Identification a coat protein region of cucumber mosaic virus (CMV ...

Arch Virol (2011) 156:2279–2283 DOI 10.1007/s00705-011-1104-y

BRIEF REPORT

Identification a coat protein region of cucumber mosaic virus (CMV) essential for long-distance movement in cucumber ´ kos Gelle´rt Katalin Salańki • La´szlo´ Kiss • A Ervin Bala´zs

•

Received: 21 May 2011 / Accepted: 2 September 2011 / Published online: 17 September 2011 Ó Springer-Verlag 2011

Abstract To characterise the long-distance movement determinant of cucumoviral coat proteins (CPs), five mutants were engineered into the CMV CP bearing the corresponding tomato aspermy virus (TAV) loops exposed on the surface of the virion. Both viruses can move longdistance in Nicotiana clevelandii, but only CMV can move long-distance in cucumber. Investigation of the CMV chimeras identified three amino acids of the bB-bC loop that were essential for the CMV long-distance movement in cucumber. Introducing these mutations into the TAV CP was not sufficient for long-distance movement, indicating that this is not the sole region causing long-distance movement deficiency.

Cucumber mosaic virus (CMV) belongs to the genus Cucumovirus in the family Bromoviridae and has an extremely wide host range, infecting more than 800 plant species systemically. The genome of CMV consists of three positive-sense genomic RNAs, designated RNAs 1-3.

K. Salańki (&) L. Kiss Agricultural Biotechnology Center, Szent-Gyo¨rgyi Albert u. 4, Go¨do¨ll}o 2100, Hungary e-mail: [email protected] L. Kiss Department of Plant Pathology, Corvinus University of Budapest, Meńesi Road 44., Budapest 1118, Hungary e-mail: [email protected] ´ . Gelle´rt E. Bala´zs A Agricultural Research Institute of the Hungarian Academy of Sciences, Brunszvik u. 2., Martonva´sa´r 2462, Hungary e-mail: [email protected] E. Bala´zs e-mail: [email protected]

The 1a and 2a proteins encoded by RNAs 1 and 2 form the replication complex. RNA 2 encodes a second protein called 2b, which is responsible for the suppression of posttranscriptional gene silencing and also has a role in the long-distance movement of cucumoviruses on some hosts. RNA 3 codes for the 3a protein, known as the movement protein (MP) of the virus, and the coat protein (CP) [13]. Systemic infection of a plant is a multiple-step process involving replication in the initially infected cells, cell-tocell movement to the surrounding cells, and long-distance movement through the phloem. Although cell-to-cell and systemic movement of cucumoviruses have been extensively investigated, the details of these processes and the precise roles of the viral proteins and host factors are still not fully understood. Almost all of the viral proteins have been shown to affect one or both of these processes [13]. In cell-to-cell movement, the virus is thought to move across the plasmodesmata in the form of a ribonucleoprotein complex, and the presence of both the MP and the CP is essential [20]. The MP is an RNA-binding protein with plasmodesmata-gating abilities, and it is able to promote the movement of itself and RNA through plasmodesmata [1, 7, 24]. The role of the CP in cell-to-cell movement remains unclear even though it is indispensable [5] and compatibility with the MP is required [8, 17]. A direct interaction between the MP and the 2a protein has also been demonstrated, suggesting a role of the 2a protein in cell-to-cell movement [4]. Less information is available concerning to the longdistance movement of cucumoviruses. CMV is thought to move through the vasculature in the form of virus particles, since formation of virions is necessary for long-distance movement [5, 18]. Direct evidence for this hypothesis was obtained by electron microscopy analysis of phloem exudate from CMV-infected samples, and a specific interaction

123

K. Salańki et al.

2280

Fig. 1 Construction and infectivity of CP loop mutants. A Ribbon diagram of the B subunit of the R-CMV CP model with labelled b-strands, a-helices and loops. b-strands, a-helices and coils are coloured gray, while colourings of the labelled loops are indicated in the right panel. The loop sequences of P-TAV CP and R-CMV CP are also presented in the right panel. The colour codes for the amino acid sequence background shading are as follows: light blue, where the aa sequence is identical between the P-TAV and R-CMV CP; basic

123

pR3-CMV

pβH-βI loop

pβF-βG loop

pβE-αEF loop

pβD-βE loop

B

pβB-βC loop

A

R-CMV RNA3 (pR3) cDNA clone, essentially as described earlier [17]. All oligonucleotides contained restriction endonuclease sites, resulting in silent mutations (Table 1). For exclusion of inadvertent nucleotide exchanges, all PCR-generated mutants were sequenced. In vitro transcription of the R-CMV RNA1 and RNA 2 (pR1, pR2) clones and the RNA3 mutant clones, as well as plant inoculations, were carried out according to Salańki et al. [16]. The different chimeric in vitro transcripts from the mutated clones were inoculated on Nicotiana clevelandii plants at the six-leaf stage in the presence of the R-CMV RNA 1 and 2 transcripts. All of the mutant viruses were infectious on this host, with systemic symptoms appearing 5-6 days after the inoculation. The different viruses were purified according to Lot et al. [9], except for the bD-bE loop mutant. In this case, a TAV-specific purification protocol proved to be efficient [3]. The nucleic acid sequence analysis of the RT-PCR products encoding the coat proteins of the different mutants proved that all of the mutants retained the introduced mutations. Fully expanded cotyledons of fifteen cucumber plants (cv. Delicates) were inoculated with purified virions. The infection process was followed by visual observation of symptoms and northern analysis. Local lesions were observed on all the infected plants 3-5 days after inoculation, indicating that local infection had occurred in all cases. This observation is in good agreement with previous results showing that TAV CP is able to promote cell-to-cell movement of the virus on cucumber [16, 21]. Systemic symptoms were observed eight days after the inoculation on the plants infected with the bD-bE, bE-aEF, bF-bG and Mock inoculated

with the phloem exudate protein p48 was also demonstrated in cucumber [14]. Both the MP and the CP have strain-specific determinants for long-distance movement [6, 15], and the 1a protein has also been implicated in the regulation of systemic spread [13]. In comparing virus movement between different cucumoviruses, namely CMV and TAV, striking differences were observed in the systemic movement on cucumber. While CMV infects cucumber systemically, different TAV isolates do not. Some TAV isolates induce local infection, and the bundle sheath-phloem interface appears to act as a barrier for systemic infection [23]. Other TAV isolates replicate in cucumber protoplasts but do not even move cell-to-cell in plants due to RNA 1 and/or 2 [16]. Deficiency in longdistance movement has also been shown to be connected to the CP [16, 21]. In this study, we have analysed the structural motifs of the CP responsible for long-distance movement. The three-dimensional structures of both the CMV and the TAV CP are available and show a high degree of similarity [10, 19]. Since CMV is known to move longdistance as a virus particle, the five loops of the CP identified on the surface of the particle were replaced one by one with the corresponding loops from TAV. Five CP loop mutants were engineered on the basis of the amino acid (aa) differences of the coat protein loops between P-TAV and R-CMV. In the bB-bC loop, 5 aa; in the bD-bE loop, 2 aa; in the bE-aEF loop, 7 aa; in the bF-bG loop, 5 aa; and in the bH-bI loop, 3 aa were altered from the R-CMV sequence to the P-TAV sequence (Fig. 1A). All mutants were constructed by PCR-mediated mutagenesis using the

amino acids (Arg and Lys), blue; acidic amino acids (Asp and Glu), red; polar amino acids (Asn, Ser, Thr), orange; hydrophobic amino acids (Ala, Gly, Ile, Leu, Met, Pro, Val), gray. B Northern blot hybridization analysis of non-inoculated, systemically infected leaves of cucumber. The radiolabelled probe was specific for the 30 -terminal noncoding region of R-CMV RNA 3. RNAs 1, 2, 3 and 4 are indicated. Ethidium bromide–stained rRNA from the same volume of each sample is shown below each lane

Long-distance movement of cucumber mosaic virus in cucumber

2281

Table 1 Oligonucleotide primers used for site-directed mutagenesis Mutant clone

Forward oligonucleotide primer (50 –30 )a

Reverse oligonucleotide primer (50 –30 )a

Endonuclease recognition site

ßB-ßC loop

ggaGGccTActAGaaCtgagaaagAttcatattttgg

ggAggCCtcagggtaatagatgtgaaagtg

StuI SnaBI

ßD-ßE loop

ggtacgtattaatcctAGCccgaaatttAattc

ggtacgtatttgaatgcgcgaaac

ßE-aEF loop

ggAcTAGTgccgccatcactgctatg

gcACTAgTaagaAGggTtgTtTCaTCtactttccgaactgtaaccc

SpeI

ßF-ßG loop

cggGAtCcagCccaacaataagttactc

cgGgaTCccggTcgGaAcatactgataaacc

BamHI

ßH-ßI loop

aactCgagGCggacgagatGgtac

ttctcGagtACatcgtctttcgagtaaaccagg

XhoI

pR3K76R

tgaGGccTcctgaaattgagaaaggttc

ggaGGccTcagggtaatagatgtgaaagtg

StuI

pR3P78T pR3E79R

ccactagtattaccctgaaaccgActgaaattgag ccactagtattaccctgaaaccgcctAGaattgag

ggactagtgaaagtgtaaccgggtttacag ggactagtgaaagtgtaaccgggtttacag

SpeI SpeI

pR3EI7980RT

ccactagtattaccctgaaaccgcctAGaaCtgag

ggactagtgaaagtgtaaccgggtttacag

SpeI

pR3G83D

ggactagtattaccctgaaaccgcctgaaattgagaaagAttca


SpeI

pR3PEI7880TRT

ccactagtattaccctgaaaccgActAGaaCtgag


SpeI

pR3E79A

ccactagtattaccctgaaaccgcctgCaattgag


SpeI

pT3TRT7880PEI

caaaagcttcggtcaaaggttaattatccc

ccgaagcttttgtccttctcaAttTCagGcggtcgaacatccaacgaag

HindIII

a

Embedded endonuclease recognition sites are underlined. Mutagenized codons are capitalized

bH-bI loop mutants, although in the case of the bE-aEF mutant, the symptoms developed two days later and were milder than for the other infections (data not shown). Mochizuki et al. [12] also showed that a mutant containing a polar acidic residue at aa 129 of CP (located in this loop) induced only pale green mosaic on Nicotiana tabacum cv. Xanthi plants. This phenomenon may be related to the molecular dynamics result that the bE-aEF loop of CMV has higher flexibility than the bE-aEF loop of TAV CP [2]. On the plants infected with the bB-bC loop mutant, systemic symptoms were never observed during four repetitions of the experiment with 15 plants. Northern analysis of the systemically infected leaves 12 days after the inoculation confirmed the presence of the viral RNA in the case of R-CMV and the bD-bE, bE-aEF, bF-bG and bH-bI loop mutants, but no viral RNA could be detected for the bB-bC loop mutant (Fig. 1B). Interestingly, the bD-bE loop mutant showed the highest rate of accumulation, even though there was no significant difference in symptom development between the different mutants. The nucleotide sequence of the CP coding region of the different mutants was analyzed four weeks after inoculation, and no nucleotide sequence alterations were detected. Thompson et al. [22] have also analyzed three of the abovementioned loops by alanine scanning mutagenesis and identified a role of the bD-bE, bH-bI, and bB-bC loops in long-distance movement of Fny-CMV in squash. They observed back mutations in several cases, in contrast to our experiments. Based on our results, we conclude that the bB-bC loop is crucial in the long-distance movement deficiency in the case of TAV CP in cucumber.

There are five amino acids differences between P-TAV and R-CMV in the bB-bC loop (Fig. 1A), and we analysed these differences one by one. Five point mutants were designed bearing a single mutation in pR3 (pR3K76R, pR3P78T, pR3E79R, pR3E79A and pR3G83D), a double mutant (pR3EI79-80RT), and one mutant bearing three amino acid alterations (pR3PEI78-80TRT). The in vitro transcripts of the different mutants were inoculated on N. clevelandii as before along with the R-CMV RNA 1 and 2 transcripts. All of the mutant transcripts were infectious on this host. The symptoms induced by the R3, R3K76R, R3P78T, R3E79A, R3G83D, R3EI79-80RT and R3PEI7880TRT mutants on N. clevelandii were similar to those caused by the original R-CMV strain and appeared 6-8 days after inoculation, while the R3E79R virus caused much stronger symptoms. Northern analysis seven days after the inoculation confirmed the presence of viral RNA in the systematically infected leaves, and nucleotide sequence analysis after RT/PCR demonstrated the stability of the mutations. The mutants were tested for systemic movement on cucumber plants after virus purification. The mutants R3K76R, R3P78T, R3E79A, R3EI79-80RT and R3G83D caused systemic infection on cucumber, but in the case of the R3E79R and R3PEI78-80TRT mutants, only local lesions were detected on the inoculated cotyledons (data not shown). Systemic infection was not observed, and northern analysis confirmed the visual observations (Fig. 2A). Replacing the aa at this position with a more positively charged one (arginine) induced the change of the surface electrostatic potential [11]. The drastic change in the electrostatic potential at position 79 is not correlated

123

with the movement of virus, but this electrostatic change may strongly affect the binding of a P48-like protein that is involved in the long-distance movement in cucumber [14]. Previously, this region of the CP was investigated by alanine-scanning mutagenesis [22], but these three amino acids were not found to be essential for systemic movement on squash. The mutations in these positions did not change (aa 79) or only reduced (aa 78, 80) the infectivity of the chimeric Fny-CMV. This result is in a good agreement with our results, since if alanine was introduced (R3I79A) into this position, the infectivity did not change. However, when other amino acids with different side chains were integrated, it was found that symptoms on Nicotiana benthamiana became much stronger in one case (E79R). In the case of the subgroup II CMV strains, glutamic acid is located in this position while in the case of subgroup I CMV strains, this residue is lysine, and the symptoms are usually stronger with the strains of subgroup I. The symptoms caused by the E79R mutant were even stronger than the typical symptoms caused by subgroup I strains, underlining the importance of the sequence context, even for amino acids with similar chemical properties. In the case of E79R and PEI78-80TRT, the change induced defence in long-distance movement in cucumber, demonstrating the favoured role of this region, not only in longdistance movement but also in symptom induction. Since aa 78-80 are crucial for long-distance movement of CMV, we changed the amino acid sequence TRT located in this position of TAV to the sequence PEI (pT3TRT78-80PEI). Since compatibility of the movement protein and the coat protein of CMV and TAV is required [17], this coat protein mutant was also combined with the CMV movement protein (pRT3TRT78-80PEI). Both of the mutants were infectious on Nicotiana clevelandii in the presence of CMV RNA 1 and 2 transcripts, but systemic infection was not detected on cucumber even 21 days after inoculation (Fig. 2B). Llamas et al. [8] introduced a longer

123

pT3TRT 78-80EI

pR3-CMV

Mock inoculated

pR3E79A

pR3E79R

pR3EI79-80RT

pR3P78T

pR3PEI78-80TRT

pR3K76R

pR3G83D

B pβB-βC loop

A

pR3-CMV

Fig. 2 Northern blot hybridization analysis of total RNAs extracted from noninoculated, systemically infected leaves of cucumber. The radiolabelled probe was specific for A R-CMV CP B R-CMV and P-TAV CP. Ethidium bromide–stained rRNA from the same volume of each sample is shown below each lane

pRT3TRT78-80PEI

K. Salańki et al.

2282

RNA3 RNA4 RNA3 RNA4

region (aa 60-148, including the bB-bC, bD-bE and ßEaEF loops) of Fny-CMV CP into the 1-TAV CP. This recombinant did not induce local and systemic infection on cucumber, and its infectivity was also reduced on tobacco. Amino acids 78, 79 and 80 are localized in the middle of the bB-bC loop on the external surface of the virion, and the chemical properties of these residues are predicted to have a major influence on the structure and chemical properties of the bB-bC loop. This aa triad has an indispensable role in the long-distance movement of cucumoviruses, but this is not the only region responsible for long-distance movement deficiency of TAV on cucumber. Acknowledgments This work was funded by the projects Hungarian Scientific Research Fund OTKA-K75168 and OTKA-NI 61023l. ´ kos Gelle´rt were supported by the Bolyai Jańos Katalin Salańki and A fellowship of the Hungarian Academy of Sciences.

References 1. Ding B, Li Q, Nguyen L, Palukaitis P, Lucas WJ (1995) Cucumber mosaic virus 3a protein potentiates cell-to-cell trafficking of CMV RNA in tobacco plants. Virology 207:345–353 ´ , Bala´zs E (2010) The solution structures of the 2. Gelle´rt A Cucumber mosaic virus and Tomato aspermy virus coat proteins explored with molecular dynamics simulations. J Mol Graph Model 28:569–576 3. Habili N, Francki RI (1974) Comparative studies on tomato aspermy and cucumber mosaic viruses. I. Physical and chemical properties. Virology 57:392–401 4. Hwang MS, Kim SH, Lee JH, Bae JM, Paek KH, Park YI (2005) Evidence for interaction between the 2a polymerase protein and the 3a movement protein of Cucumber mosaic virus. J Gen Virol 86:3171–3177 5. Kaplan IB, Zhang L, Palukaitis P (1998) Characterization of cucumber mosaic virus. V. Cell-to-cell movement requires capsid protein but not virions. Virology 246:221–231 6. Kaplan IB, Gal-On A, Palukaitis P (1997) Characterization of cucumber mosaic virus. III. Localization of sequences in the movement protein controlling systemic infection in cucurbits. Virology 230:343–349

Long-distance movement of cucumber mosaic virus in cucumber 7. Li Q, Palukaitis P (1996) Comparison of the nucleic acid- and NTP-binding properties of the movement protein of cucumber mosaic cucumovirus and tobacco mosaic tobamovirus. Virology 216:71–79 8. Llamas S, Moreno IM, Garcıá-Arenal F (2006) Analysis of the viability of coat-protein hybrids between Cucumber mosaic virus and Tomato aspermy virus. J Gen Virol 87:2085–2088 9. Lot H, Marrou J, Quiot JB, Esvan C (1972) Contribution a´ l’e´tude du virus de la mosaique du concombre (CMV). I. Me´thode de purification rapide du virus. Ann Phytopath 4:25–38 10. Lucas RW, Larson SB, Canady MA, McPherson A (2002) The structure of tomato aspermy virus by X-ray crystallography. J Struct Biol 139:90–102 11. Maestro 9.1 (2010) Schro¨dinger LLC, New York, NY 12. Mochizuki T, Ohki ST (2011) Single amino acid substitutions at residue 129 in the coat protein of cucumber mosaic virus affect symptom expression and thylakoid structure. Arch Virol 156: 881–886 13. Palukaitis P, Garcıá-Arenal F (2003) Cucumoviruses. Adv Virus Res 62:241–323 14. Requena A, Simon-Buela L, Salcedo G, Garcia-Arenal F (2006) Potential involvement of a cucumber homolog of phloem protein 1 in the long-distance movement of Cucumber mosaic virus particles. Mol Plant Microbe Interact 19:734–746 15. Ryabov EV, Roberts IM, Palukaitis P, Taliansky M (1999) Hostspecific cell-to-cell and long-distance movements of cucumber mosaic virus are facilitated by the movement protein of groundnut rosette virus. Virology 260:98–108 16. Salańki K, Carre`re I, Jacquemond M, Bala´zs E, Tepfer M (1997) Biological properties of pseudorecombinant and recombinant

2283

17.

18.

19.

20.

21.

22.

23.

24.

strains created with cucumber mosaic virus and tomato aspermy virus. J Virol 71:3597–3602 ´ , Huppert E, Na´ray-Szabo´ G, Bala´zs E (2004) Salańki K, Gelle´rt A Compatibility of the movement protein and the coat protein of cucumoviruses is required for cell-to-cell movement. J Gen Virol 85:1039–1048 Schmitz I, Rao AL (1998) Deletions in the conserved aminoterminal basic arm of cucumber mosaic virus coat protein disrupt virion assembly but do not abolish infectivity and cell-to-cell movement. Virology 248:323–331 Smith TJ, Chase E, Schmidt T, Perry KL (2000) The Structure of Cucumber mosaic virus and comparison to Cowpea chlorotic mottle virus. J Virol 74:7578–7586 Suzuki M, Kuwata S, Kataoka J, Masuta C, Nitta N, Takanami Y (1991) Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcription system. Virology 183:106–113 Taliansky ME, Garcia-Arenal F (1995) Role of cucumovirus capsid protein in long-distance movement within the infected plant. J Virol 69:916–922 Thompson JR, Doun S, Perry KL (2006) Compensatory capsid protein mutations in cucumber mosaic virus confer systemic infectivity in squash (Cucurbita pepo). J Virol 80:7740–7743 Thompson JR, Garcıá-Arenal F (1998) The bundle sheath-phloem interface of Cucumis sativus is a boundary for systemic infection by tomato aspermy virus. Mol Plant Microbe Interact 11:109–114 Vaquero C, Turner AP, Demangeat G, Sanz A, Serra MT, Roberts K, Garcıá-Luque I (1994) The 3a protein from cucumber mosaic virus increases the gating capacity of plasmodesmata in transgenic tobacco plants. J Gen Virol 75:3193–3197

123