Plant Mol Biol (2011) 77:475–487 DOI 10.1007/s11103-011-9825-6
Identification and characterization of SHORTENED UPPERMOST INTERNODE 1, a gene negatively regulating uppermost internode elongation in rice Li Zhu • Jiang Hu • Keming Zhu • Yunxia Fang • Zhenyu Gao • Yinghong He • Guangheng Zhang • Longbiao Guo • Dali Zeng • Guojun Dong • Meixian Yan • Jian Liu • Qian Qian
Received: 10 November 2010 / Accepted: 8 September 2011 / Published online: 18 September 2011 Ó Springer Science+Business Media B.V. 2011
Abstract In rice, the elongated internodes are derived from the vegetative shoot apical meristem (SAM), and the transition of the SAM from the vegetative to the reproductive stage induces internode elongation. In this study, we characterize two shortened uppermost internode mutants (sui1-1 and sui1-2). During the seedling and tillering stages, sui1 plants are morphologically similar to wild-type plants. However, at the heading stage, the sui1-1 mutant exhibits a shortened uppermost internode and a partly sheathed panicle, and the sui1-2 mutant shows an extremely shortened uppermost internode and a fully sheathed panicle. Gibberellin treatment results in elongation of every internode, but the shortened uppermost internode phenotype remains unaltered. Microscopic analysis indicates that cell length of sui1-1 uppermost internode exhibits decreased. Map-based cloning revealed that SUI1 is located on Chromosome 1, and encodes a putative phosphatidyl serine synthase (PSS) family protein. Searches for matches in protein databases showed that OsSUI1 contains the InterPro domain IPR004277, which is conserved in both animal and plant kingdoms. Introduction of a wild-type SUI1 gene fully rescued the mutant phenotype of sui1-1 and sui1-2, confirming the identity of the cloned gene. Consistent with these results, the SUI1-RNAi transgenic plants displayed decreased elongation of the uppermost internode. Our results suggest that SUI1 plays an Li Zhu, Jiang Hu and Keming Zhu have contributed equally to this work. L. Zhu J. Hu K. Zhu Y. Fang Z. Gao Y. He G. Zhang L. Guo D. Zeng G. Dong M. Yan J. Liu Q. Qian (&) State Key Laboratory of Rice Biology, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, 359 Tiyuchang Road, Hangzhou 310006, China e-mail:
[email protected]
important role in regulating uppermost internode length by decreasing longitudinal cell length in rice. Keywords Uppermost internode SUI1 Map-based cloning Rice
Introduction In terms of the origins of internodes, there is an important difference between rice and Arabidopsis: the elongated internodes in rice are derived from the vegetative shoot apical meristem (SAM), whereas those in Arabidopsis are derived from the reproductive SAM. In rice, the transition of the SAM from the vegetative to the reproductive stage induces internode elongation (Yamamuro et al. 2000). Several studies showed that the transition between the vegetative and reproductive phases in rice requires expression of both PLA1 and PLA2 for proper termination of vegetative development (Miyoshi et al. 2004; Kawakatsu et al. 2006). Moreover, NL1, which acts upstream of PLA1 during panicle development, functions in modulating distinctive pathways to coordinate organogenesis in both vegetative phytomers and panicles during reproductive development in rice (Wang et al. 2009). When the SAM shifts to the reproductive phase, each internode differentiates in response to the development of intercalary meristems in the internodes. Numerous internode elongation mutants have been collected and characterized in rice because of their agronomic importance. Generally, internode elongation mutants include internode-enhanced mutants that show an increased plant height, and short-internode mutants, which show a dwarf phenotype. Molecular genetic studies have revealed that the internode elongation mutation often
123
476
results from deficiency in the biosynthesis and perception of plant hormones such as gibberellin (GA) and brassinosteroids (BRs) (Achard and Genschik 2009; Zhu et al. 2006; Rieu et al. 2008b; Haubrick and Assmann 2006; Yamamuro et al. 2000). EUI1 encodes a cytochrome P450 monooxygenase that deactivates bioactive gibberellins (GAs). The eui mutant exhibited an extremely elongated uppermost internode and slightly elongated second and third internodes, caused by elevated levels of bioactive GAs (Luo et al. 2006). EUI1 and EUI2 were cloned and mapped to chromosome 5 and 10, respectively (Luo et al. 2006; Yang et al. 2001). OsBRI1, with extensive sequence similarity to the Arabidopsis BRI gene, encodes a putative BR receptor kinase, and is closely linked to the d61 locus. OsBRI1 causes internode elongation by inducing formation of the intercalary meristem and longitudinal elongation of internode cells (Yamamuro et al. 2000). Recently, Asano and coworkers analyzed ssd1, which phenotypically differs from the typical GA- or BR-related dwarf phenotypes. SSD1 encodes a plant-specific protein and controls internode elongation by controlling cell division (Asano et al. 2010). Takeda categorized various internode elongation mutants into six groups based on the elongation pattern of the upper four or five internodes. In the ‘sh’ type, the uppermost internode shows no elongation, with the panicle enveloped in the leaf sheath. The ‘nl’ type shows reduced length of the uppermost internode and increased length of basal internodes (Takeda 1977). Mutants of the NL1 gene, which encodes a GATA-type transcription factor with a single zinc finger domain, have reduced uppermost internode lengths and an elongated basal internode, compared with those of the wild-type. Uppermost internode elongation patterns and panicle development are also impaired in nl1 mutants (Wang et al. 2009). A QTL for uppermost internode length was mapped in rice in different growth environments using a composite interval mapping method. Thirteen QTLs related to uppermost internode length were detected under three different growth environments. These QTLs were located on chromosomes 1, 2, 3, 5, 6, 8, 10 and 11, and explained 3.97–15.21% of observed phenotypic variance. The QTLs were stable, and were barely affected by environmental factors (Qiao et al. 2007). Mutants with sheathed panicle phenotypes, such as shp1–5, have been identified and mapped with morphological markers. shp1, 3, 4, and 5 are located on chromosomes 1, 5, 3, and 4, respectively (http://www.shigen.nig. ac.jp/rice/oryzabase/quickSearch/queryAction.do). Although several shp mutants were identified, the mechanism underlying the shortened uppermost internode of rice remains unclear. In this study, we investigated the shortened uppermost internode mutants sui1-1 and sui1-2. sui11 showed a partly sheathed panicle phenotype, and sui1-2 showed a fully sheathed panicle phenotype. Map-based
123
Plant Mol Biol (2011) 77:475–487
cloning revealed that SUI1 encodes a putative phosphatidyl serine synthase family protein (PSS). This gene is nonallelic with other known loci. Our results suggest that SUI1 plays an important role in regulating uppermost internode length by decreasing longitudinal cell length in rice.
Materials and methods Plant materials and growth conditions Among two rice (Oryza sativa) mutants with shortened uppermost internode phenotypes; sui1-1 and sui1-2, sui1-1 was obtained from a T-DNA insertional population of the japonica rice cultivar Nipponbare, and sui1-2 was obtained from an M2 population of the japonica rice cultivar Zhonghua11 after EMS mutagenesis. A mapping population of 1,228 F2 mutant plants was generated from a cross between sui1-1 and the indica variety TN1. Rice plants were cultivated in an experimental field at the China National Rice Research Institute in Hangzhou of China during the natural growing season. For root measurement, seedlings were grown in sand for 10 d under a 16-h light/8h dark photoperiod at 30/22°C (SANYO, Versatile Environmental Test Chamber, MLR-351). Fine mapping of SUI1 To fine map SUI1, we downloaded the DNA sequence of BAC clones located inside the two flanking markers that were detected in the linkage analysis from the NCBI database (http://www.ncbi.nlm.nih.gov/BLAST/Genome/PlantBlast. shtml?10). Based on the primary mapping of SUI1 to chromosome 1 using 296 F2 individuals, additional STS and simple sequence repeat (SSR) markers located near the preliminary location were used to genotype the F2 population. New STS and SSR markers between the two flanking markers were designed by comparison of DNA sequences between indica and japonica rice. The polymerase chain reaction (PCR)-based molecular markers used in this study are shown in Table 3. The PCR procedure for mapping was as follows: denaturation at 94°C for 4 min, followed by 35 cycles of 94°C for 30 s, annealing for 30 s (annealing temperature determined by primer pair sequence), 72°C for 1 min, and a final extension step at 72°C for 10 min. The PCR products were analyzed on 5–6% agarose gels. Sequencing analysis of candidate region Specific DNA fragments were amplified from genomic DNA of sui1-1 and sui1-2 mutant plants by PCR. After being purified by electrophoresis on an agarose gel, these fragments were sequenced by the Shanghai Sangon
Plant Mol Biol (2011) 77:475–487
Biological Engineering Technology and Service Co. Ltd. To confirm the mutation site, another sui1-1 mutant plant from the F2 of a cross between the sui1-1 mutant and TN1 was also used for sequencing by the same method. The sixth exon of SUI1 was amplified from genomic DNA of sui1-1 by thermal asymmetric interlaced PCR (TAIL-PCR). TAIL-PCR was used to isolate the T-DNA sequence flanking the gene sequence of the insertion site (Liu et al. 1995). To amplify the right border sequence of T-DNA, we designed the following gene-specific primers: sps5R (50 -GATACTACTCCAGCAGCTTATA-30 ), sps521 (50 -CATTAAAGTTTGGCAGCATATG-30 ), and sps522 (50 -CATTAGCTCAAAGCCAATTG-30 ). To amplify the left border sequence of T-DNA, we used the primers sps4F (50 -AAGGCATTGCATTCTTTTAC-30 ), sps41 (50 -AGTC AATAGGAAGCTTCCCAG-30 ), and sps42 (50 -CGCAAGAGAATTGTGCATCA-30 ). The degenerate primers used were as follows: AD1 [50 -NTCGA(G/C)T(A/T)T(G/C) G(A/T)GTT-30 ], AD2 [50 -NGTCGA (G/C)(A/T)GANA (A/T)GAA-30 ], AD3 [50 -(A/T)GTGNAG(A/T)ANCANA GA-30 ], and AD4 [50 -NGTA(G/C)A(G/C)(A/T)GTNA(A/ T)CAA-30 ]. The tertiary PCR products were sequenced by the Shanghai Sangon Biological Engineering Technology and Service Co. Ltd. Complementation test and RNA interference of SUI1 To construct the binary vector p23N13 containing the entire SUI1 coding region, the BAC clone was digested with PvuII and SacII. Then the 4,919-bp entire SUI1 genomic DNA fragment, a 3,238-bp upstream region, and a 3,150-bp downstream sequence were inserted into the binary vector pCAMBIA2300 to generate the transformation vector p23N13 for complementation. The p23N13 (complementation) and pCAMBIA2300 (control) vectors were introduced into the sui1-1 and sui1-2 mutants by Agrobacterium-mediated transformation, using the Agrobacterium tumefaciens strain EHA105 (Hiei et al. 1994). To help identify the functions of SUI1 in rice, we developed a Gateway vector, pSPSANDA, for RNA interference analyses. We generated 719-bp fragments of SUI1 gene sequences by PCR, using the primer pair 50 -C ACCTTTCGCCATATGCTGC-30 (forward) and 50 -AA CCCATTCATATGTCCTCCCATC-30 (reverse). The resulting PCR fragments were cloned into the Gateway pENTR/ D-TOPO cloning vector. Subsequently, the SUI1 gene fragment was transferred into a pANDA35HK destination vector by recombinase reactions. In these reactions, the SUI1 gene fragments were inserted into two regions flanked by two recombination sites (attB1 and attB2) in opposite directions, and the GUS linker sequence was flanked by two inverted repeats (Miki et al. 2005). Transformation was performed as described above.
477
Quantitative real-time PCR analysis Total RNA was extracted from roots, the culms of uppermost internodes, flag leaves, flag leaf sheaths, and panicles at the heading stage using a MicroRNA Extraction kit (Axygen). After RNase-free DNase (Promega; http://www.promega. com) treatment, first-strand cDNAs were synthesized from equal amounts of total RNA (2 lg/reaction) with a ReverTra AceÒ qPCR-RT kit (TOYOBA, Japan) in a total volume of 10 lL, as described by the manufacturer. Real-time PCR was performed using 2 9 SYBR Green PCR Master Mix (Applied Biosystems) on an Applied Biosystems 7900HT Real-Time PCR System with three replicates for each sample. The relative expression level of each transcript was obtained by comparison to expression of the OsACT1 gene. The primers for the SUI1 gene were 50 -CTTCTACTATGCATCAAGTTTGGACAT-30 (forward) and 50 -GGTCGTC CAGGCTATGAACAA-30 (reverse), and for OsACT1 were 50 -CCATTGGTGCTGAGCGTTT-30 (forward) and 50 -CGC AGCTTCCATTCCTATGAA-30 (reverse).
Phylogenetic analysis The sequences used for alignments were identified by NCBI BLAST searches. We used the Blastp search program of the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) to identify homologous sequences of SUI1 for phylogenetic analyses. A neighbor joining tree was constructed using MEGA 4.0 (Tamura et al. 2007) by the bootstrap method with 1,000 replicates.
Affymetrix GeneChip hybridization and data collection Total RNA was isolated from panicles at the seventh day after heading. The microarray analysis using the Affymetrix GeneChipÒ Rice Genome Array was carried out according to the Affymetrix manual for one-cycle target labeling and control reagents (Affymetrix, Santa Clara, CA) using 5 lg RNA as starting material. The microarray experiments were performed at CapitalBio Corporation (Beijing, China). Global median normalization by dChip and flagged spots corresponding to absent or low-quality signals (\100) were removed before analysis. SAM (significance analysis of microarrays) software was used to find differentially expressed genes (fold change C 3, q value = 0, FDR (false discovery rate) = 0) (Tusher et al. 2001). To focus the analysis on the genes showing the greatest variation in expression, we selected genes whose expression changed more than threefold compared with their average expression across the entire sample set.
123
478
Plant Mol Biol (2011) 77:475–487
Results Isolation and characterization of the sui1 mutant We used the sui1 mutant in the Nipponbare background, hereafter named sui1-1, to identify the SUI1 locus by mapbased cloning. The mutants were initially characterized as two independent mutants, because the uppermost internode of sui1-2 is much shorter than that of sui1-1. In addition, sui1-1 shows a pattern of internode elongation similar to the ‘nl’ type, whereas that of sui1-2 is more similar to the ‘sh’ type (Takeda 1977; Fig. 1b, d). However, reciprocal crosses between these mutants demonstrated that the mutant genes were alleles of a single locus. This is the only case of rice mutants of a single locus that show different, specific patterns of inhibition of internode elongation. The sui1-1 mutant produced a partly sheathed panicle, whereas sui1-2 had a fully sheathed panicle (Fig. 1a–c). During the seedling and tillering stages, sui1 mutant plants were morphologically similar to wild-type plants. However, at the heading stage, the sui1-1 mutant exhibited a shortened uppermost internode and the sui1-2 mutant exhibited an extremely shortened uppermost internode with slightly shortened second and third internodes and panicles. In
addition, the sui1 mutants also showed other developmental abnormalities, including tillering on upper nodes (second node and third node), reduced plant heights and panicle size at different degrees, and slightly shorter leaf sheaths (Fig. 1a; Table 1). The root length was not significantly reduced (Fig. 1f). Internode elongation is caused by cell division in the intercalary meristem, followed by cell elongation in the elongation zone. Therefore, defects in one or both of these processes could result in shortened internodes (Yamamuro et al. 2000). To determine the cellular basis of the mutant phenotype, we examined the uppermost internode of adult plants by light microscopy, as the uppermost internode showed the greatest differences from the wild-type. The cell morphology of the uppermost internodes in a wild-type plant and in the sui1-1 mutant is shown in Fig. 1e. The shortened uppermost internode of the sui1-1 mutant was largely due to decreased cell length. The number of cells in the uppermost internode was approximately the same in the wild-type and the sui1-1 mutant. Gibberellin (GA) stimulates cell elongation, and is an efficient and effective internode elongation growth regulator. To examine the response of the uppermost internode of sui1 to GA treatment, GA (3-lL of GA3 in 50% acetone
(A)
(B)
sui1-1
Nipponbare
Zhonghua11
(D)
(C)
4
Relative length of each internode to the total culm(%)
3
2
I
90% 80%
1
II
I
2
3
4
70% 60% 50% 40%
III
II
30% 20% I I I 10% 0%
IV
IV V
Nipponbare
V
sui1-1
Zhonghua11
sui-2
WT
Fig. 1 Phenotypic analysis of two sui1 mutants and their wild-types. a Gross morphology. From left to right: Nipponbare, sui1-1, Zhonghua11, sui1-2, Bar = 10 cm. b Various internode elongation of sui1 mutants and their wild-types. From left to right: 1. Nipponbare, 2. sui11, 3. Zhonghua11, 4. sui1-2, Bar = 10 cm. c Flag leaves phyllula. 1.
123
(F)
(E)
100%
1
sui1-2
sui1-1
1
2
3
4
Nipponbare, 2. sui1-1, 3. Zhonghua11, 4. sui1-2. d Relative length of each internode to total culm. e Longitudinal sections of the elongated regions of the uppermost internodes of wild-type and sui1-1 plants, Bar = 100 lm. f 10-Days-old seminal root length. 1 sui1-1, 2 Nipponbare, 3 sui1-2, 4 Zhonghua11. Bar = 5 cm
Plant Mol Biol (2011) 77:475–487
479
Table 1 Traits of mutants and wild-types Trait
Nipponbare
sui1-1
Zhonghua11
Plant height (cm)
88.79 ± 2.80
67.42 ± 2.55
107.25 ± 2.21
Uppermost internode (cm)
35.29 ± 1.02
19.38 ± 2.95
43.38 ± 1.40
Wrapround spikelet rate
0.00 ± 0.00%
26.64% ± 3.90%
0.00 ± 0.00%
sui1-2 58.86 ± 3.82 0.17 ± 0.04 100.00% ± 0.00%
Flag leaf sheath (cm)
29.28 ± 0.27
23.67 ± 3.21
33.27 ± 0.99
Tiller on upper nodes
0.00 ± 0.00
2.31 ± 0.48
0.00 ± 0.00
1.82 ± 0.60
95.40 ± 16.34
66.58 ± 11.47
182.70 ± 30.19
139.82 ± 23.39
Seed number per panicle
solution) was applied to the area between the culm and flag leaf sheath. The length of the upper four or five internodes was measured 2 d after the GA treatment. We found that GA treatment caused every internode elongated, but the shortened uppermost internode phenotype remains unaltered (Fig. 2a, b). The eui mutant accumulated exceptionally large amounts of biologically active GAs in the uppermost internode, thereby exhibiting an extremely elongated uppermost internode, with slightly elongated second and third internodes and panicles (Zhu et al. 2006). The sui/eui double mutant displayed a novel phenotype, in which the basal internodes elongated, while the sheathed panicles were unaffected (Table 2). These results suggested that sheathed panicles phenotype of sui1 is GA-insensitive, and SUI1 may play an important role in regulating uppermost internode lengths by decreasing longitudinal cell lengths in rice. Genetic characterization and cosegregation analysis of the mutation and T-DNA insertion To determine whether sui1 was controlled by a single gene or by multiple genes, 101 T1 plants of the line sui1 were used for genetic analysis at 2 weeks after heading. Of the tested plants, 70 displayed the wild-type phenotype and 31 showed the mutant phenotype, fitting a 3:1 segregation ratio (v2 = 1.455 \ v20.05 = 3.84). Thus, sui1 was a single recessive mutation. Similarly, among 480 F2 individuals from the cross between the sui1 mutant and the wild-type, 346 showed the wild-type phenotype and 134 showed the mutant phenotype, fitting the 3:1 segregation ratio (v2 = 2.021 \ v20.05 = 3.84). This result further confirmed that the sui1 mutant phenotype was caused by recessive mutations in a single nuclear gene. sui1-1 was obtained from a japonica rice cultivar Nipponbare T-DNA insertional population. Therefore, we carried out PCR amplification for co-segregation analysis in the T2 progeny of the sui1-1 mutant to determine whether the phenotype resulted from the T-DNA insertion. The result suggested that the mutation was not caused by T-DNA insertion, and so we used a map-based cloning method to identify the SUI1 gene.
26.75 ± 1.54
Map-based cloning of the SUI1 gene A mapping population of F2 was generated by crossing the sui1-1 mutant with the indica cultivar TN1. At the heading stage, homozygous mutant plants were identified by their shortened uppermost internode phenotype. The SUI1 gene was roughly mapped between the STS marker ZN1802 (at 0.3 CM, P0436E04) and the SSR marker RM5336 (at 16.1 CM, P0701D05) on the short arm of chromosome 1 (Fig. 3a). To fine-map the SUI1 gene, nine additional SSR and STS markers were designed by comparison of DNA sequences between 9311 and Nipponbare (Table 3). By analyzing of 1,228 homozygous mutant plants, we delineated the gene within an interval of 31.2-kb between the STS markers ZN2868A and ZN2868B on the bacterial artificial chromosome (BAC) clone P0494A10 (Fig. 3b). Database searches revealed that there were eight open reading frames (ORFs) in this region (http://www.ncbi. nlm.nih.gov/nuccore/AP002541?), but only one ORF was confirmed by a full-length cDNA clone. DNA sequence analysis did not identify any mutations in seven of these ORFs, whereas ORF4 (AK065788) contained various mutations in the two sui1 alleles. A TAIL-PCR analysis showed that the sui1-1 allele contained an insertion of a 4.1-kb putative retrotransposon originating from chromosome 7 in the sixth exon, resulting in the disruption of the ORF. Single nucleotide substitutions were found in the sui1-2 allele, including a T-to-A mutation that introduced a premature stop codon at nucleotide ?1,052 (Fig. 3c), which result in Leu351 changing to stop codon TAA in sui1-2. Genetic complementation and knockdown of the SUI1 gene We performed genetic complementation experiments to verify the identity of the SUI1 candidate gene. The complementation vector containing the entire SUI1 coding region, a 3,238-bp upstream region, and a 3,150-bp downstream sequence, was inserted into the binary vector pCAMBIA2300 to generate the transformation vector p23N13. The resulting p23N13 vector and an empty
123
480
Plant Mol Biol (2011) 77:475–487
Fig. 2 Response of sui1-1 mutant to GA treatment
(B)
(A) sui1-1
Table 2 Traits of sui1-1/eui: double mutant
Trait
sui1-1/eui: eui
Plant height (cm)
sui1-1+GA
sui1-1/eui: sui1
sui1-1/eui: double mutant 112.88 ± 3.07
160.54 ± 4.81
65.95 ± 2.74
Uppermost internode (cm)
59.05 ± 3.46
20.93 ± 1.40
29.30 ± 3.28
Second internode (cm)
31.19 ± 3.38
15.70 ± 2.23
21.77 ± 2.68
Third internode (cm)
23.39 ± 3.38
8.99 ± 3.37
17.78 ± 2.27
Fourth internode (cm)
14.90 ± 2.84
2.52 ± 1.41
12.35 ± 1.99
Flag leaf sheath (cm)
39.10 ± 1.88
25.79 ± 2.10
36.05 ± 3.08
RM1282
ZN1802
sui1-1
sui1-1+GA
ZN3338C
ZN2867D
ZN2868B
ZN2487A
ZN3233B
RM3740
(A)
RM5336 Chr.1
P0436E04
P0439B06
OJ1212_B09
P0494A10
P0030H07
P0684C01 P0037C04
P0701D05
P0463F06
ZN2867D
(B)
ZN2541C
ZN2868A ZN2868B
P0463F06 P0494A10
ORF2 ORF3
ORF4
ORF5
O RF6
ORF7
OR F 8
ORF1
(C) ATG
Insertion of a putative retrotransposon
TGA Single base-pair substitutions
Fig. 3 Map-based cloning of SUI1. a SUI1 was primarily mapped on the short arm of chromosome 1 between markers ZN1802 and RM5336. b Fine mapping of the SUI1 locus with the markers developed based on the sequence of BAC clone P0494A10. The SUI1 locus was narrowed to a 31.2-kb genomic DNA region between markers ZN2868A and ZN2868B. c Eight open reading frames were
located in the region, but only one ORF was confirmed by full-length cDNA clone. Start codon (ATG) and the stop codon (TAG) are indicated. Open boxes indicate coding sequence and a line between boxes indicates intron. Arrows show mutation sites of two allelic mutants
control vector pCAMBIA2300 were then introduced into sui1-1 and sui1-2 by Agrobacterium-mediated transformation. The mutant phenotype of sui1-1 and sui1-2 was
completely restored to normal phenotypes in the transgenic plants, demonstrating that the cloned candidate gene indeed represents SUI1 (Fig. 4b, e).
123
Plant Mol Biol (2011) 77:475–487
481
Table 3 Markers used for mapping of the SUI1 gene Marker
Primers (50 –30 ) sense
RM1282 RM3740
Anti-sense
Product size (bp)
AAGCATGACAGCTGCAAGAC
GGGGATGAAGGGTAATTTCG
156
ATCCCAACTCTAAGCCACCC
CTACCCGTCACCAACTCACC
134
RM5336
TCGATTTGGTCGCGATTG
AGAAATCCCCGACCACCTC
116
ZN1802
TGATGCTCCTCCTGTATTTCT
TTAGCCATCACTCAGGAAGC
132
ZN3338C
ATTGCTGGTCCACAGGTTAGG
AGCGTTCATAAATAATGGCTGTT
252
ZN2867D
CTGTCTTCTTTCTGCTCGTGG
GGTTCCGATTCATATTTTGCT
211
ZN2541C
TAGTAGACGCAGCAGCAACAATG
TACTCTGATTTGTCATCTTCCTCG
106
ZN2868A
CAAATGTTGTAACCCATAAAGAC
AGCGTATCAGGGTATCAAGGA
336
ZN2868B
TCGCCAACTTTGACCTGTGAT
ATCGCTCCATCACATTACAACC
68
ZN2487A
ATTATTCTCCATCCAATCAAAAAC
AATCAATCCTATGTTCAATCCC
242
ZN3233B
TGGACCAGTAAAATGGGACAC
CCGAGGTGTTATGCCAATCT
207
To further investigate the role of SUI1 in plant development, we constructed RNA interference (RNAi) vector and introduced it into the sui1-1 and sui1-2 mutants and wild-types Nipponbare and Zhonghua11. Plants in which the Gateway RNAi vector pSPSANDA (see Materials and Methods) knocked-down expression of AK065788 showed a phenotype similar to that of sui1 mutants. The RNAi transgenic plants showed decreased uppermost internode elongation (Fig. 4c, f). The phenotype was unchanged in transgenic plants carrying an empty vector.
shares significant similarity to Populus trichocarpa CDPdiacylglycerol-serine O-phosphatidyltransferase and Arabidopsis thaliana phosphatidyl serine synthase. SUI1 protein also showed similarity to homologs in Triticum aestivum, Sorghum bicolor, Zea mays, Vitis vinifera, and Ricinus communis (Fig. 5). The high similarity among diverse plant species implies that the SUI1 protein family has a fundamental function in plants. However, searches in public databases were few identify for any plant proteins with known biological functions.
SUI1 encodes a putative phosphatidyl serine synthase(PSS) family protein
Expression pattern of SUI1
SUI1 encodes a putative phosphatidyl serine synthase family protein (PSS). A close homolog of SUI1, Os05g0554400, which shared approximately 78% amino acid sequence identity with the SUI1, was annotated in the rice genome. Comparison of the genomic and the cDNA sequences revealed that SUI1 consists of 12 exons and 11 introns. The SUI1 ORF contains 1,626-bp that encode a polypeptide of 425 amino acid residues (Table 4). SUI1 contains the InterPro domain IPR004277 (with the GO assignment(s): GO: 0006659, supported by AK065788 (http://www.ncbi.nlm. nih.gov/sites/entrez?db=gene&cmd=Retrieve&dopt=full_ report&list_uids=4326076). PSS is a serine exchange enzyme (EC: 2.7.8.8) (http://www. ebi.ac.uk/intenz/query?cmd=SearchEC&ec=2.7.8.8). This family represents eukaryotic PSSI and II, which are membrane-bound proteins that catalyze the replacement of the head group of a phospholipid (phosphotidylcholine or phosphotidylethanolamine) with L-serine (Kuge and Nishijima 1997). SUI1 contains an InterPro domain IPR004277, which is conserved in proteins derived from both animals and plants. The precise function of this domain is unclear. Multiple amino acid sequence alignment indicated that SUI1
Real-time PCR was carried out to examine the expression pattern of SUI1. At the heading stage, SUI1 was expressed in all tested tissues and organs, including roots, culms, flag leaf sheaths, flag leaves, and panicles. The highest expression levels were observed in roots, followed by panicles, flag leaf sheaths, flag leaves, and culms. Relatively higher levels of expression were detected in the roots and panicles, and lower levels of expression in flag leaf sheaths, flag leaves and culms, all of which were growing vigorously at that stage (Fig. 6). SUI1 regulates expression of GA signaling- or GA biosynthesis-related genes To investigate if SUI1 acts in the GA signaling or GA biosynthesis pathways, we analyzed OsGA2ox1, OsCPS, D18, EUI, GLD1, GLD2, IL1, OsKAO, SD1, SLR1, and YABBY1 transcript levels in the wild-type and the sui1-1 mutant (Fig. 7). Real-time PCR analysis of the sui1-1 mutant showed that expression of the GA biosynthetic gene OsCPS was slightly enhanced, whereas expression of D18 (GA3ox2) and SD1 (GA20ox2) was significantly enhanced. On the other hand, expression of the GA deactivation gene
123
482
Plant Mol Biol (2011) 77:475–487
Fig. 4 Functional complementation and RNA interference of SUI1. a and d Wide type (NIP and Zhonghua11); b and e functionally complemented plant (sui1-1-Com and sui1-2Com); c and f plant RNA interference of SUI1 in wide type (Nipponbare-RNAi and Zhonghua11- RNAi)
OsGA2ox1 was slightly reduced. In addition, expression of the GA signaling genes GID1, SLR1 (DELLA), and YABBY1 were significantly enhanced, and expression of IL1 was slightly enhanced. Expression of GLD2 was unaltered in the sui1 mutant. Interestingly, expression of the GA biosynthetic gene OsKAO was significantly reduced, while that of the GA deactivation gene EUI was slightly enhanced in the sui1-1 mutant. These results suggested that the SUI1 gene is likely to be involved in pathways related to GA signaling or GA biosynthesis.
Discussion Male sterile (MS) cultivars play a critical role in the production of hybrid rice seeds. A typical phenotype of almost all MS lines is panicle enclosure within the sheath, which greatly reduces seed production of hybrid rice (Shen et al. 1987; Li and Yuan 2000; Yang et al. 2002, Zhu et al. 2006). To resolve this problem, GA3, which stimulates cell elongation, has been routinely used to effect panicle exsertion. However, gibberellin application not only increases the cost of seed production (accounting for
123
approx. 8–10% of production costs), but also greatly increases the rate of seed germination on the panicle, resulting in decreased quality and shortened storage life of hybrid seeds (Yang et al. 2000; Gangashetti et al. 2004). In this study, we identified two shortened uppermost internode mutants; sui1-1, with a partly sheathed panicle, and sui1-2, with a fully sheathed panicle. GA3 stimulated elongation of all internodes, but the shortened uppermost internode phenotype of sui1-1 remains unaltered. Therefore, the GA treatment increased the height of the mutants, but they retained a sheathed panicle. The double mutant sui/eui displayed a similar phenotype, increased its height, while the panicle remained sheathed. These results suggest that sui1 is gibberellin-insensitive, and that SUI1 may play an important role in regulating uppermost internode lengths by decreasing longitudinal cell lengths in rice. Most of the genes encoding GA biosynthesis and deactivation enzymes have been identified via biochemical and genetic analyses (Achard and Genschik 2009). GAs is biosynthesized from geranylgeranyl diphosphate (GGDP). Two TPSs, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) are involved in the conversion of GGDP to the tetracyclic hydrocarbon intermediate ent-
Plant Mol Biol (2011) 77:475–487
483
Table 4 Full length of cDNA of SUI1 1
CACTTGTAGGTACTTTCGTGGCCTAAGTAGTACATTATTCAGTTGTTAGTTATTTGTCTC
61
ACTGAATGCAAGTGTATCTTTAGTAAGAGTTGGACTGCATTGTACTTGTTTTAATCTTCT
121
TGAAGGCCAGTAAGAATTTGTACTCTAATACAAAATTGTGGAAATTTTACAGATAATAAG
181
CTGCTAAGAATTATCACCATGGAGGTCAATGGTCATCACAAACCAAGAAGAGAATATAAT
241
GGCCGAGAGTGCAATGGTGTACAATCAGTAAACAATTTTGGCGATATCGATCCATGGACA
301
GCATGGGCATACAAACCGCGCACAGTTTCATTGCTACTGATGGGAACATGCTTTTTAATT
361
TGGGCAAGTGGTGCTCTTGATCCAGAAAGAAGCTTCTCTGTTGACCGCGTTTCATCTGTT
421
AAAAGGGGTGTCTTTGCAATGATTGCTGTTTTTTTGGCTTATTCATTTCTTCAGGCACCT
481
TCTACTGTACTTATTAGACCACATCCTGCCATTTGGCGGCTGGTCCACGGGATGGCAGTT
541
GTTTACCTTGTTGCTCTAACTTTTTTGCTTTTCCAGACCCGTGATGATGCTAGGCAATTT
601
ATGAAGTATCTTCACCCTGATCTTGGTGTTGAATTACCTGAAAGATCTTATGGAACCGAC
661
TGCCGCATATATGTACCTGATCATCCGAAAAGCAGGTTTAACAATGTTTATGAGATCCTT
721
TTTGATGAGTTTGTTATTGCCCATATCCTTGGATGGTGGGGGAAGGCTATAATGATAAGA
781
AACCAACCACTTTTATGGGTATTATCAATTGGCTTTGAGCTAATGGAGCTCACCTTTCGC
841 901
CATATGCTGCCAAACTTTAATGAGTGTTGGTGGGATAGCATCGTACTAGACATATTAATC TGCAATTGGTTTGGTATTTGGGCTGGAATGAAGACTGTGAGATACTTTGATGGGAGGACA
961
TATGAATGGGTTGGTTTGAGTCGTCAACCCAATATTATCAGTAAGGTAAAAAGGACGCTA
1021
GGCCAGTTCACACCAGCACAGTGGGACAAAGATGAGTGGTACCCTCTGCTTGGCCCTTGG
1081
AGATTCATCCAGGTGCTGAGCCTATGTATTGTTTTCATGATTGTTGAACTTAACACATTC
1141
TTTCTCAAGTTCTGCCTTTGGATTCCTCCCCGAAACCCCTTGATTGTTTACCGACTTGTC
1201
CTTTGGTGGTTAATTGCGATACCAACCATTCGCGAGTACAATACATACTTACAAGACAGG
1261
AAACCTGTTAAAAAGGTGGGGTCTTTCTGTTGGCTTTCCCTAGCTATTTGCATTTTGGAG
1321
CTTCTACTATGCATCAAGTTTGGACATGGTCTCTTTCCGAAGTCGATGCCGTCATGGTTG
1381
TTCATAGCCTGGACGACCGTGGCGTCGCTTCTGATGATGTTCCTTCTTGTGTGGACTTGG
1441
AAAATTTACCGAACAATGATAAGGAAAAGGCTATGATTCTTCTGTTGCTTTGCTCTCAAT
1501
TCTTTCCTCCTCCATTCAATATTGTCGTGTAAATATTCATTCAAAAAAATCTGTACATGT
1561
GGTAGTAGCCATTAATTTGGTGGTCTCGAGAAGGATCATCATAAGGAATTTTATGTCTTT
1621
GCCTTT
Note start codon ?199; stop codon ?1476 Fig. 5 SUI1 encodes a putative phosphatidyl serine synthase family protein (PSS). Phylogenetic tree of OsSUI1 and its homologous proteins. The tree was constructed using MEGA version 4. The GenBank accession numbers of these homologous proteins are indicated ahead of their sources
123
484
Plant Mol Biol (2011) 77:475–487 5
Relative expression level
4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
Roots
Culms
Leaves
Sheaths
Panicles
Fig. 6 Real-time PCR expression analysis of SUI1. Real-time PCR analysis of SUI1 transcript levels in different organs. Total RNA was extracted from roots, the culms of uppermost internodes, flag leaves, flag leaf sheaths, and panicles at the heading stage. Values are the mean ± SD of three replicates
kaurene. Ent-kaurene is then converted to GA12 by entkaurene oxidase (KO) and entkaurenoic acid oxidase (KAO) (Sakamoto et al. 2004). GA12 is converted to GA4, a bioactive form, via oxidations on C-20 and C-3 by GA 20-oxidase (GA20ox) and GA 3-oxidase (GA3ox), respectively (Achard and Genschik 2009). However, homeostasis of GAs also depends on GA deactivation pathways. The major route of deactivation of bioactive 25
20
Relative expression level
Fig. 7 Expression analysis of GA signaling or GA biosynthesis related genes in sui1 mutant and wide type. Total RNA was isolated from the panicle at heading stage. The transcript levels of OsGA2ox1, OsCPS, D18, EUI, GLD1, GLD2, IL1, OsKAO, SD1, SLR1 and YABBY1 were normalized against levels of OsACT1 gene expression. Transcript levels of all tested genes in the wild type were arbitrarily set to 1. Values are the mean ± SD of the three replicates
GAs is via 2b-hydroxylation, catalyzed by the GA 2-oxidases (GA2ox) (Rieu et al. 2008a). In mutants deficient in bioactive GA production or signaling, the transcript levels of GA biosynthetic genes (GA20ox and GA3ox) are high, whereas the expressions of catabolic genes (GA2ox) are low (Achard and Genschik 2009). Zhenshan 97A (ZS97A), an elite Cytoplasmic male sterile (CMS) line, the occurrence of cytoplasmic male sterility caused a deficiency of indole-3-acetic acid (IAA) in ZS97A panicles. The decreased panicle derived IAA caused a gibberellin A1 (GA1) deficiency in the uppermost internode (UI) by the down-regulation of OsGA3ox2 transcript level, resulting in a shortened UI (Yin et al. 2007). In this study, we found that the expression of the GA biosynthetic gene OsCPS was slightly enhanced, those of D18 (GA3ox2) and SD1 (GA20ox2) were significantly enhanced, and that of the GA deactivation gene OsGA2ox1 was slightly reduced in the sui1-1 mutant. Similar results were obtained from GeneChip analyses. These data suggested that there are other different reasons to exhibit phenotype of panicle enclosure within the sheath except for MS panicle enclosure that have been reported. It was reported that the interaction between DELLA and bHLH proteins controls cell elongation in Arabidopsis (De Lucas et al. 2008). ILI1 inhibits the activity of IBH1 (bHLH transcription factor) in rice (Zhang et al. 2009). In this study, real-time PCR analyses showed that the expressions of the GA signaling pathway genes
15
sui1-1 NIP
10
5
0 OsGA2ox1 OsCPS
123
D18
EUI
GLD1
GLD2
IL1
OsKAO
SD1
SLR1 YABBY1
Plant Mol Biol (2011) 77:475–487
485
Table 5 Identification of differentially expressed genes (possibly related to the sui1 mutation) between sui1-1 and wild-type by microarray analysis Gene or cDNA
Protein and domain
AK288641
PSD activity
4.8
Upregulated
AK288207
PSD activity
4.31
Upregulated
AK240808 AK288503
PSD activity PSD activity
3.7 3.54
Upregulated Upregulated
AK288924
PSD activity
3.39
Upregulated
AK289245
PSD activity
3.28
Upregulated
AK288664
PSD activity
3.18
Upregulated
AK288783
PSD activity
3.13
Upregulated
AK289135
PSD activity
3.05
Upregulated
AK103470
Gibberellin 20-oxidase activity
7.36
Upregulated
NM_001071594
Cytochrome P450 family proteins
3.81
Upregulated
AK070156
Cytochrome P450 family proteins
3.53
Upregulated
AK071488
Cytochrome P450 family proteins
3.27
Upregulated
AK068691
Cytochrome P450 family proteins
3.07
Upregulated
AK066771
Ozone-responsive stress-related protein
AK068489
Ser/Thr protein kinase-like protein
AK062433
(S)-2-hydroxy-acid oxidase
3.8
Downregulated
AK067834 AB040744
Similar to WRKY transcription factor Helix-loop-helix dimerization region bHLH domain
3.35 6.8
Downregulated Downregulated
NM_001048323
Helix-loop-helix dimerization region bHLH domain
3.78
Downregulated
GID1, SLR1 (DELLA), and YABBY1 were significantly enhanced, and that of IL1 was slightly enhanced in sui-1. The GeneChip result showed that two bHLH transcriptional factors were downregulated in sui1-1. These data suggested that the bHLH proteins might play an important role in regulation of plant growth. Interestingly, the expression of the GA biosynthetic gene OsKAO was significantly reduced, while that of the GA deactivation gene EUI was slightly enhanced in sui1-1. Further studies on GA biosynthesis and deactivation and the roles of SUI1 in GA signaling and biological functions are required to better understand the properties and functions of this versatile enzyme. Phosphatidylserine (PS) is a membrane phospholipid that is ubiquitously present in membranes of eukaryotic and prokaryotic cells, playing an important role in cell death signaling, vesicular trafficking, lipid-protein interactions and membrane lipid metabolism (Vance and Steenbergen 2005). In yeasts and prokaryotes, it is formed from serine and CDP-diacylglycerol in a reaction catalyzed by PS synthase (PSS) (Kanfer and Kennedy 1964). In contrast, in mammalian cells, the serine base-exchange is catalyzed by at least two different enzymes that differ in their substrate specificity. Several PSS enzymes have been found and their encoding PSS genes cloned from prokaryotes, lower eukaryotes, and plants (Delhaize et al.
Fold change
Upregulated/ downregulated
111.86
Downregulated
8.22
Downregulated
1999; Vences-Guzma´n et al. 2008; Smith and Bu¨tikofer 2010; Yamaoka et al. 2011). A wheat cDNA (TaPSS1) encoding PSS was cloned by Delhaize and co-workers. High levels of TaPSS1 expression in Arabidopsis and tobacco (Nicotiana tabacum) led to the appearance of necrotic lesions on leaves, which may have resulted from the excessive accumulation of PS (Delhaize et al. 1999). Recently, Yamaoka and coworkers analyzed PSS results showed that PS is enriched in Arabidopsis floral tissues and that genetic disruption of PS biosynthesis decreased heterozygote fertility due to inhibition of pollen maturation. A few seeds with pss1-1 and pss1-2 knockout alleles escaped embryonic lethality but developed into sterile dwarf mutant plants. These plants contained no PS, verifying that PSS1 is essential for PS biosynthesis (Yamaoka et al. 2011). Here, we report that the recessive rice mutant sui1 exhibits shortened elongation of internodes, particularly the uppermost internode, during the heading stage. Sequence analyses indicated that OsSUI1 encodes a putative PSS family protein containing 425 amino acid residues, which shared around 78% amino acid sequence identity with At1g15110. In addition, the sui1 mutants also showed slightly decreased seed setting rate. The expression of the GA biosynthetic gene D18 (GA3ox2) was significantly enhanced in sui1. These results indicated that SUI1 might relate to IAA transportation form panicles and GA
123
486
biosynthesis regulated by IAA in rice. There are many reports of PSS family members in many different species, suggesting that this protein family has a fundamental function in eukaryotic and prokaryotic cells. However, searches in public databases revealed few similar proteins with known biological functions. To investigate the differences in expression levels of other genes between the wild-type and sui1, microarray analysis was carried out using RNA from flag leaves at the heading stage as the starting material. Genes whose expressions showed at least threefold differences between the mutant and the wild-type were further analyzed. Several genes were upregulated in the mutant, including sui1, genes encoding putative phosphatidylserine decarboxylases (PSD), a gene encoding a putative gibberellin 20-oxidase, and four genes encoding putative cytochrome P450 family proteins. Several genes were downregulated in sui1, including those encoding putative stress-related proteins, such as an ozone-responsive stress-related protein (similar to a Ser/Thr protein kinase-like protein), an (S)-2-hydroxy-acid oxidase, and a protein similar to a WRKY transcription factor (Xu et al. 2009; Fan et al. 2007; Rushton et al. 2010). Also downregulated in sui1 were two genes encoding putative proteins with helix-loop-helix dimerization-region bHLH domains, which are thought to be associated with hormone signaling (Table 5) (CarreteroPaulet et al. 2010). Further studies on the transcriptional regulation, cell signal transduction, and biological functions of PSS in rice are required to obtain a deeper insight into the properties and functions of this versatile enzyme. Acknowledgments We thank Dr. Jianru Zuo at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences for the critical reading of the manuscript, Dr. Bin Han (National Center for Gene Research and Institute of Plant Physiology and Ecology, Chinese Academy of Sciences) for providing BAC clones, and Honglan Yan for photography. This work was supported by grants from the National Natural Science Foundation of China (Grant Nos. 30921140408; 30710103903; 31171532), the Zhejiang Natural Science Foundation (Grant Nos. Y3100357, Y308044), and the Transgenic Plant Research and Commercialization Project of the Ministry of Agriculture of China (Grant No. 2008ZX08011-001, 2008ZX08001-002).
References Achard P, Genschik P (2009) Releasing the brakes of plant growth: how GAs shutdown DELLA proteins. J Exp Bot 60:1085–1092 Asano K, Miyao A, Hirochika H, Kitano H, Matsuoka M, Ashikari M (2010) SSD1, which encodes a plant-specific novel protein, controls plant elongation by regulating cell division in rice. Proc Jpn Acad Ser B Phys Biol Sci 86:265–273 Carretero-Paulet L, Galstyan A, Roig-Villanova I, Martı´nez-Garcı´a JF, Bilbao-Castro JR, Robertson DL (2010) Genome-wide classification and evolutionary analysis of the bHLH family of transcription factors in Arabidopsis, poplar, rice, moss, and algae. Plant Physiol 153:1398–1412
123
Plant Mol Biol (2011) 77:475–487 De Lucas M, Davie`re JM, Rodrı´guez-Falco´n M, Pontin M, IglesiasPedraz JM, Lorrain S, Fankhauser C, Bla´zquez MA, Titarenko E, Prat S (2008) A molecular framework for light and gibberellin control of cell elongation. Nature 451(7177):480–484 Delhaize E, Hebb DM, Richards KD, Lin JM, Ryan PR, Gardner RC (1999) Cloning and expression of a wheat (Triticum aestivum L.) phosphatidylserine synthase cDNA. Overexpression in plants alters the composition of phospholipids. J Biol Chem 274:7082– 7088 Fan HY, Chen J, Lu¨ CM, Zhang CY, Sun Q (2007) Proteomic Analysis of F2 Generation of Cucumber Against the Cucumber Powdery Mildew Disease. Acta Horticulturae Sinica 34:349–354 (Article in Chinese, abstract in English) Gangashetti MG, Jena KK, Shenoy VV, Freeman WH (2004) Inheritance of elongated uppermost internode and identification of RAPD marker linked to eui gene in rice. Curr Sci 87:469–475 Haubrick LL, Assmann SM (2006) Brassinosteroids and plant function: some clues, more puzzles. Plant Cell Environ 29: 446–457 Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6:271–282 Kanfer J, Kennedy EP (1964) Metabolism and function of bacterial lipids. II. Biosynthesis of phospholipids in Escherichia Coli. J Biol Chem 239:1720–1726 Kawakatsu T, Itoh J, Miyoshi K, Kurata N, Alvarez N, Veit B, Nagato Y (2006) PLASTOCHRON2 regulates leaf initiation and maturation in rice. Plant Cell 18:612–625 Kuge O, Nishijima M (1997) Phosphatidylserine synthase I and II of mammalian cells. Biochim Biophys Acta 1348:151–156 Li J, Yuan L (2000) Hybrid rice: genetics, breeding and seed production. Plant Breed Rev 17:150–158 Liu Y, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 8:457–463 Luo A, Qian Q, Yin H, Liu X, Yin C, Lan Y, Tang J, Tang Z, Cao S, Wang X, Xia K, Fu X, Luo D, Chu C (2006) EUI1, encoding a putative cytochrome P450 monooxygenase, regulates internode elongation by modulating gibberellin responses in rice. Plant Cell Physiol 47(2):181–191 Miki D, Itoh R, Shimamoto K (2005) RNA silencing of single and multiple members in a gene family of rice. Plant Physiol 138:1903–1913 Miyoshi K, Ahn BO, Kawakatsu T, Ito Y, Itoh J, Nagato Y, Kurata N (2004) PLASTOCHRON1, a timekeeper of leaf initiation in rice, encodes cytochrome P450. Proc Natl Acad Sci USA 101: 875–880 Qiao BJ, Wang YY, Zhu XB, Hong DL (2007) QTL analysis of the uppermost internode length in rice under different growing environments. Yi Chuan 29:1001–1007 (Article in Chinese, abstract in English) Rieu I, Eriksson S, Powers SJ, Gong F, Griffiths J, Woolley L, Benlloch R, Nilsson O, Thomas SG, Hedden P, Phillips AL (2008a) Genetic analysis reveals that C19-GA 2-oxidation is a major gibberellin inactivation pathway in Arabidopsis. Plant Cell 20(9):2420–2436 Rieu I, Ruiz-Rivero O, Fernandez-Garcia N, Griffiths J, Powers SJ, Gong F, Linhartova T, Eriksson S, Nilsson O, Thomas SG, Phillips AL, Hedden P (2008b) The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle. Plant J 53:488–504 Rushton PJ, Somssich IE, Ringler P, Shen QJ (2010) WRKY transcription factors. Trends Plant Sci 15:247–258
Plant Mol Biol (2011) 77:475–487 Sakamoto T, Miura K, Itoh H, Tatsumi T, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Agrawal GK, Takeda S, Abe K, Miyao A, Hirochika H, Kitano H, Ashikari M, Matsuoka M (2004) An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol 134(4):1642–1653 Shen ZT, Yang CD, He ZH (1987) Studies on eliminating panicle enclosure in WA type MS line of rice Oryza sativa subsp. indica. Chin J Rice Sci 1:95–99 (Article in Chinese, abstract in English) Smith TK, Bu¨tikofer P (2010) Lipid metabolism in Trypanosoma brucei. Mol Biochem Parasitol 172:66–79 Takeda K (1977) Internode elongation and dwarfism in some gramineous plants. Gamma Field Symp 16:1–18 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599 Tusher VG, Tibshirani R, Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98:5116–5121 Vance JE, Steenbergen R (2005) Metabolism and functions of phosphatidylserine. Prog Lipid Res 44:207–234 Vences-Guzma´n MA, Geiger O, Sohlenkamp C (2008) Sinorhizobium meliloti mutants deficient in phosphatidylserine decarboxylase accumulate phosphatidylserine and are strongly affected during symbiosis with alfalfa. J Bacteriol 190:6846–6856 Wang L, Yin H, Qian Q, Yang J, Huang C, Hu X, Luo D (2009) NECK LEAF 1, a GATA type transcription factor, modulates organogenesis by regulating the expression of multiple regulatory genes during reproductive development in rice. Cell Res 19:598–611 Xu ZS, Liu L, Ni ZY, Liu P, Chen M, Li LC, Chen YF, Ma YZ (2009) W55a encodes a novel protein kinase that is involved in multiple stress responses. J Integr Plant Biol 51:58–66 Yamamuro C, Ihara Y, Wu X, Noguchi T, Fujioka S, Takatsuto S, Ashikari M, Kitano H, Matsuoka M (2000) Loss of function of a
487 rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 12:1591– 1606 Yamaoka Y, Yu Y, Mizoi J, Fujiki Y, Saito K, Nishijima M, Lee Y, Nishida I (2011) PHOSPHATIDYLSERINE SYNTHASE1 is required for microspore development in Arabidopsis thaliana. Plant J 67(4):648–661 Yang RC, Huang RH, Zhang QQ, Zhang SB, Liang KJ (2000) Developing eui-cytoplasmic male sterile lines and applying them in hybrid rice breeding. Int Rice Res Newsl 25:11–12 Yang SL, Yang RC, Qu XP, Zhang QQ, Huang RH, Wang B (2001) Genetic and microsatellite analyses of a new elongated uppermost internode gene eui2 of rice. Acta Botanica Sinica 43:67–71 (Article in Chinese, abstract in English) Yang RC, Zhang SB, Huang RH, Yang SL Zhang QQ (2002) Breeding technology of eui hybrids of rice. Sci Agric Sin 35:233–237 (Article in Chinese, abstract in English) Yin C, Gan L, Ng D, Zhou X, Xia K (2007) Decreased paniclederived indole-3-acetic acid reduces gibberellin A1 level in the uppermost internode, causing panicle enclosure in male sterile rice Zhenshan 97A. J Exp Bot 58(10):2441–2449 Zhang LY, Bai MY, Wu J, Zhu JY, Wang H, Zhang Z, Wang W, Sun Y, Zhao J, Sun X, Yang H, Xu Y, Kim SH, Fujioka S, Lin WH, Chong K, Lu T, Wang ZY (2009) Antagonistic HLH/bHLH transcription factors mediate brassinosteroid regulation of cell elongation and plant development in rice and Arabidopsis. Plant Cell. 21(12):3767–3780 Zhu Y, Nomura T, Xu Y, Zhang Y, Peng Y, Mao B, Hanada A, Zhou H, Wang R, Li P, Zhu X, Mander LN, Kamiya Y, Yamaguchi S, He Z (2006) ELONGATED UPPERMOST INTERNODE encodes a cytochrome P450 monooxygenase that epoxidizes gibberellins in a novel deactivation reaction in rice. Plant Cell 18:442–456
123
