Identification and expression profiling of CLCuV ... - DergiPark

Turkish Journal of Biology http://journals.tubitak.gov.tr/biology/

Research Article

Turk J Biol (2014) 38: 226-237 © TÜBİTAK doi:10.3906/biy-1307-55

Identification and expression profiling of CLCuV-responsive transcripts in upland cotton (Gossypium hirsutum L.) Beenish AFTAB*, Muhammad Naveed SHAHID, Sania RIAZ, Adil JAMAL, Bahaeldeen Babiker MOHAMED, Muzna ZAHUR, Mahwish AFTAB, Bushra RASHID, Tayyab HUSNAIN Center of Excellence in Molecular Biology, University of Punjab, Lahore 54000, Pakistan Received: 26.07.2013

Accepted: 18.11.2013

Published Online: 28.03.2014

Printed: 28.04.2014

Abstract: CLCuV is one of the most serious causes of cotton damage for which no adequate remedy is available. The possible solution to this problem may be the transfer of resistant genes into the background of agronomical CLCuV-tolerant varieties. In response to viral infection, several plants may show qualitative and quantitative variations in gene expression. To study gene expression between diseased and tolerant plants, DDRT-PCR was performed. Upregulated gene expression was observed among cDNA transcripts screened through random primers. Seven transcripts have significant homology with known proteins (ribosomal protein, photosystem protein unit, membrane protein, and a predicted hypothetical protein). Quantitative real-time PCR showed varied levels of expression in tolerant as compared to CLCuV-diseased leaf samples. The potential candidate transcript DET1 was generated full length as GhLCVR. The deduced amino acid sequence, with a molecular mass of 16.1 kDa, contains a single open reading frame of 142 amino acids. The predicted amino acid sequence shares 33%–80% identities with Glycine max, Populus trichocarpa, Vitis vinifera, Zea mays, Ricinus communis, Arabidopsis thaliana, Picea sitchensis, Physcomitrella patens, and Staphylococcus aureus in descending order. This gene and other identified DETs could provide a valuable resource for the future improvement of cotton varieties against CLCuV infection. Key words: Differential display, leaf curl virus, stress tolerance

1. Introduction Cotton leaf curl disease (CLCuD) is a serious disorder in several plants of the family Malvaceae, most importantly cotton (genus Gossypium L.). The disease occurs across Africa and southern Asia (Sattar et al., 2013). Cotton production has declined 11.3%, i.e. from 12,914,000 bales in 2009–2010 to 11,460,000 bales in 2010–2011 (Pakistan Economic Survey, http://finance.gov.pk/survey/ chapters_13/02-Agriculture.pdf). One of the major factors in this decline is the prevalence of the dreadful disease caused by cotton leaf curl virus (CLCuV) in the major cotton-growing areas of the Punjab and Sindh. Following resistance-breaking in cotton in 2001, a single begomovirus (cotton leaf curl Burewala virus [CLCuBuV]) was identified across the Punjab in Pakistan (Amrao et al., 2010b; Sattar et al., 2013). It has now spread to India, and more recently to central and southern Sindh Province (Briddon and Markham, 2000; Briddon, 2003; Amrao et al., 2010a). G. hirsutum is the most widely grown cotton species and constitutes 80% of the total cotton production in Asia (Khan et al., 2011). At present, no resistant variety exists against this disease; even Bt cotton is vulnerable to this disease. Bt-cotton strain sown under field conditions * Correspondence: [email protected]

226

also shows typical symptoms of CLCuV (Perveen et al., 2004). This menace has badly afflicted the crop in the last few years (Briddon, 2003). CLCuV is the causal agent of a damaging disease of cotton (CLCuD) that is caused by a number of different begomoviruses and vectored by the silverleaf whitefly (Bemisia tabaci) (Kauter, 2007). CLCuV is a whiteflytransmitted monopartite begomovirus with symptommodulating satellites belonging to the family Geminiviridae (Briddon and Markham, 2000; Ilyas et al., 2010). The disease is characterized by thickening of veins, upward curling of leaves, and cup-shaped laminar outgrowths on the undersides of leaves called ‘enation’, which results in many adaptation strategies in plants (Briddon and Markham, 2000; Akhtar et al., 2002a; Beck et al., 2007). To date, CLCuV-tolerant cotton lines have been introduced that were developed by conventional breeding/ selection. After initially showing promise in the control of CLCuV disease, recent reports have suggested that the virus complex has overcome the resistance (Mansoor et al., 2003). However, little is known about the molecular and physiological events regulating gene expression in cotton in disease conditions. Study of CLCuV-responsive

AFTAB et al. / Turk J Biol

gene expression in tolerant and diseased plants is therefore important, as it may enhance our knowledge of the role of differential gene expression and molecular mechanisms of CLCuV stress tolerance. Differential display of mRNA, first described by Liang and Pardee (1992), is a technique for making broadscale surveys of transcribed gene expression patterns and subsequently cloning sequences with desired expression characteristics. It is a sensitive and powerful technique for isolating clones of eukaryotic genes regulated in response to various stimuli, particularly CLCuV stress. This method not only reveals all aspects of gene regulation but also suggests qualitative and quantitative differences. The present study attempted to identify and isolate the differentially expressed G. hirsutum transcripts responsive to CLCuV tolerance. The identification of uniquely expressed transcripts is an initial step in identification of the novel gene(s) and characterization of their regulatory elements, which will eventually direct the discovery of novel gene functions and will also confer new evidence for better understanding of the mechanism(s) concerned with biotic stress response. 2. Materials and methods 2.1. Plant material and total RNA isolation Seeds of G. hirsutum L. Var. CIM-482 (CLCuV-tolerant) were collected from an authentic source, Central Cotton Research Institute (CCRI), Multan, Pakistan. Delinted seeds were sown in a natural environment and normal conditions in the fields of the Center of Excellence in Molecular Biology (CEMB), Lahore, Pakistan. Plants were allowed to acquire CLCuV infection naturally. At the initiation of symptoms, CLCuV disease severity was assessed by visual observation and as per disease-rating scale (Perveen et al., 2005). The symptoms included upward curling of leaves, vein thickening, and the most distinctive symptom, which is the formation of leaflike enations on the undersides of leaves. Initially, fully symptomatic (diseased), mildly symptomatic (tolerant), and asymptomatic (control) plant leaves were sampled randomly in liquid nitrogen. Later, total genomic DNA was isolated from all types of samples by the CTAB method (Doyle and Doyle, 1990). For the confirmation of CLCuV disease, a set of CLCuV-specific primers corresponding to the conserved regions of the virus genome, viz. 5’-CCAGGATTGCACAGGAAGAT-3’ and 5’-TGTGGGGACATCTAGACCTG-3’, were employed in the PCR (unpublished data). Total RNA was isolated according to Jaakola et al. (2001) with minor modifications. 2.2. Differential display reverse transcriptase (DDRT) PCR Differential display was performed according to Liang and Pardee’s (1992) method with minor modifications.

RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas, USA) was used to reverse-transcribe DNAsetreated total RNA through temperature changes in a thermocycler (MJ Research, Inc., Waltham, MA, USA, model PTC-100). PCR amplification of each cDNA was performed using 6 arbitrary and 3 anchoring primers providing 18 combinations (Table 1). PCR reactions were performed in a 25-μL volume containing 3 μL of cDNA, arbitrary primer (1 μM), anchored primer (1 μM), 1X PCR buffer (MgCl2, 2.5 mM), dNTPs (0.25mM), and 1 unit Taq polymerase in the thermocycler (ABI, Gene Amp PCR system 9700). Resolution of DD-PCR products was obtained by electrophoresing samples on 2% agarose gel at 50V. The gel was visualized by GrabIT v. 2.5 transilluminator software on a gel document system (Ultra-violet Products). Differentially expressed bands that appeared consistently in tolerant samples were excised and eluted using a DNA Gel Extraction Kit (Fermentas, USA). Confirmed bands were reamplified with eluted DNA using the same sets of primers and PCR conditions. Quality control was conducted to monitor contamination by residual genomic DNA. Reamplified DNA fragments were then cloned into pCR 2.1 vector (TA Cloning Kit, Invitrogen, USA) and transformed in E. coli cells. Plasmid DNA was isolated from a minimum of 4 clones per transformation following Bimboim and Doly (1979). The screening of positive clones was confirmed through restriction digestion with EcoR1 (Fermentas, USA) and PCR amplification with M13 primers. 2.3. DNA sequencing and homology studies On both strands, the purified clones were sequenced using vector-specific M13 primers. The sequencing reaction was performed using a Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, USA) and an Table 1. Primer sequences used for differential display PCR. 5’ Arbitrary primers

Sequence (5’–3’)

A1

AAGCTTGATTGCC

A2

AGCTTCAAGACC

A3

AAGCTTTATTTAT

A4

AAGCTTCGACTGT

A5

AAGCTTGCCTTTA

A6

AAGCTTCTTTGGT

3’ Anchored oligo-dT primers

Sequence (5’–3’)

B1

AAGCTTTTTTTTTTTTTA

B2

AAGCTTTTTTTTTTTTTG

B3

AAGCTTTTTTTTTTTTC

227


automated DNA sequencer (ABI PRISM 3700). Sequences were analyzed manually using Chromas software (v. 1.45). The deduced amino acid sequence and nucleotide sequence of each clone were processed through BLAST (Altschul et al., 1990) to find homologous genes and gene annotations. 2.4. Expression analysis of differentially expressed transcripts Reverse-transcription PCR was carried out by using specific primers for each transcript (Table 2). Quantitative real-time PCR with 50 ng of cDNA for each reaction was also carried out for all transcripts in an ABI 7500 system (Applied Biosystems, USA) with Maxima TM SYBR Green/ROX qPCR Master Mix (2×) (Fermentas, USA). To normalize data, the cotton glyceraldehyde3-phosphate dehydrogenase (GAPDH) was used as housekeeping control. The thermocycler was programmed for denaturation at 95 °C for 3 min, 95 °C for 30 s, followed by annealing at 55 °C for 30 s, extension at 72 °C for 45 s, and repeated to annealing temperature for an additional 40 cycles. The final extension was done at 72 °C for 10 min. Each reaction was performed in triplicate. The relative gene expression study was conducted via SDS v. 3.1 software (Applied Biosystems, USA). 2.5. 5’-Rapid amplification of cDNA ends (RACE)-PCR analysis RNA ligase-mediated 5’ RACE was performed using the GeneRacer kit (Invitrogen, USA). Total RNA was used to generate RACE-ready firststrand cDNA for the full-length gene of transcript DET1, and gene-specific primers GhLCVR-1 5’-GAAGCCTCCAAATCCAATGGCTAGC-3’ and GhLCVR-2 5’-TCCTCTGATTCAGGTGTGGCAGAA-3’ were designed.

Touchdown PCR (Don et al., 1991) cycling parameters were exercised as initial denaturation at 94 °C for 2 min. Cycle 1, consisting of denaturation at 94 °C for 2 min, annealing at 62 °C for 30 s, and extension at 68 °C for 1 min, was conducted. The annealing temperature was decreased by 2 °C until 62 °C was reached for every 5 subsequent cycles. A supplementary 25 cycles at an annealing temperature of 62 °C were accomplished. PCR products were resolved on 1% (w/v) agarose gel. A DNA fragment of the estimated size was eluted, cloned, and sequenced. 2.6. Data analysis To obtain the originally inserted promoter fragment sequence, vector sequences were removed manually by using VecScreen online software at the NCBI database (http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen. html). Sequence analysis of screened sequences was executed using a BLAST search (Altschul et al., 1990) and pairwise alignment algorithm programs (www. ebi.ac.uk/emboss/align). The conceptual translation of nucleotides was accomplished using an open reading frame finder program (ORF, www.ncbi.nlm.nih.gov/gorf/ gorf.html). Subcellular localization and molecular weight was determined via Expasy server. Multiple sequence alignment was conducted using ClustalW (Thompson et al., 1994), with default parameters via EMBnet (http:// www.ch.embnet.org/software/ClustalW.html). Gray and black shadings were supplemented with BOXSHADE indicating conserved amino acid residues (http://www. ch.embnet.org/software/BOX_form.html). Phylogenetic analysis was performed with all full-length GhLCVR protein sequences publicly accessible for plant and bacteria. MEGA software package v. 5.10 (Tamura et al., 2011) was used to generate a rooted neighbor-joining

Table 2. Primer sequences used for real-time PCR. Transcript

Forward primer (5’–3’)

Reverse primer (5’–3’)

Amplicon length (bp)

A6B2

CATCACTAAGTTCTGCCACACC

ACATGAAGCCTCCAAATCCA

103

A2B1

AAGACCACAACCCAGAATGG

ACCGGGAACTGGTCAATAAA

137

A5B1

TCACCCACATCAATAACCAAGA

TTGGATGTGCCAGATGAAGA

100

A1B2

TATGTTATGCGCGGTTTCTG

TTGCCATAATGGTTCAGTTCC

134

A6B1

TTCTTTGGTGGATCTCTGGTG

AGGACCAGGTAAACATGATCAAA

107

A5B2

AGAAAGTGGAGGCTCGATGA

GCACGATCAACTGCTCTTCA

115

A4B2

GCTTCGACTGTATTAGCATCTGT

TTTTTGCACACCAGAAGGAA

112

GAPDH

TGGGGCTACTCTCAAAGGGTTG

TGAGAAATTGCTGAAGCCGAAA

162

228


phylogenetic tree from the previously aligned amino acid sequences, as used by Dundar et al. (2013). Sequence gaps were treated as missing data. Bootstrap values from 1050 replicates were generated to verify relative support level for tree topology. 3. Results Differential display RT-PCR was used for searching the genes concerned with CLCuV tolerance. Differential display technique reveals all aspects of up- and downregulation as well as the absence/presence of bands, suggesting qualitative differences and signals with varying intensity, showing quantitative differences under particular conditions (Voelckel and Baldwin, 2003). A total of 26 cDNA bands from the tolerant leaf samples showed consistent differential intensity with 18 primer combinations of 6 arbitrary and 3 anchored primers, while 40 were repressed in response to disease stress in all experiments. Out of 26 apparently induced gene fragments,

only 7 transcripts were confirmed as differentially expressed transcripts (DETs) (Figure 1); the other 19 were rejected as false positives on reamplification and in the quality-control assay. All the differentially expressed transcripts showed upregulated expression except A6B1, which was the only newly expressed transcript in response to CLCuV stress. 3.1. Homology studies of transcripts On both strands, the cloned transcripts were sequenced and analyzed using Chromas (v. 1.45). The vector was removed via NCBI VecScreen (http://www.ncbi.nlm.nih. gov/VecScreen/VecScreen.html). A GenBank database search revealed 4 transcripts, i.e. DET1, DET2, DET4, and DET5, whose size ranged between 120 and 500 bp, which conferred significant homologies with known genes (Figure 2). However, other transcripts, i.e. DET3, DET6, and DET7, did not show homology with any of the known protein motifs, as they encode for a novel protein (Table 3).

DET1 DET2

DET3

DET6 DET5

DET7

DET4

Figure 1. Differential display profile of Gossypium hirsutum with different set of primers for identification of differentially expressed transcripts (DETs) on 2% (w/v) agarose gel. Odd-numbered lanes represent disease-tolerant samples while even-numbered lanes represent diseased samples in Figures 2A, 2B, and 2D, and vice versa in Figure 2C. The differentially expressed transcripts (DETs) in tolerant samples are indicated by arrows. L represents DNA ladder (2A and 2D): 50-bp DNA ladder, (2B and 2C): 100 bp DNA ladder (Fermentas, USA). NC represents negative control.

229


Figure 2. Amino acid sequence homology of 4 transcripts with reported identical proteins. The rest of the transcripts (DET1, DET3, and DET6) did not show any significant homology with known genes. The deduced amino acid sequences were aligned using NCBI BLAST pairwise alignment algorithm programs (http://www.ncbi.nlm.nih.gov/BLAST/). Table 3. Clone identification and homologies. DET no.

Clone identification

Size (bp)

GenBank accession #

Homology

DET1

A6B2

345

GT066299

PREDICTED: hypothetical protein XP002272215.1

DET2

A2B1

234

GT066297

Membrane protein/YP_291601.1

DET3

A5B1

187

GT066293

No homology

DET4

A1B2

270

GT066294

Ribosomal protein S14 /ACF33368.1

DET5

A6B1

189

GT066296

Photosystem reaction center subunit XI /ABU39903.1

DET6

A5B2

484

GT066295

No homology

DET7

A4B2

120

GT066298

No homology

3.2. Expression profiling Semiquantitative RT-PCR and quantitative real-time PCR were conducted to confirm that all DETs were highly expressed in the tolerant leaf samples under disease conditions (Figure 3A). The expression intensities of 7 transcripts were estimated by real-time PCR. A 162-bp GAPDH gene was used as the reference gene to normalize the expression level. The results clearly show that all transcripts depicted a significant level of overexpression in tolerant leaves as compared to diseased leaves (Figure 3B). There is 1.8-fold higher expression of DET1, 0.7-fold

230

higher expression of DET2, 1.4-fold higher expression of DET4, 0.3-fold higher expression of DET5, 0.1-fold higher expression of DET3, 0.4-fold higher expression of DET6, and 0.2-fold higher expression of DET7 compared to the control. There were very low expression levels for DET3 and DET7, suggesting that they do not play any significant role in disease tolerance. However, the other 4 transcripts were strongly upregulated as a result of disease stress tolerance. All the confirmed transcripts were submitted as DETs to the NCBI GenBank database (Table 3).


3.5 A

B

Relative fold expression

3

GAPDH DET7 DET6 DET4 DET5 DET3 DET2 DET1

Diseased Tolerant

2.5 2 1.5 1 0.5 0 DET1 DET2 DET3 DET4 DET5

DET6 DET7

Figure 3. (A and B) RT-PCR and real-time PCR expression analysis of cotton transcripts in CLCuV-diseased and -tolerant leaf samples, respectively. Cotton GAPDH gene was used as the housekeeping control. RT-PCR product for each sample was separated on a 1.8% (w/v) agarose gel.

3.3. Full-length studies of GhLCVR from G. hirsutum On the basis of the expression profile and homology studies, one of these transcripts, A6B2 (345 bp), was selected, which contained a poly-A tail. To generate a fulllength clone, the truncated 5’ end of this gene was obtained from tolerant leaves’ RNA extracts by RACE-PCR. RACEPCR endowed a 296-bp fragment that also contained the 5’ UTR region. A 639-bp full-length cDNA clone was achieved by overlapping the RACE product to the partial cDNA isolated by differential display (Figure 4A). 3.4. Phylogenetic analysis of GhLCVR The full-length cDNA was cloned in TA vector, sequenced, and deposited in GenBank with accession number HQ338125 (GhLCVR). A 30-bp upstream fragment to the

initiation codon (ATG) corresponds to the 5’ UTR, a 180bp downstream fragment to the termination codon (TAA) corresponds to the 3’ UTR and a poly-A tail extent a region of 13 bp ranging from 627 to 639 (Figure 4B). Through National Center for Biotechnology Information (NCBI) BLAST, a sequence similarity search was implemented to identify 9 proteins from different plant species to which the deduced amino acid sequence of G. hirsutum gene (GhLCVR) was most strongly allied. The results depicted that the protein of GhLCVR has high similarity (77% to 63%) to the predicted: hypothetical protein from V. vinifera. These percentages of similarity are high enough to consider GhLCVR to be a member of this protein family of plants. The deduced protein comprised 142 amino acid

(c DNA) 639 bp

A. GhLCVR -N (cDNA RACE)

A6/B2 (cDNA DDR T)

B.

ATG

5’UTR (30 bp)

TAA

Coding region (429 bp)

AAAAAAAAA ’UTR (180 bp) 3

Figure 4. (A) Schematic representation of the 3 steps used to obtain the full-length gene. Primer pairs used to obtain gene specific fragments are indicated. (B) Schematic representation of complete gene sequence of GhLCVR. Dashed lines indicate untranslated regions (UTRs). Solid bar indicates the coding region. The number of nucleotides in the coding region and each UTR is indicated.

231


residues encoded by the 429-bp coding region of GhLCVR. The cDNA fragment of GhLCVR gene encodes for protein with a predicted molecular weight of 16.1 KDa using SAPS (http://www.isrec.isb-sib.ch/software/SAPS_form.html). The deduced 142 amino acid protein coded by the 429-bp coding sequence of GhLCVR was compared to the known protein sequences. Maximum homology of GhLCVR protein was shown with hypothetical protein of G. max (80%) and hypothetical protein of P. trichocarpa (70%). predicted: hypothetical protein of V. vinifera (68%), hypothetical protein of Z. mays (65%), oligopeptidase, putative of R. communis (64%), A. thaliana (57%), unknown protein of P. sitchensis (50%), predicted protein of P. patens (48%), and rod-shape–determining protein MreC of S. aureus (33%). Among all the amino acid sequences, a consensus sequence of hypothetical protein domain is at hand (Figure 5). These proteins share this specific domain with a high degree of sequence similarity. A phylogenetic tree was constructed based on the multiple sequence alignment of GhLCVR protein with that of bacteria and plants. From the phylogenetic tree,

GhLCVR is found to be closely related to an unknown protein of P. sitchensis and distantly related to R. communis and V. vinifera (Figure 6). All 9 related proteins might have familiar provenance, and in the same subgroup each member might have diverged relatively late during evolution. 4. Discussion CLCuV has attained the status of the largest threat to cotton production since the late 1980s in Pakistan. Due to the widespread occurrence of such biotic stresses, plants are affected in many ways, which ultimately leads to economic losses. However, plant biotechnology can provide a quick and direct method of introducing a gene of interest into crops, which seems to be a more attractive approach for improving resistance against different threats (Cushman and Bohnert, 2000). Through screening methods, the cultivar CIM-482 showed resistant to tolerant behavior to CLCuV infection in Punjab in 2000 (Mahmood et al., 2002; Perveen et al., 2005). Recently, however, this cultivar was also found to be susceptible to a great extent to CLCuV

Figure 5. Alignment of GhLCVR protein with related proteins from other species. The deduced amino acid sequence of GhLCVR was aligned using ClustalW with default parameters. Black and grey shadings done with BOXSHADE indicate conserved amino acid residues.

232

AFTAB et al. / Turk J Biol 32 45

100

39 95

98

Populus thichocarpa Vitis vinifera Ricinus communis Glycine max Arabidopsis thaliana Zea mays Piceasitchensis

96

Physcomitrella patens Gossypium hissutum Staphylococcus aureus

0.1

Figure 6. A distance-based neighbor-joining (Saitou and Nei, 1987) tree relating complete G. hirsutum GhLCVR amino acid sequence to full-length related amino acid sequences from other plants. A neighbor-joining tree was constructed with MEGA 5 (Tamura et al., 2011). A bootstrap analysis (1050 replicates) was performed using Staphylococcus aureus as an out-group. Sequences were aligned with ClustalW.

disease, due to a resistance-breaking combination of virus and satellite DNA or changing environmental conditions suitable for its establishment and the presence of whitefly, the insect vector of CLCuV (Sattar et al., 2013). In the present study, a highly sensitive molecular technique, namely differential display reverse-transcribed (DDRT) PCR was applied to find CLCuV-responsive genes in G. hirsutum. This technique has also been used recently for searching abiotic-stress–tolerant genes from G. arboreum (Shahid et al., 2012). It is capable of identifying and isolating those genes that respond to CLCuV disease stress, to increase understanding of the molecular mechanisms and differential gene expressions under tolerant and diseased conditions. Repeating PCR reactions with each primer combination and treatment reduces the chances of false positives; the residual genomic DNA contamination can be avoided by a negative control reaction (Voelckel and Baldwin, 2003). The cDNA bands expressed via DDRT-PCR were categorized into 3 classes: suppressed (downregulated), newly expressed (activated due to stress), and induced (upregulated), on the basis of comparative intensity (Jain et al., 2001). With the total of 6 arbitrary primers in combination with 3 anchored primers, 26 gene transcripts were found to be induced; 1 is newly expressed while 40 are suppressed following CLCuV disease stress. This indicates that many genes are both qualitatively and quantitatively suppressed, reducing overall protein synthesis. This gene suppression may be due to the result of a counterdefense of the virus that has evolved suppressors. All viruses that have been investigated have been shown to encode 1 or more suppressors (Bivalkar-Mehla et al., 2011; Sattar et al., 2013). In consequence, 7 cDNA fragments were confirmed

through the screening of 26 upregulated fragments. The discrepancy between these experiments is most probably due to limitations of DDRT-PCR, for instance the intricacy in excising a single amplicon from differential-display gel and amplification of a parallel-sized nonspecific cDNA population (Debouck, 1995). A search of GenBank databases revealed that 4 transcripts, whose size ranged between 150 and 500 bp, showed significant homologies with known genes (Table 3), while the other 3 showed nonsignificant homologies to the known genes. The transcript designated as EST1 has homology with V. vinifera predicted: hypothetical protein. Hypothetical proteins (HP) are the proteins predicted from nucleic acid sequences only, and protein sequences with unknown function. The legion of HP is awaiting experiments to show their existence at the protein level, and subsequent bioinformatics handling in order to assign proteins tentative functions is mandatory (Lubec et al., 2005). About half the proteins in most genomes are candidates for HPs (Minion et al., 2004; Lubec et al., 2005). Detection of new HPs offers the presentation of not only new structures but also new functions (Lubec et al., 2005), which can prove to be important in recognizing host adaptations to disease stresses. Advance characterization of such genes will provide complete information on respective proteins’ functions in the host plant’s adaptation, or to disease stress response. The transcript designated as EST2 has homology with the membrane protein of bacteria (Prochlorococcus marinus). This membrane protein consists of 83 amino acids (Kettler et al., 2007). In several plant–parasite interactions, resistance necessitates complementary expression of 2 genes: a plant resistance gene from the

233


host plant (R gene), and a corresponding pathogen avirulence gene from the invading pathogen (avr gene) (Lebrun-Garcia et al., 1999; Bonas and Lahaye, 2002). R genes confer resistance to different pathogens, viruses, bacteria, fungi, and nematodes (Keen, 1990, 1992; de Wit, 1992; Lebrun-Garcia et al., 1999). These R genes can be classified into 5 groups depending on the combination of different structural domains; one of these groups comprises domains sharing homology with Toll protein/ interleukin-1 receptor and membrane-spanning domains (Hammond-Kosack and Jones, 1997). The transcript referred to as DET4 has high homology with ribosomal protein S14 (Rps14). S14 ribosomal protein is predominantly found in young leaves and hypocotyls, i.e. in organs with high mitotic activity (Larkin et al., 1989; Cherepneva et al., 2003). Ribosomal proteins are prime candidates for recruitment to extraribosomal functions and are ubiquitous. Ribosomal proteins (RPs) are prolific RNA-binding proteins present in every cell. It appears likely that these would be recruited to perform many auxiliary functions, predominantly by the viruses, which are proficient at seizing the cellular machinery (Weisberg, 2008; Warner and McIntosh, 2009). Autoregulation of ribosomal protein production is less pervasive in eukaryotic cells, but there are frequent documented cases of ribosomal proteins (RPs) regulating their own synthesis. The transcript level of the housekeeping genes like ribosomal proteins may vary during disease stress due to the differences in metabolic activities being carried out with defense mechanisms. Genes specifying Rps14 have also been identified in A. thaliana (Brandt et al., 1993), Brassica napus (ACY66287.1), Carica papaya (YP_001671681), Gonystylus bancanus (ACF33368.1), G. hirsutum (YP_538933), Z. mays (Larkin et al., 1989), and Oryza sativa (Kubo et al., 1999). Thus, evolution has employed the RNA-binding characteristics of RPs to balance the synthesis of individual RPs with that of rRNA and with each other. This is clearly an extraribosomal function, but not in an extraribosomal system (Warner and McIntosh, 2009). The gradual increase in the DET4 transcript level during CLCuV stress may indicate the stimulation of ribosomal machinery to accelerate the metabolic pathways to meet the demands of the defense response. The BLAST search indicated that this transcript does not have homology to the reported defense-related ESTs, but it might represent a singleton, indicating a rare gene transcript. The transcript designated as DET5 has high homology with photosystem reaction centre subunit XI. The polypeptide of photosystem reaction centre subunit XI ranges from 132 to 220 amino acid residues in different plant species. The photosystem I (PSI) found in plants and algae has the same basic function as PSI in cyanobacteria; i.e. it mediates the light-driven electron transport from

234

plastocyanin (or cytochrome c in some species) to ferredoxin (or flavodoxin) (Scheller et al., 2001). The subunits are named according to their genes, PsaA to PsaX (Golbeck, 1994; Chitnis, 1996; Fromme et al., 2001). In higher plants, the gene (PsaL) encoding polypeptide for subunit XI of photosystem I reaction center (PSI) is located in the nucleus (Ikeuchi and Inoue, 1991; Flieger et al., 1993; Scheller et al., 2001; Jensen et al., 2007). The polypeptide, designated as PSI-L subunit or subunit XI, is an integral membrane protein with a mature size of about 18 kDa (Fromme et al., 2001; Scheller et al., 2001). In some plants, for instance Ammopiptanthus mongolicus, the most highly representative transcripts in stress-response are the photosynthetic-related proteins, including the photosystem I reaction center subunit XI (Liu et al., 2013). The eukaryotic subunit does not contain any remarkable distinguishing features. From the predicted sequence, a large 10-kDa N-terminal region is estimated on the stromal side of the membrane (Ikeuchi and Inoue, 1991; Flieger et al., 1993; Scheller et al., 2001). PSI-L helps in stabilization of the PSI-H subunit (an integral membrane protein positioned near PSI-L). The downregulated PSI-L in transgenic plants has a secondary loss of PSI-H, and thus the function of PSI-L in plants seems to be intervening in an interaction with PSI-H. Since PSI-L is fairly conserved between cyanobacteria and plants, it is difficult to reconcile a role for PSI-L in interaction with PSI-H with the fact that PSI-H is not present in cyanobacteria. Most likely, PSI-L plays an additional role in both cyanobacteria and plants that is not yet understood (Scheller et al., 2001). However, expression changes of the photosynthetic-related genes may reflect their involvement in stress acclimation as in A. mongolicus (Liu et al., 2013). The expression studies of putative cDNA transcripts were confirmed via real-time quantitative PCR analysis. Real-time quantitative PCR analysis was used to detect the level of expression of all 7 confirmed DETs. The results of real-time PCR showed that the level of overexpression was not the same in all transgenic plants studied, as it varied from 0.1- to 1.8-fold. The novel polypeptide is predicted to be of 142 amino acids, containing a single open reading frame encoded by the GhLCVR. The deduced protein sequence of the gene shares significantly high identities with G. max (ACU14904), P. trichocarpa (XP00231456), V. vinifera (XP002272215), Z. mays (NP001141155), and A. thaliana (AAG28905). All these proteins belong to the hypothetical protein family, and a consensus sequence exists of the hypothetical protein domain among all sequences. These proteins share this specific domain with a high degree of sequence similarity. The observed induction of GhLCVR indicates that this gene may function as a switch in adaptation to CLCuV stress. However, no evidence exists


in bacteria or plants as to the molecular or biochemical mode of action of such a switch. It is, however, generally hypothesized that all these DETs are involved in stress responses of plants. Phylogenetic analysis reveals that the GhLCVR protein of G. hirsutum is grouped with the unknown protein of P. sitchensis and is divergent from R. communis and V. vinifera proteins. The phylogenetic relationships of GhLCVR revealed that sequence divergence, gene conversion, and gene duplication have played parts in the evolution of GhLCVR, which may have diversified in sequence and cellular localization as well as in function (Waters, 1995). About half of the ~200 known virus-resistance genes in plants are recessively inherited, suggesting that this form of resistance is more common for viruses than for other plant pathogens. The use of such genes is therefore a very important tool in breeding programs to control plant diseases caused by pathogenic viruses (Truniger and Aranda, 2009).

More extensive characterization of the natural variability of resistance genes may identify new host factors conferring recessive resistance (Truniger and Aranda, 2009). Identification of these stress-regulated transcripts is an initial step towards cloning and characterization of full-length cDNAs and promoter regions. Such studies should identify common and/or unique regulatory elements, and thus provide insight into the mechanism of a gene’s individual expression, as well as its potential role in stress response. Our aim is to proceed with the cellular localization, further revelations of the stress tolerance mechanisms at transcriptional level, and transformation of GhLCVR in cotton. In turn, this information will help us to better comprehend signaling and interactions between the major pathways of disease stress response. Acknowledgment The authors gratefully acknowledge grants from the Higher Education Commission (HEC), Government of Pakistan.

References Akhtar KP, Haq MA, Hussain M, Khan AI (2002a). Whitefly transmitted Gemini virus and associated disorder in cotton: a review. Pak J Phytopath 14: 140–150. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990). Basic local alignment search tool. J Mol Biol 215: 403–410. Amrao L, Akhter S, Tahir MN, Amin I, Briddon RW, Mansoor S (2010a). Cotton leaf curl disease in Sindh Province of Pakistan is associated with recombinant begomovirus components. Virus Res 153: 161–165. Amrao L, Amin I, Shahid MS, Briddon RW, Mansoor S (2010b). Cotton leaf curl disease in resistant cotton is associated with a single begomovirus that lacks an intact transcriptional activator protein. Virus Res 152: 153–163. Beck EH, Fettig S, Knake C, Hartig K, Bhattarai T (2007). Specific and unspecific responses of plants to cold and drought stress. J Bioscience 32: 501–510. Bimboim HC, Doly J (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7: 1513–1523. Bivalkar-Mehla S, Vakharia J, Mehla R, Abreha M, Kanwar JR, Tikoo A, Chauhan A (2011). Viral RNA silencing suppressors (RSS): novel strategy of viruses to ablate the host RNA interference (RNAi) defense system. Virus Res 155: 1–9. Bonas U, Lahaye T (2002). Plant disease resistance triggered by pathogen-derived molecules: refined models of specific recognition. Curr Opin Microbio 15: 44–50. Brandt P, Unseld M, Eckert-Ossenkopp U, Brennicke A (1993). An rps14 pseudogene is transcribed and edited in Arabidopsis mitochondria. Curr Genet 24: 330–336. Briddon RW (2003). Cotton leaf curl disease, a multicomponent begomovirus complex. Plant Pathol 4: 427–434.

Briddon RW, Markham PG (2000). Cotton leaf curl virus disease. Virus Res 71: 151–159. Cherepneva GN, Schmidt KH, Kulaeva ON, Oelmüller R, Kusnetsov VV (2003). Expression of the ribosomal proteins S14, S16, L13a and L30 is regulated by cytokinin and abscisic acid: Implication of the involvement of phytohormones in translational processes. Plant Sci 165: 925–932. Chitnis PR (1996). Photosystem I. Plant Physiol 111: 661–669. Cushman JC, Bohnert HJ (2000). Genomic approaches to plant stress tolerance. Curr Opin Plant Biol 3: 117–124. de Wit PJ (1992). Molecular characterization of gene-for-gene systems in plant-fungus interactions and the application of avirulence genes in control of plant pathogens. Annu Rev Phytopathol 30: 391–418. Debouck C (1995). Differential display or differential dismay? Curr Opin Biotechno l6: 597–599. Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS (1991). Touchdown PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res 19: 4008. Doyle JJ, Doyle L (1990). A rapid DNA isolation procedure for small quantities of fresh tissue. Phytochem Bull 9: 11–5. Dündar E, Akçiçek E, Dirmenci T, Akgün Ş (2013). Phylogenetic analysis of the genus Stachys sect. Eriostomum (Lamiaceae) in Turkey based on nuclear ribosomal ITS sequences. Turk J Bot 37: 14–23. Fewell SW, Woolford JL Jr (1999). Ribosomal protein S14 of Saccharomyces cerevisiae regulates its expression by binding to RPS14B pre-mRNA and to 18S rRNA. Mol Cell Biol 19: 826–834.

235

AFTAB et al. / Turk J Biol Flieger K, Oelmüller R, Herrmann RG (1993). Isolation and characterization of cDNA clones encoding a 18.8 kDa polypeptide, the product of the gene psaL, associated with photosystem I reaction center from spinach. Plant Mol Biol 22: 703–709. Fromme P, Jordan P, Krauss N (2001). Structure of photosystem I. Biochim Biophys Acta 1507: 5–31. Golbeck JH (1994). In: Bryant DA, editor. The Molecular Biology of Cyanobacteria. Advances in Photosynthesis, Vol. 1 Dordrecht: Kluwer Academic Publishers, pp. 319–360. Hammond-Kosack KE, Jones JDG (1997). Plant disease resistance genes. Annu Rev Plant Phys 48: 575–607. Higuchi R, Fockler C, Dollinger G, Watson R (1993). Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Nature Biotechnol 11: 1026–1030. Ilyas M, Amin I, Mansoor S, Briddon RW, Saeed M (2010). Challenges for transgenic resistance to control geminivirus diseases. In: Sharma P, Gaur RK, Ikegami M, eds. Emerging Geminiviral Diseases and Their Management. New York: Nova Science Publishers, pp. 1–35. Ikeuchi M, Inoue Y (1991). Two new components of 9 and 14 kDa from spinach photosystem I complex. FEBS Lett 280: 332–334. Jaakola L, Pirttilä AM, Halonen M, Hohtola A (2001). Isolation of high quality RNA from bilberry (Vaccinium myrtillus L.) fruit. Mol Biotechnol 19: 201–203. Jain AK, Basha SM, Holbrook CC (2001). Identification of droughtresponsive transcripts in peanut (Arachis hypogaea L.). Electron J Biotechn 4: 3–4. Jensen PE, Bassi R, Boekema EJ, Dekker JP, Jansson S, Leister D, Robinson C, Scheller HV (2007). Structure, function and regulation of plant photosystem I. Biochim Biophys Acta 1767: 335–352. Kauter G (2007). Cotton Leaf Curl Virus Study Tour. Narrabri, NSW, Australia: Australian Cotton Growers Research Association Inc. Keen NT (1990). Gene-for-gene complementarity in plant–pathogen interactions. Annu Rev Genet 24: 447–463. Keen NT (1992). The molecular biology of disease resistance. Plant Mol Biol 19: 109–122. Kettler GC, Martiny AC, Huang K, Zucker J, Coleman ML, Rodrigue S, Chen F, Lapidus A, Ferriera S, Johnson J et al. (2007). Patterns and implications of gene gain and loss in the evolution of Prochlorococcus. PLoS Genetics 3. Khan MA, Shahid AA, Rao AQ, Kiani S, Ashraf MA, Muzaffar A, Husnain T (2011). Role of epicuticular waxes in the susceptibility of cotton leaf curl virus (CLCuV). Afri J Biotech 10: 17868–17874. Kubo N, Harada K, Hirai A, Kadowaki K (1999). A single nuclear transcript encoding mitochondrial RPS14 and SDHB of rice is processed by alternative splicing: common use of the same mitochondrial targeting signal for different proteins. P Natl Acad Sci USA 96: 9207–9211.

236

Larkin JC, Hunsperger JP, Culley D, Rubenstein I, Silflow CD (1989). The organization and expression of a maize ribosomal protein gene family. Gene Dev 3: 500–509. Lebrun-Garcia A, Bourque S, Binet MN, Ouaked F, Wendehenne D, Chiltz A, Schäffner A, Pugin A (1999). Involvement of plasma membrane proteins in plant defense responses: analysis of the cryptogein signal transduction in tobacco. Biochimie 81: 663–668. Li Z, Hansen JL, Liu Y, Zemetra RS, Berger PH (2004). Using realtime PCR to determine transgene copy number in wheat. Plant Mol Biol Rep 22: 179–188. Liang P, Pardee AB (1992). Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: 967–971. Lievens S, Goormachtig S, Holsters M (2001). A critical evaluation of differential display as a tool to identify genes involved in legume nodulation: looking back and looking forward. Nucleic Acids Res 29: 3459–3468. Liu M, Shi J, Lu C (2013). Identification of stress-responsive genes in Ammopiptanthus mongolicus using ESTs generated from cold- and drought-stressed seedlings. BMC Plant Biol 13: 1–14. Lubec G, Afjehi-Sadat L, Yang JW, John JPP (2005). Searching for hypothetical proteins: theory and practice based upon original data and literature. Prog Neurobiol 77: 90–127. Mahmood T, Tahir M, Mahmood HT, Hussain MS, Khan SM, Javed N (2002). Testing for cotton leaf curl virus resistance in candidate varieties/strains through different techniques. In: Integrated plant disease management. Proceedings of the 3rd National Conference of Plant Pathology, Pakistan Phytopathology Society, pp. 106–109. Mansoor S, Amin I, Iram S, Hussain M, Zafar Y, Malik KA, Briddon RW (2003). Breakdown of resistance in cotton to cotton leaf curl disease in Pakistan. Plant Pathology J 52: 784–784. Mason HS, Guerrero FD, Boyer JS, Mullet JE (1988). Proteins homologous to leaf glycoproteins are abundant in stems of dark-grown soybean seedlings. Analysis of proteins and cDNAs. Plant Mol Biol 11: 845–856. Minion FC, Lefkowitz EJ, Madsen ML, Cleary BJ, Swartzell SM, Mahairas GG (2004). The genome sequence of Mycoplasma hyopneumoniae Strain 232, the agent of swine mycoplasmosis. J Bacteriol 186: 7123–7133. Perveen R, Khan SM, Khan MA (2004). Reactions of cotton germplasm to cotton leaf curl Begomovirus (CLCuV) disease. Pak J Phytopathol 16: 90–94. Perveen R, Sultan MK, Khan MA, Noor-ul-Islam (2005). Screening of cotton germplasm against cotton leaf curl Begomovirus (CLCuV). J Agri Social Sci 1: 235–238. Saitou N, Nei M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425. Sattar MN, Kvarnheden A, Saeed M, Briddon RW (2013). Cotton leaf curl disease – an emerging threat to cotton production worldwide. J Gen Vir 94: 695–710.

AFTAB et al. / Turk J Biol Scheller HV, Jensen PE, Haldrup A, Lunde C, Knoetzel J (2001). Role of subunits in eukaryotic photosystem I. Biochim Biophysica Acta 1507: 41–60. Shahid MN, Jamal A, Rashid B, Aftab B, Husnain T (2012). Identification and isolation of salt-stress−responsive transcripts from Gossypium arboreum L. Turk J Biol 36: 746–756.

Truniger V, Aranda MA (2009). Recessive resistance to plant viruses. Adv Virus Res 75: 119–159. Voelckel C, Baldwin IT (2003). Detecting herbivore-specific transcriptional responses in plants with multiple DDRT-PCR and subtractive library procedures. Physiol Plantarum 118: 240–252.

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739.

Warner JR, McIntosh KB (2009). How common are extra-ribosomal functions of ribosomal proteins? Mol Cell 34: 3–11.

Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680.

Weisberg RA (2008). Transcription by moonlight: structural basis of an extraribosomal activity of ribosomal protein S10. Mol Cell 32: 747–748.

Waters ER (1995). The molecular evolution of the small heat-shock proteins in plants. Genetics 141: 785–795.

237