identified in the cDNA of the patients; these included three missense mutations, two single-base deletions that resulted in a termination codon, a three-base ...
Hum Genet (1999) 104:143–148
© Springer-Verlag 1999
ORIGINAL INVESTIGATION
Yoko Aoki · Xue Li · Osamu Sakamoto Masahiro Hiratsuka · Hiroshi Akaishi · Liquing Xu Paz Briones · Terttu Suormala E. Regula Baumgartner · Yoichi Suzuki Kuniaki Narisawa
Identification and characterization of mutations in patients with holocarboxylase synthetase deficiency Received: 28 August 1998 / Accepted: 1 December 1998
Abstract Holocarboxylase synthetase deficiency (HCS) is an autosomal recessive disorder characterized by metabolic ketoacidosis, abnormal urine organic metabolites, and dermatitis. These symptoms are improved by pharmacological doses of biotin. In this study, we have analyzed seven patients with HCS deficiency found in European and Middle Eastern countries by using reverse transcription/polymerase chain reaction/single-stranded conformation polymorphism and a sequencing analysis. Although we had previously reported that two mutations were frequent in Japanese patients, no frequent mutations were found in the patients analyzed in this study. Seven novel mutations were identified in the cDNA of the patients; these included three missense mutations, two single-base deletions that resulted in a termination codon, a three-base in-frame deletion, and a 68-bp deletion. A new polymorphism C1121T was also identified in four alleles. A transient expression study demonstrated that the HCS activities of three missense mutations and one amino acid deletion were 1%–14% that of wild-type cDNA; in contrast, the activities of the two singlebase deletions followed by a termination codon and Asp571Asn were nearly undetectable. These data suggest that a variety of mutations is responsible for decreasing HCS activity and that the aspartate residue at amino acid position 571 may be crucial for the catalytic activity of HCS.
Y. Aoki and X. Li contributed to this work equally Y. Aoki · X. Li · O. Sakamoto · M. Hiratsuka · H. Akaishi X. Liquing · Y. Suzuki (✉) · K. Narisawa Department of Medical Genetics, Tohoku University School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai 980-8574, Japan Tel.: +81 22 717 8140; Fax: +81 22 717 8142 P. Briones Institut Bioquimica Clinica, c/. Mejia Lequerica, s/n. Edifici Helios III, Planta Baixa, E-08028 Barcelona, Spain T. Suormala · E. R. Baumgartner Metabolic Unit, University Children’s Hospital, Roemergasse 8, CH-4005 Basal, Switzerland
Introduction Holocarboxylase synthetase (HCS; EC 6.3.4.10) is the enzyme responsible for attaching biotin to mammalian mitochondrial carboxylases, including pyruvate carboxylase, propionyl-CoA carboxylase, and methylcrotonyl-CoA carboxylase, and to cytosolic acetyl-CoA carboxylase (Achuta Murthy and Mistry 1972; Wolf 1995). Most patients with HCS deficiency manifest symptoms that include tachypnea, seizures, difficulties in feeding, and dermatitis in the early infantile period. Biochemical findings include metabolic ketoacidosis, hyperammonemia, and excretion of abnormal organic acid metabolites (Wolf 1995). Clinical and biochemical symptoms are dramatically improved by pharmacological doses of biotin (Wolf 1995). The human HCS cDNA has been isolated and shown to encode 726 amino acids (Suzuki et al. 1994; Leon-Del-Rio et al. 1995). By the analysis of mutations in patient cDNA, 10 different mutations have been identified so far (Suzuki et al. 1994; Aoki et al. 1995, 1997; Dupuis et al. 1996; Sakamoto et al. 1998). Three of them (Val550Met, Leu237Pro, and delG 1067) appear to be disease-causing mutations according to an analysis of expressed mutant proteins in vitro (Aoki et al. 1997). The primary defect of mutant HCS had been believed to be a decreased affinity for biotin, i.e., a change in Km (Burri et al. 1981, 1985; Ghneim and Bartlett 1982). However, an expression study demonstrated that the Km of HCS with the mutation Leu237Pro was the same as that obtained with wild-type cDNA, suggesting another mechanism of biotin responsiveness (Aoki et al. 1997). In order to look for further mutations responsible for decreasing HCS activity, we investigated seven additional patients with HCS deficiency and measured the HCS activity of the mutants in a transient expression study.
144 Table 1 Details of the studied patients Patient
Reference
Origin
Age of onset
Nucleic acid changes
Description of the mutation
1 (TM) 2 (KE) 3 (SM) 4 (FE) 5 (VG) 6 (HR) 7 (AD)
a,b
Germany France Germany Germany Spain Lebanon Turkey
13 months 5 months 3 months 9 months 1 day 20 months 2 days
T1285A/–g del C2279/del (1740–1807) G1998A/–g del T1876/del (1740–1807) C1672T/–g del (2114–2116)/del (2114–2116) G2028 A/G2028A
Val333Glu/ Frameshift-termination/frameshift-termination Asp571Asn/ Frameshift-termination/frameshift-termination T462Ile/ del Thr 610 /del Thr 610 Gly581Ser/Gly581Ser
a e
a a c d e a, f
Suormala et al. 1997, Tuoma et al. (1999),
b f
Suormala et al. 1998; Fuchshuber et al. 1993,
Table 2 Sequence of primers used in SSCP analysis (F fluorescein-labeled)
Segment
c g
d Briones et al. 1989 This paper, No mutations were detected by sequencing the alleles
Positiona
1
225–516
2
435–715
3
662–976
4
766–1064
5
955–1296
6
1198–1456
7
1411–1708
8
1662–1857
9
1722–1995
10
1945–2145
11
2004–2298
12
2196–2523
a
Numbering as in Suzuki et al. 1994 b Sequences of primer pairs given 5’ to 3’
Material and methods Patients and cell lines Six patients, viz., patients TM, KE, SM, VG, HR, and AD, have previously been reported (Table 1; Briones et al. 1989; Fuchshuber et al. 1993; Suormala et al. 1997, 1998; Touma et al. 1999). Patient FE showed acute dehydration caused by gastroenteritis and had severe metabolic acidosis, muscular hypotonia, and developmental delay at the age of 11 months. Organic acid analysis, performed at the age of 21 months, suggested multiple carboxylase deficiency that was confirmed in cultured skin fibroblasts. Plasma biotinidase activity was normal. With 10 mg biotin/day, there was some clinical improvement, but carboxylase activities in lymphocytes remained below 20% of the normal control. The daily biotin dose was increased to 100 mg, but the carboxylase activities in lymphocytes remained clearly below the normal range (23%–44% of mean normal). The clinical response was also
Primer sequenceb
Size (bp)
5’-F-GATCCTTATCGGCTAATTGCTG 5’-TCCTTTGTTTGGGTTGTTGACCAAGAGC 5’-GAGATTAAGCCTGAGCAGGACG 5’-F-GCAACACTCTCCAAACTGCTGC 5’-GTCTGCCGAGAACATTCCAGAC 5’-F-TACAGGTCTTCGGGAATGGACT 5’-F-AGGCACCCAACATCCTCCTCTA 5’-GCTTGTCACCTGAAAGCCACCAA 5’-AGTCCATTCCCGAAGACCTGTAC 5’-F-GTTCTAAGTGCACCTGGCAAAG 5’-F-AGGGCCACCTGGAGAATGAGGA 5’-GACAGCAAGTAAAGAGGAGTTAAG 5’-F-GTGACATGAAACAAGTTCCTGC 5’-ACTTCGGCAAACAAAATTACTTTC 5’-F-AATCTGCAGACCAAGCAGTTGG 5’-GAGTAGAAAGAGCACATCCCAC 5’-ATGCGTCTCCTGGATGGGCTGA 5’-F-TGGGCCACTTCACTCGTAAGTT 5’-F-TGAGGTCCATTCCCGAGTATCA 5’-ATTCTGTGATGAGGTCGTTGAT 5’-TATTACAGTGACCTCATGAAGATC 5’-F-CACTGTGGACCCAGTATCGGTA 5’-F-ATCGCCAGAGTCGTGACTGTG 5’-F-TAGATTTCCAGATGCATGGGCA
292 281 315 299 342 259 298 196 274 201 295 328
partial. In spite of some progress, her psychomotor development has remained slightly retarded (3–3.5 years at the chronological age of 4 years), and she suffers from mild hypotonia and truncal ataxia. Fibroblasts from all the patients were cultured in minimal essential medium containing 10% fetal calf serum and 1% penicillin/streptomycin.
Reverse-transcribed polymerase chain reaction and single-stranded conformation polymorphism The total RNA isolated from the patient’s fibroblasts was reversetranscribed (RT; Suzuki et al. 1994), and the polymerase chain reaction (PCR) was conducted with 20 pairs of oligonucleotide primers and fluorescein-labeled primers in 10 overlapping fragments of HCS cDNA (Table 2). The reaction mixture contained 0.4 µM each primer, 80 µM each dNTP, 20 mM TRIS HCl (pH 8.3), 1.5 mM MgCl2, 0.01% gelatin, 0.5 µg patient cDNA, and 0.1 U Taq polymerase (Takara, Otsu, Japan). The amplification was performed for 35–40 cycles, each
145 Fig. 1 SSCP analysis of HCS cDNA. The PCR mixture was denatured and applied to an SSCP gel fitted to an automated sequencer. The regions of cDNA that showed mobility shift were sequenced. C Control samples. The five mutations and the polymorphism indicated under the columns were detected
cycle consisting of 1 min denaturation at 94°C, 1 min annealing at 58–60°C, and 1 min extension at 72°C. A fluorescence-based single-strand conformation polymorphism (SSCP) protocol was performed according to the manufacturer’s recommendations (Pharmacia Biotech, Uppsala, Sweden). An aliquot of 2 µl PCR product was mixed with 2 µl sequencing loading dye (Pharmacia), denatured by heat, and applied to a non-denaturing acrylamide gel (MDE, AT Biochem, Malvern, Pa.) with or without 5% glycerol, on an automated DNA sequencer (ALF, Pharmacia). During electrophoresis at 30 W, the temperature of the gel was kept at 25°C with a built-in water-jacket connected to an external thermostatregulated water circulation. Sequencing of cDNA For the sequencing of cDNA, amplified DNA was subcloned into a TA cloning vector or the XhoI-EcoRI site of pBluescript II KS+ (Stratagene, La Jolla, Calif.) and sequenced on an automated laser fluorescent (ALF) sequencing apparatus (Pharmacia; Suzuki et al. 1994). Allele-specific PCR and modified PCR to detect del Thr610 and Gly581Ser Genomic DNA was extracted from cultured fibroblasts by using a Sepa Gene kit (Sanko Junyaku, Tokyo, Japan). To detect del Thr610, a forward primer was designed to amplify either wild-type DNA (Sw; 5’-TAATGTGACTAACAGTAACCCTTC) or mutant DNA (Sm; 5’TAATGTGACTAACAGTAACCCCT). PCR was conducted by using either Sw or Sm and a common antisense primer (AS; 5’-CACTGTGGACCCAGTATCGGTA), and the products were applied to an agarose gel. Wild-type DNA was amplified only when primer pairs Sw and AS were used, whereas mutant DNA was amplified when Sm and AS were used. To detect the Gly581Ser mutant allele, the underlined nucleotide in the forward primer (S-2; 5’-TATTACAGTGACCTCATGAAGACC) was changed from T to C to make a recognition site for MspI in the PCR products amplified from the normal allele. A 142-bp PCR fragment was amplified from genomic DNA by using S-2 and antisense primers (5’-ATTCTGTGATGAGGTCGTTGAT). When the PCR product was digested with MspI, a 142-bp fragment was obtained from the normal allele, and 119-bp and 23-bp fragments were obtained from the mutant allele. Construction of the expression vector and transient expression study For constructing the expression vector, pBluescript II KS+ containing full-length HCS cDNA was modified (Aoki et al. 1995). The identified mutations Val333Glu, del C2279, Asp571Asn, Thr462Ile, and del Thr610 were inserted by digestion with restriction enzymes, viz.,
StyI-StyI (1105–1397), AflII-NsiI (2177–2508), BglII-AflII (1648–2177), BglII-AflII (1648–2177), AflII-HpaI (2040–2177), respectively. Constructs containing del T1876 and Gly581Ser were generated by using an in vitro mutagenesis kit (Clontech, Palo Alto, Calif.). After mutagenized cDNAs had been confirmed by sequencing, cDNAs were excised from pBluescript KS+ by digestion with XhoI and subcloned to pCAGGS, a mammalian expression vector with a cytomegalovirus enhancer and a chicken beta-actin promoter (Niwa et al. 1991). The wild-type or mutant HCS cDNAs in the pCAGGS vector were transfected into SV40-transformed fibroblasts from patient MT, whose HCS activity was 0.02% that of the expressed wild-type cDNA (Aoki et al. 1997). Briefly, 6 µg plasmid DNA were transfected with 30 µl lipofectamine reagent (Gibco BRL, Gaithersburg, Md.) per 90mm dish. The transfected cells were harvested by scraping 48 h after the transfection, washed twice with PBS, and stored at –80°C until assayed for HCS activity by using apo-CCP as a substrate (Aoki et al. 1997). Expression of HCS proteins was determined by Western blot analysis as described previously (Aoki et al. 1997). The biotin concentration used in this reaction was 1500 nM. At this biotin concentration, the activity of expressed wild-type HCS reached the Vmax (Aoki et al. 1997).
Results Detection of mutations SSCP analysis detected fifteen aberrant patterns in all, of which five novel mutations and a new polymorphism were identified by RT-PCR followed by sequencing (Table 1, Fig. 1). In patient TM, a T to A substitution at position 1285 (Val333Glu) was identified that created an ApaLI site. A 261-bp PCR fragment was amplified from genomic DNA by using exonic sense and antisense primers. When the PCR product was digested with ApaL1, a 261-bp fragment was obtained from the normal allele, and 172-bp and 89-bp fragments were obtained from the mutant allele. Patient TM was confirmed as being heterozygous for the mutation (data not shown). In patient KE, a one-base deletion of C at position 2279 was detected that caused a frame-shift and resulted in a termination codon. The resultant peptide was expected to be 23 amino acids shorter than a wild-type peptide (see Fig. 3). In the other allele of the patient, a 68-bp deletion between nucleotide positions 1740 and 1807 was found, which sug-
146
Fig. 2 A cDNA sequencing of three patients. Left Patient SM has a G to A transition at nucleotide 1998 causing a missense mutation, Asp571Asn. Middle Patient VG has a C to T transition at nucleotide 1672, resulting in a Thr462Ile mutation. Right Patient AD has a G to A transition at nucleotide 2028 leading to Gly581Ser. B. Detection of mutations in genomic DNA. Left Detection of del Thr610 mutation by allele-specific PCR. cDNA (C) or genomic DNA (G) from a control and patient HR was amplified by using either wild-type specific sense primer (W) or mutant specific sense primer (M). The PCR fragment was amplified only by the wild-type primer in the control, whereas amplified bands were seen when mutant primer was used with cDNA and genomic DNA from patient HR. The result indicates that patient HR is homozygous for del Thr610. Right Detection of Gly581Ser by restriction-site-generating PCR. Amplified cDNA and genomic DNA were digested with MspI and analyzed by agarose gel electrophoresis. In cDNA (C) and genomic DNA (G) from normal controls, PCR fragments were digested into 119-bp and 23-bp fragments (not shown). However, PCR fragments amplified from cDNA and genomic DNA from patient AD remained uncut. Patient AD was found to be homozygous for Gly581Ser
gested that the mutation might be a splicing mutation. The deletion caused a frame-shift of amino acids followed by a termination codon. In patient FE, the same 68-bp deletion, del (1740–1807), was detected in one allele. In the other allele of the patient, a one-base deletion of T at position 1876 was detected; this caused a frame-shift and premature termination. The mutant allele containing the deletion produced a short peptide whose length was 75% that of normal. A three-base deletion from nucleotide positions 2114 to 2116 was detected in patient HR. This caused a deletion of the threonine residue at position 610 (del Thr610). Because all of the cloned cDNAs had the mutation, allele-specific sense oligonucleotides were designed to amplify either the normal sequence or the mutant sequence from genomic DNA. PCR amplification of the patient’s genomic DNA revealed that patient HR was homozygous for the mutation (Fig. 2B). We also found a new polymorphism, a C to T transition at nucleotide 1121 in one allele of patients TM and SM, and in both alleles of patient AD. The nucleotide change did not cause an amino acid change (Ser278Ser).
Fig. 3 Position of mutations and HCS activities of wild-type and mutant cDNAs. The putative biotin-binding region (amino acid position 448–701) was designated as described by Suzuki et al. (1994). Dots Positions of mutations, hatched boxes frame-shifts. Constructs were transfected into HCS-deficient immortalized fibroblasts, and HCS activities were determined. The experiment was performed in triplicate. Data are the means ± standard deviation
Because SSCP analysis failed to detect mutations in all patients, we conducted RT-PCR to amplify the whole coding region. Three additional mutations were newly detected by sequencing. A G to A substitution at position 1998 was identified in patient SM (Asp571Asn; Fig. 2A). This mutation has previously been identified in another patient (Dupuis et al. 1996). Six of the nine colonies that we picked up had this mutation; however, no mutations were detected in the other allele. The patient was found to be heterozygous for the mutation. In patient VG, a C to T substitution at position 1672 (Thr462Ile) was identified in one allele (Fig. 2A). However, no mutation was found in the other allele. In patient AD, a G to A substitution at position 2028 was identified (Gly581Ser; Fig. 2A). This mutation was detected by using a modified sense primer to create an MspI restriction site in the PCR fragment amplified from the normal sequence of genomic DNA. By PCR amplification followed by MspI digestion, the normal sequence was cut into fragments of 119 bp and 23 bp, whereas the fragment from the patient remained uncut (Fig. 2B). The patient was found to be homozygous for the mutation. The homozygosity was consistent with the finding that the patient’s parents were cousins (Fuchshuber et al. 1993). Transient expression study Expression constructs including wild-type and seven mutant cDNAs were transfected into patient fibroblasts, and HCS activities were measured (Fig. 3). The activity of the expressed del Thr610 mutant exhibited 14% that of expressed wild-type cDNA, showing the highest residual activity of these mutants. Three missense mutations, includ-
147
ing Val333Glu, Thr462Ile, and Gly581Ser, exhibited 1%–10% the activity of that of the wild-type. The missense mutation Asp571Asn and two single-base deletions (del C2279 and del T1876) that produce truncated proteins exhibited 0.1% of the wild-type activity. We assessed the expression level of wild-type and mutant HCS proteins by Western blot analysis. In the del T1876 mutant, we observed a shorter expressed protein corresponding to the premature termination. The size of the protein derived from the del C2279 mutation was indistinguishable from the wildtype protein. There was no significant difference in the expression levels of HCS protein among all preparations, suggesting that none of the mutations tested in this study affected the stability of the transcript or protein.
Discussion In this study, we have identified seven novel mutations, one earlier described mutation, and a new polymorphism in seven patients with HCS deficiency. Five patients originate from European countries (TM, SM, FE: Germany; KE: France; VG: Spain), and two are from the Middle East (AD: Turkey; HR: Lebanon). The seven mutations identified include three missense mutations, two single-base deletions that result in a termination codon, a three-base in-frame deletion, and a 68-bp deletion, which is possibly a splicing mutation. The latter deletion, viz., del (1740–1807), is found in one allele of two patients (KE and FE) and is the only mutation shared between the seven patients studied. The mutation Asp571Asn in one allele of patient SM has been previously described in another patient (Dupuis et al. 1996). Although Leu237Pro and del G1067 have frequently been detected in Japanese patients (Aoki et al. 1995), neither of them has been found in these patients. The results suggest that a variety of mutations is causative in patients from European or Middle Eastern countries, whereas Leu237Pro and del G1067 may be founder mutations in Japanese patients. The expression study of seven mutants has demonstrated that all of these mutants have lower HCS activities than expressed wild-type cDNA. According to the level of residual activities, the mutants can be divided into two groups: (1) those with a readily detectable HCS activity of 1%–14% that of the expressed wild-type cDNA (del Thr610, Val333Glu, Thr462Ile, and Gly581Ser) and (2) those with a hardy detectable HCS activity of less than 0.1% that of the wild-type (del C2279, Asp571Asn, and del T1876). The two deletions (del C2279 and del T1876) are present in the latter group, suggesting that these deletions affect HCS activity because of the truncation of the protein. The two patients (KE and FE) with these deletions in one allele combined with a further deletion (del 1740–1807) in the second allele, are the only patients who show a partial biochemical and clinical response to biotin therapy. Interestingly, the activity of the missense mutation Asp571Asn is also nearly undetectable. The aspartate residue at amino acid position 571 is located in the putative biotin-binding region and is
completely conserved among human HCS, yeast HCS, and bacterial HCS-related enzymes (Dupuis et al. 1996). The data suggest that the aspartate at position 571 is crucial for the catalytic activity of HCS. The relationship between phenotype and genotype in HCS deficiency is not well understood from this study. Patient HR shows mildest symptoms and the latest onset and has the mutant protein that has the highest residual activity. Patient AD is more severely affected than patient HR, probably because she has the mutant protein with less activity. Although patients KE and FE exhibit a milder phenotype than patient AD, they have onebase deletion mutations that give extremely low HCS activity and the 68-bp deletion (del 1740–1807). Since the activity of the protein derived from the 68-bp-deleted HCS mRNA would also be very low, it is difficult to explain the milder symptoms only from the residual activity of these mutant proteins. There is a possibility that the 68-bp deletion is the product of exon-skipping resulting from an intronic mutation. In this situation, normally spliced HCS mRNA might account for residual activity in the cells of the patients. Analysis of genomic DNA is necessary to test this possibility. The structure-function relationship of the HCS enzyme is not fully understood. The only information available is that amino acids 448–701 have homology to E. coli BirA, yeast HCS, and bacterial HCS-related enzymes (Suzuki et al. 1994; Dupuis et al. 1996). The region is probably important for affinity to biotin. We have found different types of mutations inside and outside the biotin-binding region in this study (see Fig. 3). Three missense mutations (Asp571Asn, Thr462Ile and Gly581Ser) and del Thr610 are located within the putative biotin-binding region. The three deletion mutations, del T1876, del C2279 and del (1740–1807), may produce mutants lacking a part of the biotin-binding region. In contrast, Val333Glu is located outside the putative biotin-binding region. We have previously shown that a mutation (Leu237Pro) outside the putative biotin-binding region affects the catalytic activity of HCS without changing the Km for biotin (Aoki et al. 1997). A relationship between the location of the mutations and the Km values of the mutants is therefore possible. We have not been able to identify any mutations in the second allele of patients TM, SM, and VG, although we have finally sequenced the whole coding region in both alleles from these patients. However, nested PCR has enabled us to amplify a very small amount of cDNA not detected by Northern blotting (Ogasawara et al. 1994). This suggests that the level of mRNA of the second allele may be decreased in these patients. Acknowledgments This work was supported mainly by Grants-inAid for Scientific Research from the Ministry of Education, Culture and Science of Japan, and grants from the Ministry of Health and Public Welfare of Japan. We thank Dr. U. Stephani, Children’s Hospital, Kiel, Germany, for providing us with clinical information about patient FE.
148
References Achuta Murthy PN, Mistry SP (1972) Synthesis of biotin-dependent carboxylases from their apoproteins and biotin. J Sci Ind Res 31:554–563 Aoki Y, Suzuki Y, Sakamoto O, Li X, Takahashi K, Ohtake A, Sakuta R, Ohura T, Miyabayashi S, Narisawa K (1995) Molecular analysis of holocarboxylase synthetase deficiency: a missense mutation and a single base deletion are predominant in Japanese patients. Biochim Biophys Acta 1272:168–174 Aoki Y, Suzuki Y, Li X, Sakamoto O, Chikaoka H, Takita S, Narisawa K (1997) Characterization of mutant holocarboxylase synthetase (HCS): a Km for biotin was not elevated in a patient with HCS deficiency. Pediatr Res 42:849–854 Briones P, Ribes A, Vilaseca MA, Rodriguez-Valcarcel G, Thuy LP, Sweetman L (1989) A new case of holocarboxylase synthetase deficiency. J Inherit Metab Dis 12:9–330 Burri BJ, Sweetman L, Nyhan WL (1981) Mutant holocarboxylase synthetase: evidence for the enzyme defect in early infantile biotin-responsive multiple carboxylase deficiency. J Clin Invest 68:1491–1495 Burri BJ, Sweetman L, Nyhan WL (1985) Heterogeneity of holocarboxylase synthetase in patients with biotin-responsive multiple carboxylase deficiency. Am J Hum Genet 37:326–337 Dupuis L, Leon-Del-Rio A, Leclerc D, Campeau E, Sweetman L, Saudubray JM, Herman G, Gibson KM, Gravel RA (1996) Clustering of mutations in the biotin-binding region of holocarboxylase synthetase in biotin-responsive multiple carboxylase deficiency. Hum Mol Genet 5:1011–1016 Fuchshuber A, Suormala T, Roth B, Duran M, Michalk D, Baumgartner ER (1993) Holocarboxylase synthetase deficiency: early diagnosis and management of a new case. Eur J Pediatr 152:446–449 Ghneim H, Bartlett K (1982) Mechanism of biotin-responsive combined carboxylase deficiency. Lancet I:1187 Leon-Del-Rio A, Leclerc D, Akerman B, Wakamatsu N, Gravel RA (1995) Isolation of a cDNA encoding human holocarboxylase synthetase by functional complementation of a biotin auxotroph of Escherichia coli. Proc Natl Acad Sci USA 92:4626–4630
Niwa H, Yamamura K, Miyazaki J (1991) Efficient selection for highexpression transfectants with a novel eukaryotic vector. Gene 108:193–200 Ogasawara M, Matsubara Y, Mikami H, Narisawa K (1994) Identification of two novel mutations in the methylmalonyl-CoA mutase gene. Hum Mol Genet 3:867–872 Sakamoto O, Suzuki Y, Aoki Y. Li X, Hiratsuka M, Yanagihara K, Inui K, Okabe T, Yamaguchi S, Kudoh J, Shimizu N, Narisawa K (1998) Molecular analysis of new Japanese patients with holocarboxylase synthetase deficiency. J Inherit Metab Dis 21:873–874 Suormala T, Fowler B, Duran M, Burtscher A, Fuchshuber A, Tratzmuller R, Lenze MJ, Raab K, Baur B, Wick H, Baumgartner R (1997) Five patients with a biotin-responsive defect in holocarboxylase formation: evaluation of responsiveness to biotin therapy in vivo and comparative biochemical studies in vitro. Pediatr Res 41:666–673 Suormala T, Fowler B, Jakobs C, Duran M, Lehnert A, Raab K, Wick H, Baumgartner ER (1998) Late-onset holocarboxylase synthetase-deficiency: pre- and post-natal diagnosis and evaluation of effectiveness of antenatal biotin therapy. Eur J Pediatr 157: 570–575 Suzuki Y, Aoki Y, Ishida Y, Chiba Y, Iwamatsu A, Kishino T, Niikawa N, Matsubara Y, Narisawa K (1994) Isolation and characterization of mutations in the holocarboxylase synthetase cDNA. Nat Genet 8:122–128 Touma A, Suormala T, Baumgartner ER, Gerbaka B, Ogier de Baulny H, Loiselet J (1999) Holocarboxylase synthetase deficiency: Report of a case with onset in late infancy. J Inherit Metab Dis (in press) Wolf B (1995) Disorders of biotin metabolism. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The metabolic and molecular basis of inherited diseases, 7th edn. McGraw-Hill, New York, pp 3151–3177
