). Hypoxia increased protein expression of HIF-1␣, and this increase was attenuated in cells transfected with siHIF-1␣ (Fig. 6D). However, transfection with siHIF-1␣ did not affect the mRNA expression of syndecan-1 and -4, EXT2, and HS6ST-1 after 24 h exposure to hypoxia (Fig. 6B). Measurements conducted at shorter times of exposure to hypoxia also showed no effects of siHIF-1␣ (data not shown).

HSPG expression and biosynthesis. In spite of a putative binding site for HIF-1␣ in the promotor region of syndecan-1 core protein, this transcription factor does not appear to be involved in the hypoxic down-regulation of HSPG. Attraction and accumulation of macrophages are important for atherosclerotic plaque development and progression of some tumors [6 – 8]. Cell-bound HSPG are important for cell migration, adhesion, proliferation, receptor interaction, signaling, and coagulation as well as binding and uptake of lipoproteins [21–23]. Macrophages are suggested to be the major cell type responsible for the synthesis of HSPG in cardiovascular diseases [27]. A decreased expression of syndecan is correlated with increased motility of some tumor cells [29, 31], and overexpression of syndecan has been shown previously to inhibit cell motility in Chinese hamster ovary-K1 cells [32]. The aim of this study was to investigate the role of hypoxia on the general macrophage motility in response to changes in cell-associated HSPG. We found that hypoxia increased the nondirected motility of HMDM and investigated the potential role of HSPG in this process. Our results showed that the motility was increased further after enzymatic reduction of HS after hypoxic incubation compared with cells in hypoxia alone. Others [29 – 31] have observed increased cell motility upon heparanase treatment. We found that the mRNA expression of syndecan-1 was decreased in hypoxia compared with normal cell culture conditions and that there was a significant decrease of the ⬃100kDa immunoreactive syndecan-1 protein product. This is the size described for syndecan-1 with attached GAG chains [46]. The predicted protein size for syndecan-1 is 90 kDa, but because of differences in the number of GAG chain attachments and core protein self-associations, the apparent molecular mass on SDS-PAGE is normally larger than 90 kDa [47]. We found that enzymatic degradation increased the intensity of two smaller immune-reactive bands (70 kDa and ⬃55 kDa),

DISCUSSION In the present study, we observed that hypoxia increased the nondirected motility of HMDM, which could be increased further by enzymatic removal of the HS GAG chains. This effect correlated with a hypoxia-induced reduction of cell-associated

www.jleukbio.org

Figure 5. Hypoxia down-regulated the mRNA expression of key enzymes involved in the HS biosynthesis. mRNA expression was measured after 24 h incubation at 21% O2 (normal cell culture condition) or 0.5% O2 (hypoxia). Data are normalized to ␤-actin expression. Values are mean ⫾ sem of n ⫽ 6 –7.



5

Figure 6. Silencing of HIF-1␣ in THP-1 cells did not affect the expression of syndecan-1 and -4 or key enzymes. (A) Concentration of lactate dehydrogenase measured in cell lysates and medium from THP-1 cells over time under normal (21% O2) or hypoxic (0.5% O2) conditions. Values are means of n ⫽ 3. (B) mRNA expression of HIF-1␣ and GLUT-1 after siHIF-1␣ or si-control. mRNA expression was measured after 24 h incubation at 21% (normal cell culture condition) or 0.5% O2 (hypoxia). Data are normalized to ␤-actin expression. Values are means ⫾ sem of n ⫽ 5. (C) Cells transfected with siHIF-1␣ or si-control were incubated for 7 h under normal or hypoxic conditions. The HIF-1␣ protein was isolated by nuclear extraction, immunoprecipitated, and evaluated by Western blots. One representative gel is shown (two individual experiments). No differences in actin levels were detected between samples. (D) mRNA expression of syndecans and key enzymes in THP-1 cells after 24 h incubation at 21% O2 and hypoxia with and without siHIF-1␣. Data are normalized to ␤-actin expression, and values are means ⫾ sem of n ⫽ 4 –5.

indicating that these bands may also represent syndecan-1 but with fewer GAG chains attached. This is consistent with previous reports of syndecan-1 degradation products found in fibroblast and macrophages [13, 46]. The extracellular ectodomain of syndecans can be cleaved proteolytically (i.e., shedded) and released to the ECM, resulting in a rapid reduction of cell surface HS [48]. However, we were not able to detect syndecan-1 protein in the cell culture medium in Western blots. This suggests that shedding activity is not responsible for the decreased amount of HSPG on the cell surface in hypoxia. On the other hand, it is possible that shedding followed by rapid degradation of the core protein could have occurred. The mRNA expression of syndecan-4 was also decreased in hypoxia but to a smaller extent than that which was observed for syndecan-1. Syndecan-4 induction in response to hypoxia has been found in various cell types [49], although the effect on macrophages has not been investigated to our knowledge. We detected two bands for syndecan-4 protein with the specific antibody on Western blots: one band of ⬃50 kDa and in some donors, a band with the predicted size of ⬃37 kDa [47]. In macrophages, bands of ⬃60 kDa and ⬃35 kDa have been reported for syndecan-4 [13]. However, no significant reduction of syndecan-4 protein was detected upon hypoxic treat6 Journal of Leukocyte Biology


ment, which might reflect the small reduction in mRNA expression in hypoxia. The synthesis of HS GAG involves a number of enzymes that determine the chain length and sulfation (for review, see ref. [50]). Our results indicate that hypoxia not only decreased the syndecan-1 core protein but also inhibited the expression of several enzymes involved in HS synthesis and polymerization (EXT1 and EXT2) and others involved in sulfation (NDST-1, HS2ST-1, HS3ST-1, and HS6ST-1). Little is known about the complex regulation of HS biosynthesis, its effect on the structural properties of GAG, and how this modulates its function. However, growth factor-mediated effects on cells have been shown to require specific HS sulfation of HSPG [51, 52]. EXT1 and EXT2 have been described as tumor-suppressor genes [53], and structural HS changes have been found in various cancer cells during malignant transformation (for review, see ref. [54]). Our results indicate that the hypoxia-induced reduction in expression of enzymes involved in HS biosynthesis could be related to the relative reduction of HS in the cellassociated GAG observed in cell lysates of hypoxia-exposed cells. The mechanism by which hypoxia regulates HSPG biosynthesis is not known, but oxygen-sensitive transcription factors

www.jleukbio.org

Asplund et al. Hypoxic changes in macrophage cell-associated proteoglycans

or metabolic changes associated with anaerobic metabolism are likely candidates. Glucose concentration has been reported to be involved in HSPG regulation in endothelial cells [55]. Therefore, we tested the hypothesis that a decrease in glucose levels in hypoxia might be involved in the down-regulation of HSPG. However, our results did not support that notion. HIF-1␣ is known as the main controller of the cellular response to hypoxia and has been shown to be involved in motility in hypoxic macrophages [56] and to regulate HS synthesis in endothelial cells [57]. We found in THP-1 cells that a significant reduction of HIF-1␣ expression accompanied with reduced expression of GLUT-1 did not affect the expression of syndecan-1 and -4 or the enzymes involved in the HS biosynthesis—EXT2 and HS6ST-1. Therefore, our results do not support the notion that HIF-1␣ is involved in the regulation of HSPG in hypoxic macrophages. This suggests that other oxygen-sensitive transcription factors, such as AP-1, specificity protein-1, and NF-␬B, may be involved in the hypoxia-induced effects on HSPG in HMDM. Several mechanisms are involved in controlling monocyte and macrophage motility in response to hypoxia, and clusters of genes coding for inflammatory cytokines, chemokines, and growth factors are induced or changed (for review, see ref. [58]). These hypoxia-induced inflammatory mediators have been shown to inhibit and induce macrophage motility. The different response could be a result of the fact that different cell types have unique responses to acute hypoxia and to chronic hypoxia. The mechanism behind the increased motility of cells upon HSPG reduction may involve the reduced capacity of cell-associated HSPG to bind and control growth factors, cytokines, and chemokines [24]. Cell-associated HSPG also contribute to focal adhesion, and a reduction of HSPG by hypoxia could be expected to decrease cell attachment to ECM and thereby enhance the motility of cells [59, 60]. In conclusion, our results suggest that oxygen tension is of importance for the regulation of cell-associated HSPG production and expression in macrophages. Given the multiple functions of HSPG in macrophage behavior, this observed phenomena may be of importance in processes such as atherosclerosis and tumor growth, which are accompanied by hypoxia, and these cells have important functions.

ACKNOWLEDGMENTS This work was supported by the ALF grant of Sahlgrenska University Hospital and grants from the Heart and Lung Foundation and AstraZeneca. We thank Jonatan Moses for his contributions to the initial planning of the study. We also thank Christina Nodin and Maria Ha¨gg for technical advice and Rosie Perkins for editing the manuscript.

REFERENCES

1. Levin, M., Bjornheden, T., Evaldsson, M., Walenta, S., Wiklund, O. (1999) A bioluminescence method for the mapping of local ATP concentrations within the arterial wall, with potential to assess the in vivo situation. Arterioscler. Thromb. Vasc. Biol. 19, 950 –958. 2. Bjornheden, T., Levin, M., Evaldsson, M., Wiklund, O. (1999) Evidence of hypoxic areas within the arterial wall in vivo. Arterioscler. Thromb. Vasc. Biol. 19, 870 – 876.

www.jleukbio.org

3. Burke, B., Giannoudis, A., Corke, K. P., Gill, D., Wells, M., Ziegler-Heitbrock, L., Lewis, C. E. (2003) Hypoxia-induced gene expression in human macrophages: implications for ischemic tissues and hypoxia-regulated gene therapy. Am. J. Pathol. 163, 1233–1243. 4. Leek, R. D., Landers, R. J., Harris, A. L., Lewis, C. E. (1999) Necrosis correlates with high vascular density and focal macrophage infiltration in invasive carcinoma of the breast. Br. J. Cancer 79, 991–995. 5. Lewis, J. S., Lee, J. A., Underwood, J. C., Harris, A. L., Lewis, C. E. (1999) Macrophage responses to hypoxia: relevance to disease mechanisms. J. Leukoc. Biol. 66, 889 –900. 6. Knehr, H. E., Heinle, H., Betz, E. (1980) Enhanced oxygen uptake and lactate production of smooth muscle cell proliferates of rabbit carotid arteries. Pflugers Arch. 387, 73–77. 7. Bjornheden, T., Bondjers, G. (1987) Oxygen consumption in aortic tissue from rabbits with diet-induced atherosclerosis. Arteriosclerosis 7, 238 –247. 8. Kelly, P. M., Davison, R. S., Bliss, E., McGee, J. O. (1988) Macrophages in human breast disease: a quantitative immunohistochemical study. Br. J. Cancer 57, 174 –177. 9. Lewis, C., Murdoch, C. (2005) Macrophage responses to hypoxia: implications for tumor progression and anti-cancer therapies. Am. J. Pathol. 167, 627– 635. 10. Kolset, S. O., Salmivirta, M. (1999) Cell surface heparan sulfate proteoglycans and lipoprotein metabolism. Cell. Mol. Life Sci. 56, 857– 870. 11. Tkachenko, E., Rhodes, J. M., Simons, M. (2005) Syndecans: new kids on the signaling block. Circ. Res. 96, 488 –500. 12. Woods, A. (2001) Syndecans: transmembrane modulators of adhesion and matrix assembly. J. Clin. Invest. 107, 935–941. 13. Clasper, S., Vekemans, S., Fiore, M., Plebanski, M., Wordsworth, P., David, G., Jackson, D. G. (1999) Inducible expression of the cell surface heparan sulfate proteoglycan syndecan-2 (fibroglycan) on human activated macrophages can regulate fibroblast growth factor action. J. Biol. Chem. 274, 24113–24123. 14. Manakil, J. F., Sugerman, P. B., Li, H., Seymour, G. J., Bartold, P. M. (2001) Cell-surface proteoglycan expression by lymphocytes from peripheral blood and gingiva in health and periodontal disease. J. Dent. Res. 80, 1704 –1710. 15. Saphire, A. C., Bobardt, M. D., Zhang, Z., David, G., Gallay, P. A. (2001) Syndecans serve as attachment receptors for human immunodeficiency virus type 1 on macrophages. J. Virol. 75, 9187–9200. 16. Makatsori, E., Lamari, F. N., Theocharis, A. D., Anagnostides, S., Hjerpe, A., Tsegenidis, T., Karamanos, N. K. (2003) Large matrix proteoglycans, versican and perlecan, are expressed and secreted by human leukemic monocytes. Anticancer Res. 23, 3303–3309. 17. Yeaman, C., Rapraeger, A. C. (1993) Membrane-anchored proteoglycans of mouse macrophages: P388D1 cells express a syndecan-4-like heparan sulfate proteoglycan and a distinct chondroitin sulfate form. J. Cell. Physiol. 157, 413– 425. 18. Carey, D. J. (1997) Syndecans: multifunctional cell-surface co-receptors. Biochem. J. 327, 1–16. 19. Sasisekharan, R., Moses, M. A., Nugent, M. A., Cooney, C. L., Langer, R. (1994) Heparinase inhibits neovascularization. Proc. Natl. Acad. Sci. USA 91, 1524 –1528. 20. Taylor, K. R., Gallo, R. L. (2006) Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of inflammation. FASEB J. 20, 9 –22. 21. Fager, G., Camejo, G., Olsson, U., Ostergren-Lunden, G., Lustig, F., Bondjers, G. (1995) Binding of platelet-derived growth factor and low density lipoproteins to glycosaminoglycan species produced by human arterial smooth muscle cells. J. Cell. Physiol. 163, 380 –392. 22. Jackson, R. L., Busch, S. J., Cardin, A. D. (1991) Glycosaminoglycans: molecular properties, protein interactions, and role in physiological processes. Physiol. Rev. 71, 481–539. 23. Kjellen, L., Lindahl, U. (1991) Proteoglycans: structures and interactions. Annu. Rev. Biochem. 60, 443– 475. 24. Whitelock, J. M., Iozzo, R. V. (2005) Heparan sulfate: a complex polymer charged with biological activity. Chem. Rev. 105, 2745–2764. 25. Li, J., Brown, L. F., Laham, R. J., Volk, R., Simons, M. (1997) Macrophage-dependent regulation of syndecan gene expression. Circ. Res. 81, 785–796. 26. Wang, W., Haller, C. A., Wen, J., Wang, P., Chaikof, E. L. (2008) Decoupled syndecan 1 mRNA and protein expression is differentially regulated by angiotensin II in macrophages. J. Cell. Physiol. 214, 750 –756. 27. Wen, J., Wang, P., Smith, S. V., Haller, C. A., Chaikof, E. L. (2007) Syndecans are differentially expressed during the course of aortic aneurysm formation. J. Vasc. Surg. 46, 1014 –1025. 28. Fears, C. Y., Woods, A. (2006) The role of syndecans in disease and wound healing. Matrix Biol. 25, 443– 456. 29. Moon, J. J., Matsumoto, M., Patel, S., Lee, L., Guan, J. L., Li, S. (2005) Role of cell surface heparan sulfate proteoglycans in endothelial cell migration and mechanotransduction. J. Cell. Physiol. 203, 166 –176. 30. Parish, C. R., Freeman, C., Hulett, M. D. (2001) Heparanase: a key enzyme involved in cell invasion. Biochim. Biophys. Acta 1471, M99 –108. 31. Takahashi, H., Matsumoto, H., Smirkin, A., Itai, T., Nishimura, Y., Tanaka, J. (2008) Involvement of heparanase in migration of microglial cells. Biochim. Biophys. Acta 1780, 709 –715.



7

32. Longley, R. L., Woods, A., Fleetwood, A., Cowling, G. J., Gallagher, J. T., Couchman, J. R. (1999) Control of morphology, cytoskeleton and migration by syndecan-4. J. Cell Sci. 112, 3421–3431. 33. Burke, B., Tang, N., Corke, K. P., Tazzyman, D., Ameri, K., Wells, M., Lewis, C. E. (2002) Expression of HIF-1␣ by human macrophages: implications for the use of macrophages in hypoxia-regulated cancer gene therapy. J. Pathol. 196, 204 –212. 34. Sowter, H. M., Raval, R. R., Moore, J. W., Ratcliffe, P. J., Harris, A. L. (2003) Predominant role of hypoxia-inducible transcription factor (Hif)-1␣ versus Hif-2␣ in regulation of the transcriptional response to hypoxia. Cancer Res. 63, 6130 – 6134. 35. Bøyum, A. (1976) Isolation of lymphocytes, granulocytes and macrophages. Scand. J. Immunol. 5 (Suppl.), 9 –15. 36. Svensson, L., Camejo, G., Cabre, A., Vallve, J. C., Pedreno, J., Noren, K., Wiklund, O., Hulten, L. M. (2003) Fatty acids modulate the effect of darglitazone on macrophage CD36 expression. Eur. J. Clin. Invest. 33, 464 – 471. 37. Rydberg, E. K., Krettek, A., Ullstrom, C., Ekstrom, K., Svensson, P. A., Carlsson, L. M., Jonsson-Rylander, A. C., Hansson, G. I., McPheat, W., Wiklund, O., Ohlsson, B. G., Hulteń, L. M. (2004) Hypoxia increases LDL oxidation and expression of 15-lipoxygenase-2 in human macrophages. Arterioscler. Thromb. Vasc. Biol. 24, 2040 –2045. 38. Rydberg, E. K., Salomonsson, L., Hulteń, L. M., Noreń, K., Bondjers, G., Wiklund, O., Bjo¨rnheden, T., Ohlsson, B. G. (2003) Hypoxia increases 25-hydroxycholesterol-induced interleukin-8 protein secretion in human macrophages. Atherosclerosis 170, 245–252. 39. Frevert, C. W., Wong, V. A., Goodman, R. B., Goodwin, R., Martin, T. R. (1998) Rapid fluorescence-based measurement of neutrophil migration in vitro. J. Immunol. Methods 213, 41–52. 40. Filmus, J., Selleck, S. B. (2001) Glypicans: proteoglycans with a surprise. J. Clin. Invest. 108, 497–501. 41. Stillemark, P., Boren, J., Andersson, M., Larsson, T., Rustaeus, S., Karlsson, K. A., Olofsson, S. O. (2000) The assembly and secretion of apolipoprotein B-48-containing very low density lipoproteins in McA-RH7777 cells. J. Biol. Chem. 275, 10506 –10513. 42. Turnbull, J. E., Lyon, M., et al. (1995) Structural Analysis of Glycosaminoglycans. Extracellular Matrix: A Practical Approach, Oxford, UK, IRL. 43. (1974) Recommended methods for the determination of four enzymes in blood. Scand. J. Clin. Lab. Invest. 33, 291–306. 44. Schwende, H., Fitzke, E., Ambs, P., Dieter, P. (1996) Differences in the state of differentiation of THP-1 cells induced by phorbol ester and 1,25dihydroxyvitamin D3. J. Leukoc. Biol. 59, 555–561. 45. Hagg, M., Wennstrom, S. (2005) Activation of hypoxia-induced transcription in normoxia. Exp. Cell Res. 306, 180 –191. 46. Yeaman, C., Rapraeger, A. C. (1993) Post-transcriptional regulation of syndecan-1 expression by cAMP in peritoneal macrophages. J. Cell Biol. 122, 941–950. 47. Woods, A., Couchman, J. R. (1998) Syndecans: synergistic activators of cell adhesion. Trends Cell Biol. 8, 189 –192. 48. Kim, C. W., Goldberger, O. A., Gallo, R. L., Bernfield, M. (1994) Members of the syndecan family of heparan sulfate proteoglycans are ex-



49.

50. 51.

52. 53.

54. 55.

56.

57.

58.

59.

60.

pressed in distinct cell-, tissue-, and development-specific patterns. Mol. Biol. Cell 5, 797– 805. Kojima, T., Takagi, A., Maeda, M., Segawa, T., Shimizu, A., Yamamoto, K., Matsushita, T., Saito, H. (2001) Plasma levels of syndecan-4 (ryudocan) are elevated in patients with acute myocardial infarction. Thromb. Haemost. 85, 793–799. Lindahl, U., Kusche-Gullberg, M., Kjellen, L. (1998) Regulated diversity of heparan sulfate. J. Biol. Chem. 273, 24979 –24982. Robinson, C. J., Mulloy, B., Gallagher, J. T., Stringer, S. E. (2006) VEGF165-binding sites within heparan sulfate encompass two highly sulfated domains and can be liberated by K5 lyase. J. Biol. Chem. 281, 1731– 1740. Turnbull, J. E., Fernig, D. G., Ke, Y., Wilkinson, M. C., Gallagher, J. T. (1992) Identification of the basic fibroblast growth factor binding sequence in fibroblast heparan sulfate. J. Biol. Chem. 267, 10337–10341. Hecht, J. T., Hogue, D., Strong, L. C., Hansen, M. F., Blanton, S. H., Wagner, M. (1995) Hereditary multiple exostosis and chondrosarcoma: linkage to chromosome II and loss of heterozygosity for EXT-linked markers on chromosomes II and 8. Am. J. Hum. Genet. 56, 1125–1131. Sanderson, R. D., Yang, Y. (2008) Syndecan-1: a dynamic regulator of the myeloma microenvironment. Clin. Exp. Metastasis 25, 149 –159. Gharagozlian, S., Borrebaek, J., Henriksen, T., Omsland, T. K., Shegarfi, H., Kolset, S. O. (2006) Effect of hyperglycemic condition on proteoglycan secretion in cultured human endothelial cells. Eur. J. Nutr. 45, 369 – 375. Cramer, T., Yamanishi, Y., Clausen, B. E., Forster, I., Pawlinski, R., Mackman, N., Haase, V. H., Jaenisch, R., Corr, M., Nizet, V., Firestein, G. S., Gerber, H. P., Ferrara, N., Johnson, R. S. (2003) HIF-1␣ is essential for myeloid cell-mediated inflammation. Cell 112, 645– 657. Li, J., Shworak, N. W., Simons, M. (2002) Increased responsiveness of hypoxic endothelial cells to FGF2 is mediated by HIF-1␣-dependent regulation of enzymes involved in synthesis of heparan sulfate FGF2-binding sites. J. Cell Sci. 115, 1951–1959. Bosco, M. C., Puppo, M., Blengio, F., Fraone, T., Cappello, P., Giovarelli, M., Varesio, L. (2008) Monocytes and dendritic cells in a hypoxic environment: spotlights on chemotaxis and migration. Immunobiology 213, 733–749. Reiland, J., Sanderson, R. D., Waguespack, M., Barker, S. A., Long, R., Carson, D. D., Marchetti, D. (2004) Heparanase degrades syndecan-1 and perlecan heparan sulfate: functional implications for tumor cell invasion. J. Biol. Chem. 279, 8047– 8055. Sanderson, R. D. (2001) Heparan sulfate proteoglycans in invasion and metastasis. Semin. Cell Dev. Biol. 12, 89 –98.

KEY WORDS: leukocytes 䡠 oxygen deprivation 䡠 membrane-sulfated polysaccharides

www.jleukbio.org