Original Article Identification and Mapping of Amplified Fragment Length Polymorphism Markers Linked to Shell Color in Bay Scallop, Argopecten irradians irradians (Lamarck, 1819) Yanjie Qin,1,2 Xiao Liu,1 Haibin Zhang,1 Guofan Zhang,1 Ximing Guo3 1
Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China Graduate School, Chinese Academy of Sciences, Beijing 100039, China Haskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences, Rutgers University, Port Norris, NJ 08349, USA
2 3
Received: 8 June 2006 / Accepted: 10 July 2006 / Published online: 12 December 2006
Abstract
Introduction
Amplified fragment length polymorphisms (AFLP) were used to study the inheritance of shell color in Argopecten irradians. Two scallops, one with orange and the other with white shells, were used as parents to produce four F1 families by selfing and outcrossing. Eighty-eight progeny, 37 orange and 51 white, were randomly selected from one of the families for segregation and mapping analysis with AFLP and microsatellite markers. Twenty-five AFLP primer pairs were screened, yielding 1138 fragments, among which 148 (13.0%) were polymorphic in two parents and segregated in progeny. Six AFLP markers showed significant (P G 0.05) association with shell color. All six loci were mapped to one linkage group. One of the markers, F1f335, is completely linked to the gene for orange shell, which we designated as Orange1, without any recombination in the progeny we sampled. The marker was amplified in the orange parent and all orange progeny, but absent in the white parent and all the white progeny. The close linkage between F1f335 and Orange1 was validated using bulk segregation analysis in two natural populations, and all our data indicate that F1f335 is specific for the shell color gene, Orange1. The genomic mapping of a shell color gene in bay scallop improves our understanding of shell color inheritance and may contribute to the breeding of molluscs with desired shell colors.
Most color traits in animals are inherited in relatively simple fashions (Legates and Warwick, 1990). Examples of qualitatively inherited color traits in aquaculture species include red/white flesh color in chinook salmon (Wither, 1986), complex red/white color patterns in koi carp (Gomelsky et al., 1996), and pigmentation in rainbow trout (Thorgaard et al., 1995). Shell color in molluscs is highly variable. Shell color may be controlled or influenced by environmental factors in Turbo cornutus Lightfoot (Ino, 1949), Haliotis rufescens Swainsom (Leighton, 1961), Austrocochlea constricta Lamarck (Creese and Underwood, 1976), and Donax denticulatis Linne´ (Wade, 1968). Mitton (1977) has suggested that variation in shell color is adaptive. However, data from experimental crosses indicate that shell color has a genetic base (David and Leslie, 1977; Kraeuter et al., 1984; Adamkewicz and Castagna, 1988). In some species, shell color is determined by one or a small number of genes (Timothy, 1975; Hoagland, 1977; Palmer, 1985; Elek and Adamkewicz, 1990). The bay scallop, Argopecten irradians, is a hermaphroditic bivalve native to the Atlantic coast of North America. It was introduced to China in 1982 and is now a major aquaculture species (Zhang et al., 1986; Guo et al., 1999). Bay scallops are well known for their colorful shells. Shell color in bay scallops is relevant to aquaculture. When sold at the live market, scallops with brilliant shells are desired and command higher prices. Therefore, understanding the genetics of shell color in bay scallops is of economic importance. Clarke (1965) observed various shell colors in a museum collection of bay scallops, with white shells being the most frequent among the rare color types. Elek and Adamkewicz (1990) classified the colors in bay scallops into three
Keywords: AFLP — aquaculture — Argopecten irradians — breeding — genetics — shell color
Correspondence to: Xiao Liu; E-mail:
[email protected]
66
DOI: 10.1007/s10126-006-6076-7 & Volume 9, 66–73 (2007) & * Springer Science+Business Media, Inc. 2006
YANJIE QIN
ET AL.:
AFLP MARKERS LINKED
TO
SHELL COLOR
IN
BAY SCALLOP
background colors and six pattern colors. Based on data from experimental crosses, Kraeuter et al. (1984) suggested that colors in Argopecten irradians irradians (Lamarck, 1819) were under genetic control and were not strongly influenced by the environment. Adamkewicz and Castagna (1988) studied shell color inheritance in selfing families and found that orange or yellow parent produced both Bcolorful[ and white offspring in an approximately 3:1 ratio. They concluded that shell color in bay scallops was controlled by one locus with rare orange and yellow alleles dominant to white. However, shell color in bay scallops is highly diverse, and some of the colors cannot be adequately explained on the basis of the one-locus system. One way to better our understanding of shell color inheritance is to determine the number of loci and alleles that are involved. The identification of color-linked genetic markers can help us to determine the genotype of shell colors that involves recessive alleles, and therefore be used in markerassisted selection. Genetic markers have been used to study color polymorphisms in several molluscs including Cepaea nemoralis (Davison and Clarke, 2000) and Macoma balthica (Sololowski et al., 2002). Amplified fragment length polymorphism (AFLP) and microsatellites are commonly used markers for genetic studies (Holland, 2001; del Gaudio et al., 2004; Yu and Guo, 2004; Sato et al., 2005) and linkage mapping (Yu and Guo, 2003; Li and Guo, 2004; Wang, 2005; Liu et al., 2006) in marine organisms. AFLPs are highly effective and efficient markers for genomic mapping. Microsatellite markers are codominant and highly polymorphic. These polymerase chain reaction (PCR)-based techniques have been used to identify molecular markers associated with various traits of commercial importance. The AFLP technique has been considered to be the most powerful in revealing the highest level of DNA polymorphism and is being used extensively to map qualitative and quantitative trait loci. Sex-linked or sex-specific AFLP markers have been successfully isolated in Oreochromis niloticus (Ezaz et al., 2004) and Chlamys farreri (Li et al., 2005). In an effort to identify genetic markers for shell color in bay scallops, we analyzed a large number of AFLP and some microsatellite markers in an F1 population in which shell color was segregating. Here we report the identification and mapping of color-linked markers for the first time in the bay scallop.
67
classify shell color in this study. Two scallops with orange and white background color (Figure 1) were selected as parents to study shell color inheritance. The scallop with the white background had black pigment on the left shell. In May of 2003, two F1 families were produced using the two selected scallops: OW (orange as femalewhite as male) and the reciprocal WO (white as femaleorange as male). At the same time, two pure crosses, OO and WW, were also created by self-fertilization of the two parents with orange and white shells. Shell color of progeny was determined through random sampling in August 2003. In January 2004, 88 scallops, 37 orange and 51 white, were randomly selected from the OW for genetic analysis. A piece of adductor muscle was dissected from each scallop and stored in 75% alcohol. DNA Isolation and Genotyping. DNA was extracted via the phenol-chloroform method described by Zhang et al. (2005). Briefly states, 30 to 50 mg of tissue was homogenized in 600 2l of homogenization buffer 10 mM Tris-HCl (pH 8.0); 50 mM EDTA; 1% sodium dodecyl sulfate (SDS); 100 mM proteinase K. DNA was extracted once with phenol, twice with phenol-chloroform-isoamyl alcohol (25:24:1) and once with phenol-isoamyl alcohol (24:1), then precipitated by addition of 1/10 of the original volume of 3.0 M sodium acetate and two volumes of ethanol. After precipitation, DNA was collected by centrifugation and washed twice
Materials and Methods Production of Families. The color system devised by Elek and Adamkewicz (1990) was employed to
Fig. 1. Two scallops with orange and white background color used as parents in our study.
68
YANJIE QIN
with 70% ethanol. The pellets were air-dried and then suspended in 50 2l of autoclaved ddH2O. DNA concentration was measured using a UV spectrophotometer (Beckman, DU650), and concentrations were adjusted to 50 ng/2l for AFLP and microsatellite analysis. AFLP markers were generated following protocols described by Vos et al. (1995) with minor modifications. Briefly stated, 200 ng of genomic DNA was digested with 3 U of EcoRI (Promega) and 6 U of MseI (New England Biolabs, NEB) in a volume of 25 2l. The specific double-stranded EcoRI and MseI adapters were subsequently ligated to the restriction fragment ends. The preamplification reaction was then carried out in a volume of 20 2l. The preamplified DNA was diluted (1:20) with sterilized ddH2O, and 4 2l was used for selective amplification with three selective bases. Primer sequences for microsatellite markers were obtained from Wang (2005) and Zhan et al. (2005). Microsatellite analysis was conducted according to Zhan et al. (2005). PCR was performed in a volume of 25 2l containing 1 U of Taq DNA polymerase (Promega, Shanghai, China), 1PCR buffer, 0.2 mM dNTP mix, 1.5 mM MgCl2, 1 2M of each primer, and about 50 ng of template DNA. PCR conditions were the following: 5 min at 95-C followed by 35 cycles of 1 min at 94-C, 1 min at proper annealing temperatures, and 40 s at 72-C, with a final extension of 10 min at 72-C. PCR products were separated using 6% denaturing polyacrylamide gels (19:1 acrylamidebis-acrylamide, 7 M urea, 1TBE buffer (89 mM Tris-borate, 2 mM EDTA)) sized with the DNA ladder ,X174/Hinf I (Fermentas Life Sciences, USA). DNA bands were visualized via silver staining. Data and Linkage Analysis. AFLPs were scored as dominant markers and recorded as B1[ for band presence and B0[ for band absence. Only markers occurred in one parent, but absent in the other parent, and segregated in progeny were used for mapping analysis. Microsatellite markers were scored as codominant markers, and one of the two
ET AL.:
AFLP MARKERS LINKED
TO
SHELL COLOR
IN
BAY SCALLOP
alleles from the heterozygous parent was selected for coding and linkage analysis. Allele frequency distribution in each color morphotype was tested by contingency table test. All segregating markers including shell color were used for linkage analysis using the backcross model and the software package MAPMAKER/EXP 3.0 (Lander et al., 1987; Lincoln et al., 1992). The recombination frequencies between the color loci and the molecular markers were calculated using two-point analysis. The most likely map order was determined by three or multipoint analysis with a minimum LOD threshold of 3.0 and a maximum recombination fraction of 0.40. The recombination frequencies were converted into centiMorgans (cM) using the Kosambi function (Kosambi, 1944). Bulk Segregation Analysis of Color-Linked Markers. Because of high polymorphism of AFLP technique and easy to produce the false-positives, bulk segregation analysis developed by Michelmore et al. (1991) was used to validate the marker linked to orange color. Five DNA pools were established on the basis of the shell color. Among them, two pools were for orange shell color: one for offspring from WO family and the other from a natural population. The other three pools were for white color, from WO and WW families, and a natural population. Each pool contained an equal amount of DNA from six scallops of the same type/group. The five DNA pools were subjected to AFLP analysis with the primer combinations that produced the marker linked to orange color. Results Shell Color of Progeny. Three of the four families survived larval culture and were subsequently available for this study. Scallops from the three families reached a shell length of 1.5 to 2.0 cm when shell color was surveyed in August 2003. Family OW and WO had a large number of offspring, while WW produced only 18 scallops. Orange and white type scallops were found in about equal proportion in OW
Table 1. Frequency of Orange and White Progeny in Families Created by Crossing an Orange and a White Bay Scallop
Group OW WO WW
Sample number 177 139 145 Total 18
Orange
White
Percent white
75 54 70 199 0
102 85 75 262 18
57.6 61.2 51.7 0.57 100.0
OW, Orange as female white as male; WO, white as female orange as male; WW, selfing of the white scallop. a 2 # test is not available because one class has an expected frequency of zero.
# 2-Test 0.042 0.009 0.678 0.003 N/Aa
YANJIE QIN
ET AL.:
AFLP MARKERS LINKED
TO
SHELL COLOR
IN
69
BAY SCALLOP
Table 2. Microsatellite Markers and the Fraction of Each Color Type Having a Particular Allele Tested Against Random Distribution
Morphotype Orange
White
P-value (contingency test)
60
15/37
27/51
0.414
54
15/37
13/50
0.211
54
23/34
25/51
0.400
54
16/37
25/51
0.706
56
15/36
22/49
0.864
50
17/37
20/51
0.620
63
17/37
28/49
0.573
61
14/36
17/51
0.715
61
16/35
24/51
0.805
67
15/37
26/51
0.488
Locus
GenBank
Primer sequences (50 –30 )
Tm (-C)
MSB1248
AY485260
F:AAGTAGAGCGGAACGGATGT R:TGCCTCGAAGTTTGAGATAA F:AAGTAGAGCGGAACGGATGT R:GATGCCTCGAAGTTTGAGAT F:TAATGAGTACCGTTGAATGA R:AACGCTAACGACTATCTGTA F:CATAATGAACGGGTGGAGTG R:CAAATGATGACGATTAGGGA F:ATAATGAACGGGTGGAGTGT R:CAAATGATGACGATTAGGGA F:GCATCTAAGCACACTAATCC R:ACAGTGTATGCTATCAAAGT F:GAGAGTACAAGCACTGTTCTCATG R:GGTGCTATATCGACCTATATCTGAG F:AGTAGAGCGGAACGGATGTGC R:GAAGTTTGAGATAATGAGGTAGGG F:GACCCTGGATACCAATAAGACG R:TTGTATTCCGGGTGAGCGATAG F:CACTTCAGACACAAGTTACCGC R:TGAACCACCAAAGGTGACGGGG
MSBcn226 MSB5812
AY524781
MSBcn413 MSB3974
AY496642
MSB2888
AY512571
AIMS012
CN783420
AIMS020
CB416269
AIMS022
CB413627
AIMS026
CB416920
and WO families. The proportions of white types were 57.6% and 61.2% for two samples from OW, and 51.7% for WO family (Table 1). The frequency of the orange and white colors differed significantly from the expected 1:1 ratio in OW, but not in WO. On average, white types accounted for 56.8% of all scallops from the three families. In the WW family, all 18 surviving scallops were of the white type, as expected. Markers Linked to Shell Color. We screened 36 publicly available microsatellite markers in this study, and 10 produced clear and stable products that are polymorphic in parents and their progeny. But none of the 10 microsatellites showed significant association (P 9 0.05) to shell color (Table 2). We used 25 AFLP primer combinations and obtained 1138 fragments. Among the fragments, 148 (13.01%) were polymorphic in two parents and segregated in progeny. Among the segregating
markers, 19 (12.8%) showed significant deviation from the 1:1 Mendelian ratio (P G 0.05), with 16 having an excess of heterozygotes. Contingency # 2 test for random distribution of alleles in different color types found significant (P G 0.05) deviations at six loci (Table 3). Among the six markers, I5f180 had an excess of homozygotes and H5f348 showed a deficiency of homozygotes, and other markers were segregated according to the 1:1 Mendelian ratio (P 9 0.05). Linkage Analysis. The six markers showing association with shell color were all maternally segregated markers, and all of them were mapped to one linkage group (Figure 2). One of the loci (F1f335), generated by primer combination E-AAC/M-CTA and as shown in Figure 3, showed completed linkage to the shell color locus. This locus was amplified in the orange parent and all of the orange progeny, but absent in the white parent and all the
Table 3. Fraction of Each Color Type Progeny having a Particular AFLP Marker Tested Against Random Distribution in an Orange White Family
Morphotype Locus
MseI
EcoRI
size
Orange
White
P-value (contingency test)
#2-test (segregation ratio)
F1f335 I2f680 I6f550 I5f180 H5f348 H7f305
M-CTA M-CTT M-CTT M-CTT M-CTG M-CTG
E-AAC E-AAG E-ACT E-ACG E-ACG E-AGC
335 680 550 180 348 305
36/37 32/37 4/37 26/37 12/37 8/37
0/51 18/51 49/51 3/51 46/51 29/51
2.07E-12 1.70E-03 3.37E-07 2.21E-07 9.30E-04 1.15E-02
0.0881 0.2008 0.0550 0.0014 0.0028 0.2008
70
YANJIE QIN
H5f348 3.4 I5f180 9.3 I6f550 6.6 F1f335(Orange1)
ET AL.:
AFLP MARKERS LINKED
TO
SHELL COLOR
IN
BAY SCALLOP
H5f348, and H7f305, which were present at a distance of 15.9 cM, 19.3 cM, and 35.5 cM, respectively, from the shell color locus. No microsatellite markers were linked to this group. Bulk Segregation Analysis. Bulk segregation analysis in two natural populations and the three experimental crosses confirmed the expected linkage. Marker F1f335 was amplified in all of the orange pools, but absent in all white pools, suggesting that F1f335 allele was in complete linkage with the Orange1 gene for shell color. Discussion
29.9
I2f680 5.6 H7f305 Fig. 2. A genetic linkage group of six AFLP markers and the Orange1 locus associated with shell color in bay scallop, A. i irradians.
white progeny. No recombinant between this marker and the color locus was observed. We designated this locus as Bshell color[ and the cosegregating allele F1f335 as BOrange1[. The linkage group that carried Orange1 was 54.8 cM in length with a marker density of 11 cM. Marker I6f550 and I2f680 flanked Orange1 at a distance of 6.6 cM and 29.9 cM, respectively. Other markers located on this linkage group were I5f180,
Results of our study are in agreement with previous studies that shell color in bay scallops is under genetic control (Kraeuter et al., 1984; Adamkewicz and Castagna, 1988; Elek and Adamkewicz, 1990; Zheng et al., 2003). Further, our data support the one-locus system proposed by Adamkewicz and Castagna (1988) and Elek and Adamkewicz (1990), in which the white color is recessive. In our study, the fact that whiteorange crosses (WO and OW) produced about 1:1 white to orange progeny and selfing of the white parent (WW) produced all white progeny suggests that the orange parent is heterozygous and contains both the white and orange alleles. Our results support the following genotypes for the two parents: Ow for the orange and ww for the white parent. Crosses between the orange and white parents produce about 50% white and 50% orange progeny: Ow ww ¼ Ow ww. Selfing of the ww genotype can produce only white progeny. The observed frequency of white and orange progeny differed from the expected 1:1 ratio in the OW, but not in the WO family. The excess of white type suggests the white genotype may have better survival than the orange type.
Fig. 3. A portion of the AFLP profile generated with the primer combination E-AAC/M-CTA in an F1 mapping population that involved two parents and their 37 orange and 7 white-color progenies. The specific marker (F1f335) for orange color is indicated with an arrowhead.
YANJIE QIN
ET AL.:
AFLP MARKERS LINKED
TO
SHELL COLOR
IN
BAY SCALLOP
It is easy to understand that the white colored parent is homozygous, as the white allele is recessive. It is also not unexpected that the orange parent is heterozygous. The orange individual used here was selected from a few rare individuals from a natural population. Orange types are known to be rare occurrences in other natural populations also (Clarke, 1965). Among 1416 bay scallops collected from Martha_s Vineyard, MA, Elek (1985) recorded yellow and orange shell types at frequencies of 3% and 2%, respectively. With such a low frequency of the orange allele, it would be difficult to find an orange type that is homozygous. The finding of simple genetic control of shell color in bay scallops is not surprising. Shell color is determined by similar one-locus two-allele systems in Mytilus edulis (David and Leslie, 1977; Newkirk, 1980), Crepidula convexa (Hoagland, 1977), and Urosalpinx cinerea (Timothy, 1975). Different color variants (purple, brown, orange, yellow, and white) were also observed in the north Chilean scallop (Argopecten purpuratus), and they were determined by two loci, a simple dominant model of epistasis (Winkler et al., 2001). There are three background colors (white, orange, and yellow) and six overlying (pattern) colors in bay scallops (Elek and Adamkewicz, 1990). Scallops we usually considered as brown or black are probably those with white background color but covered with different pattern colors. It has been shown that orange and white background color is inherited in a one-locus two-allele system, which is supported by our molecular analysis. Yellow background color versus white is also subject to the same genetic model as orange to white (Adamkewicz and Castagna, 1988), while orange and yellow may be alternative alleles (Elek, 1985) or only variations in the concentration of one pigment (Adamkewicz and Castagna, 1988). We cannot determine the relationship between orange and yellow in this study because no yellow scallops have been found in China. Further studies are needed to determine if other alleles or loci are involved in shell color determination in bay scallops. The most significant result of this study is the identification of genetic markers linked to the shell color locus. The presence of the F1f335 fragment in the orange parent and all of the orange progeny studied, and its absence in the white parent and all of the white progeny, suggest this allele is closely or completely linked to the Orange1 gene at the shell color locus. The same association was observed in bulk analysis, providing validation of the linkage. Positive association in natural populations suggests that the linkage is very strong or nearly complete, as recombination over many generations would have
71
broken weak linkages. Nevertheless, the number of individuals used in this study was relatively small, and the natural populations used have a short history (introduced in 1982). Confirmation with a large number of individual and in a true wild population is needed to determine if F1f335 is completely linked to Orange1. The fact that all six markers associated with shell color is closely linked to each other in one linkage group shows that the association is not random, but truly reflects genetic linkage. This finding shows that variations at the AFLP loci are real and free from artifacts. Also, the observation that all six markers segregated from the female (instead of the male) provides further support that the female parent (orange) is heterozygous at the color locus, and the male parent (white) is likely homozygous. This study is probably the first time that DNA marker technique was used to study color heredity in bay scallops. This study demonstrates that power of genetic analysis with AFLP markers. AFLP is a robust and reliable molecular marker assay (Vos et al., 1995). The number of polymorphisms per reaction is much higher than that revealed by restriction fragment linked polymorphisms (RFLP) or the PCR-based randomly amplified polymorphic DNA (RAPD) assay. With the ease of generating a large number of markers, AFLP permits rapid genome-wide scan for the identification and mapping of important traits (Rodriguez et al., 2004; Anastasia et al., 2005; Yu and Guo, 2005). This study provides another example for the effective use of AFLP markers. None of the 10 microsatellite markers used in this study showed any association with the shell color locus. The screening of hundreds of microsatellites would be time-consuming and expensive. Although the AFLP markers are not easily transferred across populations or labs, markers of interest such as F1f335 in this study can potentially be cloned, sequenced, and converted to codominant markers. Such a marker may eventually lead to the identification and cloning of the actual gene for orange pigmentation. It may be that the low polymorphism (relative to microsatellites) and the bi-allelic nature of AFLPs make possible the detection of association at the population level. This study provides genomic mapping of a shell color gene in the bay scallop. This is probably the first time that a shell color gene was genetically mapped in a bivalve. The mapping of shell color genes improves our understanding of shell color inheritance in bay scallops. This has been done in other organisms; for example, the seed color gene in rapeseed was mapped with RAPD and AFLP
72
YANJIE QIN
markers, bracketed by two markers, which are 2.1 and 3.1 cM away (Liu et al., 2005). Sabharwal et al. (2004) found an AFLP marker cosegregating with the gene controlling seed-coat color in Brassica juncea, and successfully converted it to a sequencecharacterized amplified region (SCAR) marker. The trait-specific markers have been recently detected in aquaculture organism. Sex-specific DNA sequences have been identified in several fish species via different assays, including RAPDs, RFLPs, AFLPs, and microsatellite markers (Devlin et al., 2001). Kai et al. (2002) found five specific AFLP loci among three color morphotypes in black rockfish, Sebastes inermis. A sex-linked marker was mapped on the female map with zero recombination in Zhikong scallop, Chlamys farreri (Li et al., 2005). Identification of markers closely linked to a trait of interest is important for breeding through marker assistant selection (MAS), which has been widely practiced in plants. Shell color is an important trait in bivalve molluscs such as scallops and pearl oysters. Wada and Komaru (1996) found that a line of selected white Japanese pearl oysters, Pinctada fucata martensii, was useful in producing higherquality pearls. The correlation of growth and survival with shell color has been reported in Mytilus edulis (Newkirk, 1980) and in scallop (Wolf and Garrido, 1991; Alfonsi and Perez, 1998). We have also noticed an association between the orange color and the growth and survival in bay scallops (unpublished). The F1f335 marker that closely linked to Orange1 can potentially be used for marker-assisted selection. Because orange color is dominant, marker-assisted selection may be especially useful in identifying homozygous versus heterozygous orange individuals during selective breeding. Acknowledgments We thank Qingdao Jinying Ocean Science & Technology Development Co., Ltd. for their assistance in scallop hatchery and farm operations. This study was funded by grants from the NSFC (30671622, 30500381), and also partly supported by grants from NSFC (39825121).
References Adamkewicz L, Castagna M (1988) Genetics of shell color and pattern in the bay scallop Argopecten irradians. J Hered 79, 14–17 Alfonsi C, Perez JE (1998) Growth and survival in the scallop Nodipecten nodosus as related to self-fertilization and shell colour. Bol Inst Oceanogr Venez 37, 69–73
ET AL.:
AFLP MARKERS LINKED
TO
SHELL COLOR
IN
BAY SCALLOP
Anastasia MZ, Paul AW, Sandra SR, Gary HT (2005) Composite interval mapping reveals three QTL associated with pyloric caeca number in rainbow trout, Oncorhynchus mykiss. Aquaculture 247, 85–95 Clarke H (1965) The scallop superspecies Aequipecten irradians (LAMARCK). Malacologia 2, 161–188 Creese RG, Underwood AJ (1976) Observations on the biology of the torchid gastropod, Austrocochlea constricta (Lamarck) (Prosobranchia). I. Factor affecting shell-banding patterns. J Exp Mar Biol Ecol 23, 211–228 David JI, Leslie EH (1977) Inheritance of a shell color polymorphism in the mussel. J Hered 68, 203–204 Davison A, Clarke B (2000) History or current selection? A molecular analysis of Barea effects[ in the land snail Cepaea nemoralis. Proc Roy Soc B Biol Sci 267, 1399– 1405 del Gaudio D, Fortunato G, Borriello M, Gili JM, Buono P, Calcagno G, Salvatore F, Sacchetti L (2004) Genetic typing of Corallium rubrum. Mar Biotechnol 6, 511–515 Devlin RH, Biagi CA, Smailus DE (2001) Genetic mapping of Y-chromosomal DNA markers in Pacific salmon. Genetica 111, 43–58 Elek J (1985) Shell Color Polymorphism in the Atlantic Bay Scallop. M. Sc Thesis, George Mason University, Fairfax, VA. Elek JA, Adamkewicz SL (1990) Polymorphism for shell color in the Atlantic bay scallop Argopecten irradians irradians (Lamarck) (Mollusca: Bivalvia) on Martha_s Vineyard island. Am Malacol Bull 7, 117–126 Ezaz MT, Harvey SC, Boonphakdee C, Teale AJ, McAndrew BJ, Penman DJ (2004) Isolation and physical mapping of sex-linked AFLP markers in Nile tilapia (Oreochromis niloticus L.). Mar Biotechnol 6, 435–445 Gomelsky B, Cherfas NB, Ben-Dom N, Hulata G (1996) Color inheritance in ornamental koi carp (Cypprinus carpio L.) inferred from color variability in normal and gynogentic progenies. Isr J Aquac-Bamidgeh 48, 219–230 Guo X, Ford SE, Zhang F (1999) Molluscan aquaculture in China. J Shellfish Res 18, 19–31 Hoagland KE (1977) A gasteropod color polymorphism: one adaptive strategy of phenotypic variation. Biol Bull 152, 360–372 Holland BS (2001) Invasion without a bottleneck: microsatellite variation in natural and invasive populations of the brown mussel Perna perna (L). Mar Biotechnol 3, 407–415 Ino T (1949) The effect of diet on growth and colouration of the top shell Turbo cornutus (Solander). J Mar Res 8, 1–5 Kai Y, Nakayama K, Nakabo T (2002) Genetic differences among three color morphotypes of the black rockfish, Sebastes inermis, inferred from mtDNA and AFLP analyses. Mol Ecol 11, 2591–2598 Kosambi DD (1944) The estimation of map distance from recombination values. Ann Eugen 12, 172–175 Kraeuter J, Adamkewicz L, Castagna M, Wall R, Karney R (1984) Rib number and shell color in hybridized subspecies of the Atlantic bay scallop, Argopecten irradians. Nautilus 98, 17–20 Lander E, Green P, Abrahamson J, Barlow A, Daley M, Lincoln S, Newburg L (1987) MAPMAKER: an interac-
YANJIE QIN
ET AL.:
AFLP MARKERS LINKED
TO
SHELL COLOR
IN
BAY SCALLOP
tive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1, 174–181 Legates JE, Warwick EJ (1990) Breeding and Improvement of Farm Animals. (New York: McGraw-Hill), pp 342 Leighton DL (1961) Observations on the effect of diet on shell coloration on the red abalone Haliotis rufescens Swainson. Veliger 4, 29–32 Li L, Guo X (2004) AFLP-based genetic linkage maps of the Pacific Oyster Crassostrea gigas Thunberg. Mar Biotechnol 6, 26–36 Li L, Xiang J, Liu X, Zhang Y, Dong B, Zhang X (2005) Construction of AFLP-based genetic linkage map for Zhikong scallop, Chlamys farreri Jones et Preston and mapping of sex-linked markers. Aquaculture 245, 63–73 Lincoln S, Daly M, Lander E (1992) Constructing genetic maps with MAPMAKER/EXP 3.0. Whitehead Institute Technical Report, Whitehead Technical Institute, Cambridge Liu X, Liu X, Guo X, Gao Q, Zhao H, Zhang G (2006) A preliminary genetic linkage map of the Pacific abalone Haliotis discus hannai Ino. Mar Biotechnol 8, 386–397 Liu Z, Fu T, Tu J (2005) Inheritance of seed colour and identification of RAPD and AFLP markers linked to the seed colour gene in rapeseed (Brassica napus L.). Theor Appl Genet 110, 303–310 Michelmore RW, Paran I, Kesseli RV (1991) Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc Natl Acad Sci USA 88, 9828–9832 Mitton JB (1977) Shell color and pattern variation in Mytilus edulis and its adaptive significance. Chesapeake Sci 18, 387–390 Newkirk GF (1980) Genetics of shell color in Mytilus edulis L. and the association of growth rate with shell color. J Exp Mar Biol Ecol 47, 89–94 Palmer AR (1985) Genetic basis of shell variation in Thais emarginata (Prosobranchia, Muricacea).I. Banding in populations from vancouver island. Biol Bull 169, 638–651 Rodriguez MF, LaPatra S, Williams S, Famula T, May B (2004) Genetic markers associated with resistance to infectious hematopoietic necrosis in rainbow and steelhead trout (Oncorhynchus mykiss) backcrosses. Aquaculture 241, 93–115 Sabharwal V, Negi MS, Banga SS, Lakshmikumaran M (2004) Mapping of AFLP markers linked to seed coat colour loci in Brassica juncea (L.). Czern Theor Appl Genet 109, 160–166 Sato M, Kawamata K, Zaslavskaya N, Nakamura A, Ohta T, Nishikiori T, Brykov V, Nagashima K (2005) Development of microsatellite markers for Japanese scallop (Mizuhopecten yessoensis) and their application to a population genetic study. Mar Biotechnol 7, 713–728 Sololowski A, Fichet D, Meunier PG, Radenac G, Wolowicz M, Blanchard G (2002) The relationship between metal concentrations and phenotypes in the Baltic clam Macoma balthica (L.) from the Gulf of Gdansk, southern Baltic. Chemosphere 47, 475–484
73
Thorgaard GH, Spurell P, Wheeler PA (1995) Incidence of albinos as a monitor for induced triploidy in rainbow trout. Aquaculture 137, 121–130 Timothy JC (1975) Inheritance of juvenile shell color of the oyster drill Urosalpinx cinerea. Nature 257, 794–795 Vos P, Hogers RO, Bleeker M, Reijans M, Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, Zabeau M (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23, 4407–4414 Wade BA (1968) A study on the biology of the west Indian beach clam Donax denticulatis. II. Life History. Bull Mar Sci 18, 876–901 Wada KT, Komaru A (1996) Color and weight of pearls produced by grafting the mantle tissue from a selected population for white shell color of the Japanese pearl oyster Pinctada fucata martensii (Dunker). Aquaculture 142, 25–32 Wang L (2005) The Linkage Mapping in Zhikong Scallop Chlamys farreri and Bay Scallop Argopecten irradians. Doctoral dissertation. Institute of Oceanology, Chinese Academy of Science, China Winkler FM, Estevez BF, Jollan LB, Garrido JP (2001) Inheritance of the general shell color in the scallop Argopecten purpuratus (Bivalvia: Pectinidae). J Hered 92, 521–525 Wither RE (1986) Genetic variation in carotenoid pigment deposition in the red-fleshed and white-fleshed Chinook salmon (Oncorhynchus tshawytscha) of Quesnel River, British Columbia. Can J Genet Cytol 28, 587– 594 Wolf M, Garrido J (1991) Comparative study of growth and survival of two color morphs of the Chilean scallop Argopecten purpuratus (Lamarck) in suspended culture. J Shellfish Res 10, 47–53 Yu Z, Guo X (2003) Genetic linkage map of the eastern oyster Crassostrea virginica Gmelin. Biol Bull 204, 327–338 Yu Z, Guo X (2004) Genetic analysis of selected strains of eastern oyster (Crassostrea virginica Gmelin) using AFLP and microsatellite markers. Mar Biotechnol 6, 575–586 Yu Z, Guo X (2005) Identification and mapping of diseaseresistance QTLs in the eastern oyster, Crassostrea virginica Gmelin. Aquaculture 254, 160–170 Zhan A, Bao Z, Wang X, Hu J (2005) Microsatellite markers derived from bay scallop Argopecten irradians expressed sequence tags. Fisheries Sci 71, 1339–1344 Zhang F, He Y, Ma J, Li S, Qi L (1986) A report on the introduction, spat-rearing and experimental culture of bay scallop, Argopecten irradians Lamarck. Oceanol Limnol Sinica 17, 367–374 Zhang W, Liu X, Zhang G (2005) AFLP analysis on genetic structure and differentiation of four different cultured populations of Argopecten irradians. High Technol Lett 15, 84–88 Zheng H, Zhang G, Liu X, Que H (2003) Establishment of different shell color lines of bay scallop Argopecten irradians irradians Lamarck (1819) and their development. Oceanol Limnol Sinica 34, 632–663
