Identification and functional characterization of novel ...

http://informahealthcare.com/xen ISSN: 0049-8254 (print), 1366-5928 (electronic) Xenobiotica, Early Online: 1–8 ! 2014 Informa UK Ltd. DOI: 10.3109/00498254.2014.998322

RESEARCH ARTICLE

Identification and functional characterization of novel feline cytochrome P450 2A Gaku Okamatsu1, Tetsuya Komatsu1, Akira Kubota2 Takenori Onaga1, Tsuyoshi Uchide1, Daiji Endo1, Rikio Kirisawa1, Guojun Yin1,3, Hiroki Inoue1, Takio Kitazawa1, Yasuhiro Uno4, and Hiroki Teraoka1

Xenobiotica Downloaded from informahealthcare.com by The College of Dairy on 12/30/14 For personal use only.

1

School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu, Hokkaido, Japan, 2Diagnostic Center for Animal Health and Food Safety, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Hokkaido, Japan, 3Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi, China, and 4Pharmacokinetics and Bioanalysis Center, Shin Nippon Biomedical Laboratories, Ltd., Kainan, Wakayama, Japan Abstract

Keywords

1. Cytochrome P450s are the major metabolizing enzymes for xenobiotics in humans and other mammals. Although the domestic cat Felis catus, an obligate carnivore, is the most common companion animal, the properties of cytochrome P450 subfamilies are largely unknown. 2. We newly identified the feline CYP2A13, which consists of 494 deduced amino acids, showing the highest identity to CYP2As of dogs, followed by those of pigs, cattle and humans. 3. The feline CYP2A13 transcript and protein were expressed almost exclusively in the liver without particular sex-dependent differences. 4. The feline CYP2A13 protein heterogeneously expressed in Escherichia coli showed metabolic activity similar to those of human and canine CYP2As for coumarin, 7-ethoxycoumarin and nicotine. 5. The results indicate the importance of CYP2A13 in systemic metabolism of xenobiotics in cats.

Carnivore, cytochrome P450, domestic cats, drug metabolism

Introduction Cytochrome P450 monooxygenase (CYP) is the most important enzyme for the metabolism of xenobiotics to polar substances for excretion and to active intermediates causing toxicological responses in some cases. Among the numerous members of the CYP superfamily, CYP1A, 2A, 2B, 2C, 2D, 2E, and 3A subfamilies are particularly important for xenobiotic metabolism. The CYP2A subfamily includes CYP2A6, CYP2A7 and CYP2A13 in humans and CYP2A13 and CYP2A25 in dogs. Human CYP2A6 accounts for about 4% of total hepatic CYPs that are involved in the metabolism of toxic xenobiotics, such as coumarin, nicotine, aflatoxin B1 and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, as well as medicines, such as cyclophosphamide (Guengerich, 1997; Honkakoski & Negishi, 1997). Human CYP2A13 is predominantly expressed in the respiratory tract and significantly involved in nicotine metabolism (von Weymarn et al., 2006) and in the activation of aflatoxin B1 to carcinogenic derivatives (He et al., 2006). The domestic cat Felis catus is the most common companion animal and obligate carnivore. Cats depend on a

Address for correspondence: Prof. Hiroki Teraoka, School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu, Hokkaido 069-8501, Japan. E-mail: [email protected]

History Received 8 November 2014 Revised 8 December 2014 Accepted 10 December 2014 Published online 30 December 2014

supply of at least some animal-derived materials in their diet, while dogs have relatively developed adapted digestive system for carbon hydrates (Legrand-Defretin, 1994). Unlike in dogs, knowledge of CYPs involved in the biotransformation of drugs and other xenobiotics in cats is limited. It is well known that cats are very sensitive to a variety of chemicals partly because of their deficiency of glucuronidation (Court & Greenblatt, 2000). Using liver microsomes, feline CYP1A and CYP2E were studied with typical human CYP substrates to compare their metabolic activities with those of other mammals (Chauret et al., 1997; Pearce et al., 1992). Additionally, CYP1A-, 2C-, 2D- and 3A-dependent enzymatic activities of domestic cats have been characterized (Shah et al., 2007). Enzymatic activities of the six CYP families except CYP2A in cats were compared with those of dogs with fluorescent substrates specific for each human CYP subfamily (van Beusekom et al., 2010). Molecular characterization of CYP1A1, CYP1A2 (Tanaka et al., 2006), CYP2D6 (Komatsu et al., 2010), CYP2Ea, b, c (Tanaka et al., 2005), CYP3A131 and CYP3A132 (Honda et al., 2011) in domestic cats have been conducted, as well as some enzymatic properties of CYP1As and CYP2Es, as the first studies in the whole felids. In the present study, we determined the complete cDNA sequence and deduced amino acids of feline CYP2A13 and its expression patterns in various tissues in domestic cats.

2

G. Okamatsu et al.

We also produced recombinant CYP2A13, which was heterogeneously expressed in Escherichia coli, to characterize the fundamental properties of feline CYP2A13.

Materials and methods


Chemicals 7-Benzyloxy-4-trifluoromethylcoumarin (BFC), 7-ethoxy-4(trifluoromethyl)coumarin (EFC), 7-hydroxy-4-(trifluoromethyl) coumarin (HFC) and 7-methoxy-4-(trifluoromethyl) coumarin (MFC) were from BD Gentest (Woburn, MA). 7-Ethoxyresorufin (ER), 7-methoxyresorufin (MR) and 7-pentoxyresorufina (PR) were from Molecular Probes Europe BV (Leiden, The Netherlands). Cotinine, coumarin, 7-hydroxycoumarin and resorufin were from Sigma-Aldrich (St. Louis, MO). 7-Benzoxyresorufin (BR) was from Roche (Mannheim, Germany). Nicotine and nicotinamide adenine dinucleotide phosphate (NADPH) were from Tokyo Kasei (Tokyo, Japan). All other reagents used were of analytical grade. Samples Mongrel cats of both sexes (short-haired type; 5 males and 6 females), originally bred at laboratory animal facilities of Sapporo Medical University, received humane care under the guidelines of Sapporo Medical University for laboratory animals and the experimental protocol was approved by the Committee for Animal Experiments at Rakuno Gakuen University. The cats were allowed to take food and drinking water ad libitum and were maintained at 25 ± 1 C under a standard 12-h light–dark cycle. Fresh tissues were removed from cats anesthetized by intravenous administration of pentobarbital sodium (50 mg/kg body weight). Cloning of CYP2A Total RNA was extracted from the liver, small intestine (middle part), lung and kidney (cortex) of domestic cats using a conventional acid guanidine–phenol–chloroform method (Trizol; Invitrogen, Carlsbad, CA) (Komatsu et al., 2010). cDNA was synthesized from total RNA using oligo dT primer and reverse transcriptase (QuantiTecht, Qiagen, Hilden, Germany). The feline CYP2A fragments were amplified by reverse transcription-polymerase chain reaction (RT-PCR) with degenerate primers, using high-fidelity Phusion Hot Start polymerase (Finnzymes, Espoo, Finland), and 30 - or 50 rapid amplification of cDNA ends (30 - and 50 -RACE). Degenerate oligonucleotide primers used for PCR were based on the nucleotide sequences of CYP2A from several mammalian species (forward 50 –ATCTGCTCYATYGTSTT TGG–30 : reverse 50 –TCTCTGAATCTCRYRGATGA–30 ). 30 -RACE and 50 -RACE were conducted according to the manufacturer’s instructions (30 -Full RACE and 50 -Full RACE Core Set; Takara, Otsu, Japan). PCR products were subcloned into T-vectors (BioDynamics, Tokyo, Japan). The nucleotide sequences of these clones were determined using an automated DNA sequencer (ABI 310 Genetic Analyzer; Applied Biosystems, Foster City, CA) after reactions using a BigDye terminator cycle sequencing kit (Applied Biosystems). Sequences were determined from two different female cat

Xenobiotica, Early Online: 1–8

livers. Sequence alignment and phylogenetic analysis were carried out using Clustal W software (neighbor-joining method, Kimura’s 2-parameter model) at the DNA Data Bank of Japan (DDBJ) homepage. Quantitative real-time RT-PCR Quantitative real-time RT-PCR (qRT-PCR) analysis was performed with a real-time PCR detector (Chromo4; BioRad, Hercules, CA) using SYBR Green-based kit (Thunderbird qPCR Mix, Toyobo, Osaka, Japan) as described previously (Komatsu et al., 2010). Tissues from 5 males and 6 females were used. Forward and reverse primer pairs used for CYP2A quantification were 50 -CTGAACACACAGCAAATG TACAAC-30 and 50 - TCCTGGCAGGTATTTCATCACG-30 , respectively. The concentration of the PCR product was quantified with a microchip electrophoresis system (MultiNA, Shimadzu, Kyoto, Japan). The primer sets used for qRT-PCR were confirmed to produce a single peak in the melting curve as well as a single band by agarose gel electrophoresis. The expression levels of CYP2A were normalized per mg of total RNA used for reverse transcription. Heterogeneous expression in Escherichia coli Protein expression of complete feline CYP2A was carried out according to Pritchard et al. (2006). To enhance functional protein expression in E. coli, bacterial OmpA leader sequences were fused to the 50 -end of the complete coding region of feline CYP2A by PCR with cDNA from the liver and the primers (ompA(+2)-forward GGAATTCCATATG AAAAAGACAGCTATCGCG and OmpA(+2)-CYP2A linker AAGGAGCCCTGCTGCCAGCATCGGAGCGGCCTGCGC TACGGTAGCGA) (first-round PCR). The PCR product was electrophoresed and purified with an agarose gel extraction kit (Wizard SV Gel and PCR-Clean-Up System, Fitchburg, Madison, WI). The purified PCR product was used as a forward primer for the second-round PCR with cDNA and the feline CYP2A 30 -end-specific reverse primer as a reverse primer (TCTAGATCAGCGGGGCTGGAAGCTCATG). The PCR products were digested with Nde I and Xba I and cloned into the pCWOri+ vector (Barnes, 1996), in which human reductase cDNA has already been accommodated (Iwata et al., 1998), using a DNA Ligation Kit (Mighty Mix, Takara). The resultant construct was used to transform DH5a competent cells (Frontier Science, Ishikari, Japan). The OmpA leader sequence was removed by an endogenous enzyme in E. coli. Protein expression using the generated expression plasmids and membrane preparations was performed as described previously (Iwata et al., 1998; Uno et al., 2006). The CYP2A protein content in membrane preparations was determined as described previously by Omura & Sato (1964). Enzyme activity assay Metabolic activity of feline recombinant CYP2A with coumarin was determined spectrofluorometrically according to Waxman & Chang (2006). In brief, recombinant feline CYP2A (2–8 pmol/100 mL) was incubated with coumarin (0–6 mM as a final concentration) or 7-ethoxycoumarin (0–80 mM) at 37 C for 15 min in 100 mM potassium phosphate buffer (pH 7.4) after 5-min preincubation. The

Characterization of feline CYP2A


DOI: 10.3109/00498254.2014.998322

reaction was started by an addition of 2 mL NADPH (1 mM as a final concentration) and stopped by adding 12.5 mL of icecold 2 N HCl. Resultant 7-hydroxycoumarin (7-HC) was extracted with 1 mL of 30 mM sodium borate (pH 9.2) after vigorous mixing with chloroform. Fluorescence of 7-HC (excitation 370 nm and emission 450 nm) was measured with a fluorescence spectrophotometer (650-10S, Hitachi, Tokyo, Japan). The same reaction conditions were used for determination of the metabolism of BFC, EFC and MFC. Fluorescence of HFC converted (420 nm for excitation and 535 nm for emission) was determined in a reaction buffer without extraction after the reaction had been stopped by an addition of 900 mL ice-cold potassium buffer. Cotinine, a metabolite of nicotine, was determined by HPLC connected to a UV spectrophotometer, according to Rabbaa-Khabbaz et al. (2006). Metabolic reaction was carried out by incubation of recombinant feline CYP2A and nicotine in potassium phosphate buffer containing NADPH in the same conditions as those described for coumarin. The reaction was stopped by an addition of the same volume of ice-cold acetone and centrifugation at 4 C (10 000 g for 5 min). After an addition of 1 mL isopropanol/dichloromethan (1:2) to the supernatant followed by 5-min vigorous mixing and 3-min centrifugation, the organic solvent layer was taken and evaporated by a stream of nitrogen gas at 40 C. The resultant pellet was resupended in the mobile phase for HPLC for determination (10 mM phosphate buffer/acetonitrile (9:1), pH 6.8). The flow rate was 1 mL/min, and the wavelength of the spectrophotometer was fixed at 254 nm. Alkoxyresorufin-O-dealkylase activity was determined according to Kubota et al. (2005). A total of 2 mM alkoxyresorufins (benzyloxyresorufin, ethoxyresorufin, methoxyresorufin, and pentoxyresorufin) were incubated with recombinant feline CYP2A (2–8 pmol/100 mL) in potassium phosphate buffer (pH 7.4) at 37 C. Resorufin formed by the reaction was measured by an excitation wavelength of 535 nm and emission wavelength 595 nm. Reactions were initiated by adding NADPH (final concentration of 1 mM) after 5-min preincubation at 37 C.

3

was determined by the one-way ANOVA followed by the Tukey–Kramer test (p50.05). Kinetic parameters, Michaelis constants (Km) and maximal velocities (Vmax) were determined with non-linear regression analysis by fitting a hyperbola directly to the substrate-velocity data using GraphPad Prism 5.0 (GraphPad Software, San Diego, CA).

Results Isolation and sequence analysis of feline CYP2A Using degenerate RT-PCR, we succeeded in obtaining a cDNA of feline CYP2A with a transcription initiation codon and stop codon. The open reading frame of the feline CYP2A was 1482 bp and the deduced amino acid sequence was 494. The sequence of the HR2 region around the heme-binding cysteine at position 439 was recognized (underlined, Figure 1). Six putative substrate recognition sites (SRS1-6) (boxed) were well conserved for human, canine and feline CYP2A homologues, including three amino acid residues in SRS2 and SRS4 that are important for the coumarin binding site (F in SRS2, N and T in SRS4) (Figure 1) (Skaanild & Friis, 2005). The 14 critical key residues in enzymatic activity of human and canine CYP2As were also conserved in feline CYP2A (Zhou et al., 2010). A search was made in human, dog and cat genome data for a sequence homologous to CYP2A identified above by a BLAT search (UCSC Genome Bioinformatics). The CYP2A we found was probably the dog CYP2A13 orthologue as recommended by P450 Nomenclature Committee (Nelson, 2009). Feline CYP2A13 retained the highest amino acid sequence identity with canine CYP2A13 (94%), while it showed relatively lower identity to human CYP2A6, 2A7 and 2A13 (85–89%) (Table 1). Apart from these species, CYP2A19 of cattle and pigs, showed relatively high identity (90 and 91%) to feline CYP2A13. In accordance with this, phylogenetic analysis demonstrated that the feline CYP2A13 is in a monophyletic group with dog CYP2As and far from rodent CYP2As but nearer to CYP2As of ungulates including pigs, cattle and horses (Figure 2).

Immunoblotting Feline CYP2A protein (recombinant) (0.8 pmol) and liver microsomes (30 mg) were run on 10% SDS polyacrylamide gels and transferred to cellulose nitrate membrane filters (pore size of 0.45 mm) (Advantec, Tokyo, Japan). The filters were immunoblotted with goat anti-human CYP2A6 C-terminal fragment (C-20) polyclonal antibody (Santa Cruz, Dallas, TX) (1:500) or rabbit anti-human CYP2A6 polyclonal antibody (Bioss Antibodies, Woburn, MA) (1:100), followed by incubation with biotinylated rabbit anti-goat IgG antibody or biotinylated goat anti-rabbit IgG antibody, respectively (Vectastatin ABC-AP KIT, Vector Labs, Burlingame, CA). After avidin-biotin reaction, a specific band was visualized using a DCIP/NBT substrate kit (Vector Labs) (Onaga et al., 2000). Statistical methods Results are presented as means ± SEM of at least four experiments. Significance of differences between test groups

Tissue expression of CYP2A13 transcripts We studied mRNA expression of feline CYP2A13 in the liver, small intestine (middle part of the jejunum), lung and kidney by qRT-PCR (Table 2). It was found that CYP2A13 was predominantly expressed in the liver. Much lower expression levels were found in the kidney and lung. Expression in the small intestine was negligible. There was no clear preferential expression of CYP2A13 by sex, yet large individual differences in CYP2A13 expression were found in the 11 cats. CYP2A13 expression was negligible in the heart, colon and rectum in another set of measurements (n ¼ 7–11). Metabolic activity of CYP2A13 Feline CYP2A13 was successfully expressed in E. coli. The reduced-CO difference spectrum with recombinant feline CYP2A13 showed a clear absorption peak at around 450 nm (Figure 3). Recombinant feline CYP2A13 exhibited 7hydroxylase activity of coumarin, which is a typical substrate


4

G. Okamatsu et al.


Figure 1. Comparison of amino acids of CYP2A homologues of humans, dogs and cats. Amino acid sequences are shown for humans (CYP2A6, 2A13), dogs (CYP2A13, 2A25) and cats (CYP2A13). Asterisks show conserved residues of five CYP2As. Putative heme-binding region and substrates recognition sites (SRSs) are indicated by an underline and overlines, respectively. Heme-binding cysteine and the 14 critical key residues in enzymatic activity of human and canine CYP2As are marked with plus (+) and black dots (), respectively.

Table 1. Percent identities of feline CYP2A13 to other CYP2A genes at the level of cDNA and amino acid sequences. Feline CYP2A13 Common name

Species name

Gene

Accession No.

Cat Human

Felis catus Homo sapiens

Rhesus monkey

Macaca mulatta

Cynomolgus monkey

Macaca fasicularis

Dog

Canis familiaris

Cattle Horse Pig Rabbit

Bos taurus Equus caballus Sus scrofa Oryctolagus cuniculus

Golden hamster

Mesocricetus auratus

Chinese hamster

Cricetulus griseus

Rat

Rattus norvegicus

Mouse

Mus musculus

CYP2A13 CYP2A6 CYP2A7 CYP2A13 CYP2A23 CYP2A24 CYP2A23 CYP2A24 CYP2A13 CYP2A25 CYP2A19 CYP2A13 CYP2A19 CYP2A10 CYP2A11 CYP2A8 CYP2A9 CYP2A14 CYP2A15 CYP2A17 CYP2A1 CYP2A2 CYP2A3 CYP2A4 CYP2A5 CYP2A12 CYP2A22

AB986555 NM_000762 NM_000764 AF209774 NM_001040216 NM_001040215 DQ074790 DQ074792 NM_001037345 NM_001048027 XM_612739 NM_001111337 AB052255 L10236 L10237 M63788 D86953 D86954 BAA83589 AB035867 NM_012692 J04187 NM_012542 J03549 X89864 L06463 NM_001101467

All Accesion No. are designated from GenBank, except feline CYP2A6 that is from DDBJ.

cDNA – 88 87 90 88 88 88 88 92 90 88 88 89 86 86 80 78 82 79 82 76 74 85 83 84 76 76

Amino acids – 87 85 89 87 87 88 87 94 90 90 87 91 86 86 72 69 80 71 81 70 65 87 85 86 70 70


DOI: 10.3109/00498254.2014.998322

Figure 2. Phylogenetic tree of CYP2As. The neighbor-joining method was used, based on the entire deduced amino acid sequences. The gene number is given with each species name. Feline CYP2A13 is highlighted in bold letters. Bar with the number (0.1) indicates genetic distance. Rhe.; Rhesus monkey, Maca.; Cynomolgus monkey, C-hamster; Chinese hamster, G-hamster; Golden hamster.

5

C-hamster 17 C-hamster 14 Mouse 4 Rat 3

Mouse 22 Mouse 12

Human 7 Human 6

Mouse 5 Human 13

Rhe. 24 Maca. 24 Rhe. 23 Maca. 23

Rat 2

Cat 13 Dog 13 Dog 25

Rat 1 Pig 19

Cattle 19

Rabbit 11 Rabbit Horse 13 10


C-hamster 15

G-hamster 9 0.1 G-hamster 8

Table 2. Expression profile of CYP2A13 transcripts in some feline tissues.

Male Female All

Lung

Liver

Small intestine

Kidney

25.80 ± 5.03 (5) 8.56 ± 3.66 (6) 16.40 ± 3.94 (11)

20332.57 ± 3042.97 (5) 23903.75 ± 4132.41 (6) 22280.49 ± 2469.53 (11)

1.44 ± 0.59 (4) 11.39 ± 4.28 (6) 7.41 ± 2.94 (10)

75.07 ± 46.79 (5) 48.65 ± 21.88 (6) 63.06 ± 25.63 (11)

The expression levels of CYP2A13 in some feline tissues were determined by qRT-PCR. The tissues addressed were lung, liver, small intestine and kidney cortex. Middle portion was studied in small intestine. Expression levels are expressed as means ± SEM per ng of total RNA used for reverse transcription (copies/ng total RNA). Sample numbers are indicated in parenthesis for each sex (male, female) and the total (all).

for CYP2A6 in humans (Figure 4A). The reaction was saturable with 19.50 ± 1.12 pmol/min/pmol CYP (Vmax), and the Km value was estimated to be 1.33 ± 0.22 mM (Table 3). Extensive O-deethylase activity of 7-ethoxycoumarin was also confirmed in feline CYP2A13 (Figure 4B). The apparent Km and Vmax values were 6.77 ± 2.04 mM and 217.30 ± 18.25 pmol/min/pmol CYP, respectively. Feline CYP2A13 catalysed hydroxylation of nicotine to cotinine, though the Km value was higher than that of other substrates (Km: 48.16 ± 13.72 mM) (Figure 4C). Feline CYP2A13 also exhibited significant ethoxyresorufin-O-deethylase (EROD) activity (Km: 1.60 ± 0.48 mM, Vmax: 0.30 ± 0.03 pmol/min/ pmol CYP) (Figure 4D, Table 3). Substantial metabolism by feline CYP2A13 was not confirmed for other resorufin derivatives, benzyloxyresorufin (BR), methoxyresorufin (MR) and pentoxyresorufin (PR), at 10 mM as well as some coumarin derivatives including BFC, EFC and MFC at 100 mM (Table 3).

0.02

400

420

440

460

480

500 nm

Figure 3. CO difference spectra for recombinant feline CYP2A13. Vertical line indicates absorbance size of 0.02.

KLM-conjugated CYP2A6 polyclonal antibody (not shown). A positive band of CYP2A was confirmed in the liver but not in the lung, kidney and small intestine from both sexes (Figure 5 and data not shown).

Discussion Tissue expression of CYP2A protein The recombinant feline CYP2A13 (about 50 kDa) was detected by immunoblotting with each of anti-human CYP2A6 polyclonal antibody (Figure 5) and anti-human

In the present study, we showed that feline CYP2A13 was predominantly expressed in the feline liver. This was supported by results of our immunoblotting study with two different anti-CYP2A6 antibodies. Immunoreactivity in the

6

G. Okamatsu et al.


(B) Activity (pmol/min/pmol CYP)

Activity (pmol/min/pmol CYP)

(A)

Coumarin (µM)

7-Ethoxycoumarin (µM)


(D)



(C)

Nicotine (µM)

7-Ethoxyresorufin (µM)

Figure 4. Enzymatic activities of recombinant feline CYP2A13 protein. Saturation curves for coumarin (A), 7-ethoxycoumarin (B), nicotine (C) and 7-ethoxyresorufin (D) are indicated. N ¼ 3.

Table 3. Experimental conditions and kinetic characteristics of feline CYP2A13 metabolism.

Substrate BR ER MR PR BFC EFC MFC Coumarin 7-Ethoxycoumarin Nicotine

Incubation time (min)

Km (mM)

Vmax (pmol/pmol CYP/min)

CLint (mL/pmol CYP/min)

8 8 8 8 10 10 10 15 15 30

– 1.60 ± 0.48 – – – – – 1.33 ± 0.22 6.77 ± 2.04 48.16 ± 13.72

– 0.30 ± 0.03 – – – – – 19.50 ± 1.12 217.30 ± 18.25 34.20 ± 2.69

– 0.19 – – – – – 14.66 32.10 0.710

7-Benzyloxyresorufin (BR), 7-ethoxyresorufin (ER), 7-methoxyresorufin (MR), 7-pentoxyresorufin (PR), 7-benzyloxy-4-trifluoromethylcoumarin (BFC), 7-ethoxy-4-trifluoro-memethylcoumarin (EFC), 7-methoxy-4-(trifluoromethyl)coumarin (MFC), coumarin, 7-ethoxycoumarin, and nicotine were used as substrates. (–) indicates no significant metabolic activity when 100 mM substrates were used except resorufin derivatives (10 mM). N ¼ 3.

feline liver microsomes has been confirmed by anti-rat CYP2A1 antibody in comparison with eight other species (Pearce et al., 1992). It has been reported that rat CYP2A1 (female dominant) and CYP2A2 (male dominant) are expressed in the liver (2%), while CYP2A3 is expressed in some tissues including the lung but not in the liver. Among four CYP2As, mouse CYP2A5 is mainly expressed in liver and lung (Martignoni et al., 2006). In humans, CYP2A6 is predominantly expressed in the liver, while CYP2A13 is expressed in the respiratory tract but not in the liver (von Weymarn et al., 2006). On the other hand, in the cynomolgus

monkey, three CYP2A homologues, 2A23, 24 and 26, are expressed in the liver but not in 10 other tissues including lung (Uehara et al., 2010). CYP2A is the second most abundant P450 subfamily in the cynomolgus monkey liver, representing 25% of total immunoquantified P450 content (Uehara et al., 2011), whereas CYP2A6 accounts for about 4% of total hepatic P450 in the human liver. The detailed tissue expression pattern of CYP2A is not available for the other animal species at the present time. CYP2A19 is the most abundant enzyme, accounting for 34% of total identified drug-metabolizing CYPs in the pig liver (Achour et al., 2011).


DOI: 10.3109/00498254.2014.998322


Figure 5. Immunoblot analysis of recombinant CYP2A proteins heterogeneously expressed in E. coli and microsomes from the liver and lung of cats. Recombinant CYP2A13 protein (Recomb. CYP2A13, 0.8 pmols) and microsomes from the liver and lung for both sexes (30 mg) were loaded to each lane.

Both canine CYP2A13 and CYP2A25 are present predominantly in the liver (Martignoni et al., 2006), although the abundance of CYP2As in all P450s in the canine liver is not known. Information on mRNA expression is not available, but it is known that canine microsomes of the lung catalyse coumarin 7-hydroxylation (Bogaards et al., 2000). According to the present assembly of the cat genome database (ICGSC Felis_catus 6.2/felCat5), another CYP2A subtype (CYP2A25) has two frameshifts in the I-helix; however, the cDNA we identified has a complete reading frame (unpublished data). Although we cannot rule out the possible existence of another CYP2A subtype that did not react with the antibodies we used in this study, the present results suggest that CYP2A is present in the liver but not or scarcely in the lung. Our results also suggest that feline CYP2A13 is a functional xenobiotic-metabolizing enzyme, sharing metabolic characteristics with human, canine and monkey CYP2As. Coumarin 7-hydroxylase activity has been reported in liver microsomes from cats, dogs, horses, humans (Chauret et al., 1997; Pearce et al., 1992) and cynomolgus monkeys (Uehara et al., 2010). The apparent kinetic parameters of feline CYP2A13 were similar to those of human CYP2A6 (Km: 0.6–10.6 mM, Vmax: 1.7–5.6 pmol/min/pmol CYP) (Donato et al., 2004; Han et al., 2012; Tiong et al., 2010). Metabolic properties of feline CYP2A13 were most similar to those of canine CYP2A13 (Km: 2.1 ± 0.3 mM, Vmax: 19.1 ± 1.0 pmol/min/pmol CYP) (Zhou et al., 2010). In 7-ethoxycoumarin deethylation, properties of the feline CYP2A13 were also very similar to canine CYP2A13 (Km: 4.8 ± 2.5 mM, Vmax: 47.0 ± 28.0 pmol/ min/pmol CYP) (Zhou et al., 2010), in contrast to human CYP2A6 and canine CYP2A25, which metabolize 7-ethoxycoumarin only at higher concentrations (Uno et al., 2013; Zhou et al., 2010). Feline CYP2A13 also catalysed hydroxylation of nicotine to cotinine, and the apparent pharmacokinetic parameters were similar to those of human CYP2A6 and CYP2A13, except for a small Vmax value for human CYP2A6 (Bao et al., 2005). Nicotine is also oxidized by CYP2A13 but to only a lesser extent by CYP2A25 in dogs, although Km and Vmax values are not available (Zhou et al., 2010). Ethoxyresorufin-O-deethylase activity mediated by feline CYP2A13 was confirmed in the present study. Ethoxyresorufin is widely used as a specific substrate for CYP1A (Kubota et al., 2005). EROD activity mediated by the other CYP2A has not been reported as far as we know. Although the EROD value in feline CYP2A13 (recombinant) was much higher than that in liver microsomes of cats (about 0.1 mM) (Shah et al., 2007), feline CYP2A13 may partially contribute to EROD activity in feline liver microsomes in some conditions.

7

Feline CYP2A13 retained the highest amino acid sequence identity with canine CYP2A13 (94%). Furthermore, feline CYP2A13 differs only at Leu370 from canine CYP2A13 with Val370 being one of 14 key critical residues in enzymatic activity of human and canine CYP2As (Zhou et al., 2010). Like leucine, valine is a hydrophobic branched chain amino acid, implying that the effect of mutation is relatively low. Feline CYP2A13 contained Arg372, which is a critical amino acid residue for coumarin 7-hydroxylation (He et al., 2006). Both feline CYP2A13 and canine CYP2A13 differ at Ala117 (Val), Ser208 (Ile), Phe300 (Ile), Met365 (Val) from human CYP2A6 of the 14 critical key residues (Zhou et al., 2010). Naturally, further information is required for a comparison of the metabolic activity of feline CYP2A13 with those of CYP2As from other animals, because even a single amino acid mutation is sufficient to alter the substrate specificity of CYP2A (Lindberg & Negishi, 1989). In conclusion, we described the primary structure and expression patterns of CYP2A13 identified in some feline tissues including the liver, and we characterized basic metabolic properties using recombinant protein heterogenously expressed in E. coli. In humans neither CYP2A6 nor CYP2A13 play a major role as CYP3A4 in the systemic clearance of any medical drug, due to their very low abundance in the human liver. Nevertheless, both human CYP2As are involved in the metabolism of many toxic xenobiotics. Since feline CYP2A13 was expressed almost exclusively in the liver, metabolic pathways of many drugs and other xenobiotics should be clarified in the future studies.

Acknowledgements We sincerely thank Dr Isogai and Dr Takahashi for providing animals and Ms Tamura and Ms Taniguchi for technical assistance.

Declaration of interest The authors report no declarations of interest. This study was supported by Grants-in-Aid for Scientific Research (MEXT/JSPS KAKENHI 24580462 (C)).

References Achour B, Barber J, Rostami-Hodjegan A. (2011). Cytochrome P450 Pig liver pie: determination of individual cytochrome P450 isoform contents in microsomes from two pig livers using liquid chromatography in conjunction with mass spectrometry. Drug Metab Dispos 39: 2130–4. Bao Z, He XY, Ding X, et al. (2005). Metabolism of nicotine and cotinine by human cytochrome P450 2A13. Drug Metab Dispos 33: 258–61. Barnes HJ. (1996). Maximizing expression of eukaryotic cytochrome P450s in Escherichia coli. Methods Enzymol 272:3–14. Bogaards JJ, Bertrand M, Jackson P, et al. (2000). Determining the best animal model for human cytochrome P450 activities: a comparison of mouse, rat, rabbit, dog, micropig, monkey and man. Xenobiotica 30: 1131–52. Chauret N, Gauthier A, Martin J, Nicoll-Griffith DA. (1997). In vitro comparison of cytochrome P450-mediated metabolic activities in human, dog, cat, and horse. Drug Metab Dispos 25:1130–6. Court MH, Greenblatt DJ. (2000). Molecular genetic basis for deficient acetaminophen glucuronidation by cats: UGT1A6 is a pseudogene, and evidence for reduced diversity of expressed hepatic UGT1A isoforms. Pharmacogenetics 10:355–69.


8

G. Okamatsu et al.

Donato MT, Jime´nez N, Castell JV, Go´mez-Lecho´n MJ. (2004). Fluorescence-based assays for screening nine cytochrome P450 (P450) activities in intact cells expressing individual human P450 enzymes. Drug Metab Dispos 32:699–706. Guengerich FP. (1997). Comparisons of catalytic selectivity of cytochrome P450 subfamily enzymes from different species. Chem Biol Interact 106:161–82. Han S, Choi S, Chun YJ, et al. (2012). Functional characterization of allelic variants of polymorphic human cytochrome P450 2A6 (CYP2A6*5, *7, *8, *18, *19, and *35). Biol Pharm Bul 35:394–9. He XY, Tang L, Wang SL, et al. (2006). Efficient activation of aflatoxin B1 by cytochrome P450 2A13, an enzyme predominantly expressed in human respiratory tract. Int J Cancer 118:2665–71. Honda K, Komatsu T, Koyama F, et al. (2011). Expression of two novel cytochrome P450 3A131 and 3A132 in liver and small intestine of domestic cats. J Vet Med Sci 73:1489–92. Honkakoski P, Negishi M. (1997). The structure, function, and regulation of cytochrome P450 2A enzymes. Drug Metab Rev 29:977–96. Iwata H, Fujita K, Kushida H, et al. (1998). High catalytic activity of human cytochrome P450 co-expressed with human NADPH-cytochrome P450 reductase in Escherichia coli. Biochem Pharmacol 55: 1315–25. Komatsu T, Honda K, Kubota A, et al. (2010). Molecular cloning and expression of cytochrome P450 2D6 in the livers of domestic cats. J Vet Med Sci 72:1633–6. Kubota A, Iwata H, Tanabe S, et al. (2005). Hepatic CYP1A induction by dioxin-like compounds, and congener-specific metabolism and sequestration in wild common cormorants from Lake Biwa, Japan. Environ Sci Technol 39:3611–19. Legrand-Defretin V. (1994). Differences between cats and dogs: a nutritional view. Proc Nutr Soc 53:15–24. Lindberg RL, Negishi M. (1989). Alteration of mouse cytochrome P450coh substrate specificity by mutation of a single amino-acid residue. Nature 339:632–34. Martignoni M, Groothuis GM, de Kanter R. (2006). Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert Opin Drug Metab Toxicol 2:875–94. Nelson DR. (2009). The cytochrome P450 homepage. Human Genomics 4:59–65. Omura T, Sato R. (1964). The carbon monoxide-binding pigment of liver microsomes. II. Solubilization, purification and properties. J Biol Chem 239:2379–85. Onaga T, Yoshida M, Inoue H, Yokota H. (2000). Regional distribution and plasma concentration of peptide YY in sheep. Peptides 21: 655–67. Pearce R, Greenway D, Parkinson A. (1992). Species differences and interindividual variation in liver microsomal cytochrome P450 2A


enzymes: effects on coumarin, dicumarol, and testosterone oxidation. Arch Biochem Biophys 298:211–25. Pritchard MP, McLaughlin L, Friedberg T. (2006). Establishment of functional human cytochrome P450 monooxygenase systems in Escherichia coli. In: Phillips IR, Elizabeth AS, eds. Methods in molecular biology. New Jersey: Human Press, 19–29. Rabbaa-Khabbaz L, Daoud AR, Karam-Sarkis DA. (2006). Simple, sensitive, and rapid method for the determination of cotinine in urine by high-performance liquid chromatography with UV detection. J Chromatogr Sci 44:535–8. Shah SS, Sanda S, Regmi NL, et al. (2007). Characterization of cytochrome P450-mediated drug metabolism in cats. J Vet Pharmacol Ther 30:422–8. Skaanild MT, Friis C. (2005). Porcine CYP2A polymorphisms and activity. Basic Clin Pharmacol Toxicol 97:115–21. Tanaka N, Miyasho T, Shinkyo R, et al. (2006). cDNA cloning and characterization of feline CYP1A1 and CYP1A2. Life Sci 79: 2463–73. Tanaka N, Shinkyo R, Sakaki T, et al. (2005). Cytochrome P450 2E polymorphism in feline liver. Biochim Biophys Acta 1726: 194–205. Tiong KH, Yiap BC, Tan EL, et al. (2010). Functional characterization of cytochrome P450 2A6 allelic variants CYP2A6*15, CYP2A6*16, CYP2A6*21, and CYP2A6*22. Drug Metab Dispos 38:745–51. Uehara S, Murayama N, Nakanishi Y, et al. (2011). Immunochemical detection of cytochrome P450 enzymes in liver microsomes of 27 cynomolgus monkeys. J Pharmacol Exp Ther 339:654–61. Uehara S, Murayama N, Yamazaki H, Uno Y. (2010). A novel CYP2A26 identified in cynomolgus monkey liver metabolizes coumarin. Xenobiotica 40:621–9. Uno T, Obe Y, Ogura C, et al. (2013). Metabolism of 7-ethoxycoumarin, safrole, flavanone and hydroxyflavanone by cytochrome P450 2A6 variants. Biopharm Drug Dispos 34:87–97. Uno Y, Fujino H, Kito G, et al. (2006). CYP2C76, a novel cytochrome P450 in cynomolgus monkey, is a major CYP2C in liver, metabolizing tolbutamide and testosterone. Mol Pharmacol 70:477–86. van Beusekom, CD, Schipper L, Fink-Gremmels J. (2010). Cytochrome P450-mediated hepatic metabolism of new fluorescent substrates in cats and dogs. J Vet Pharmacol Ther 233:519–27. von Weymarn LB, Retzlaff C, Murphy SE. (2006). Inactivation of CYP2A6 and CYP2A13 during nicotine metabolism. J Pharmacol Exp Ther 316:295–303. Waxman DJ, Chang TK. (2006). Spectrofluorometric analysis of CYP2A6-catalyzed coumarin 7-hydroxylation. Methods Mol Biol 320:91–6. Zhou D, Linnenbach AJ, Liu R, et al. (2010). Expression and characterization of dog cytochrome P450 2A13 and 2A25 in baculovirus-infected insect cells. Drug Metab Dispos 38:1015–18.