... CHIOU,' JIANCHAO ZONG,' ISHRAT WAHEED,2 AND GARY S. HAYWARDl.2* ...... Stenberg, R. M., J. Forteny, S. W. Barlow, B. P. Magrane, J. A.. Nelson, and ...
Vol. 67, No. 10
JOURNAL OF VIROLOGY, Oct. 1993, p. 6201-6214
0022-538X/93/106201-14$02.00/0 Copyright ©) 1993, American Society for Microbiology
Identification and Mapping of Dimerization and DNA-Binding Domains in the C Terminus of the IE2 Regulatory Protein of Human Cytomegalovirus CHUANG-JIUN CHIOU,' JIANCHAO ZONG,' ISHRAT WAHEED,2 AND GARY S. HAYWARDl.2* The Virology Laboratories, Department of Pharnacology and Molecular Sciences,2 and Department of Oncology, 1 Johns Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, Maryland 21205-2185 Received 28 May 1993/Accepted 20 July 1993
The 80-kDa IE2 nuclear phosphoprotein encoded by the human cytomegalovirus (HCMV) major immediateearly (MIE) gene behaves both as a nonspecific transactivator of heterologous reporter genes and as a specific repressor of its own promoter-enhancer region. To begin to examine the biochemical properties of the IE2 protein, we prepared panels of N-terminal and C-terminal truncation mutants by in vitro translation procedures. In cross-linking experiments, the C-terminal half of IE2 (which is sufficient for down-regulation) formed dimers but N-terminal segments did not do so. Cotranslated Oct2/IE2 fusion proteins containing the same IE2 C-terminal region from codons 266 to 579 also formed mixed-subunit DNA-bound oligomeric complexes in gel mobility shift assays. Furthermore, an IE2 domain bounded by codons 388 to 542 proved to immunoprecipitate as heterodimers with cotranslated subunits containing known epitopes for specific antibodies. Deletion up to codon 428 or truncation back to codon 504 prevented this interaction. In direct gel shift DNA-binding assays, a bacterial GST/IE2(346-579) fusion protein bound to a 30-mer oligonucleotide probe encompassing the major immediate-early gene negative cis-regulatory target DNA sequence but failed to bind to a single-base-pair insertion mutant probe (ACRS). This specific DNA-binding activity was abolished by further deletion up to codon 388 on the N-terminal side or by truncation at codon 542 on the C-terminal side. Therefore, the minimal DNA-binding domain requires additional amino acid motifs on both sides of the dimerization domain. This segment of IE2 is functionally important for both transactivation and down-regulation and contains several highly conserved amino acid motifs that are shared amongst the equivalent HCMV, simian CMV, mouse CMV, rat CMV, and human herpesvirus 6 proteins from other betaherpesviruses. been based primarily on its properties as a powerful independent transactivator in transient cotransfection assays (12, 14, 35, 50), on its ability to complement ElA-negative mutants of adenovirus (42), and on the relatively high levels of amino acid conservation in the equivalent proteins of all other betaherpesviruses (Sa). Most significantly, the intact 80-kDa IE2 protein and the unspliced late 40- and 55-kDa C-terminal forms all have the ability to specifically downregulate the MIE promoter, either in transient cotransfection assays or in vitro, through a mechanism that includes direct DNA binding to a cis-acting repression element (CRS) near the cap site (8, 20, 26, 29, 35, 37). This autoregulatory mechanism and the partially palindromic CRS DNA target site motif 5'-CGT1TN4AACCG-3' are conserved between human and African green monkey CMVs (37) but are either missing or utilize altered response sequences in mouse and rat CMVs and in human herpesvirus 6 (HHV-6) (31, 33a, 39a). In contrast, the nonspecific transactivator properties are retained in all four primate and rodent CMV IE2 species that have been tested (16, 37, 39a). Previous mapping studies have revealed that human CMV (HCMV) IE2 contains two distinct acidic activator domains (one at the N terminus and one at the C terminus), which function independently of one another in GALA fusion proteins but are both required to be present for transactivation of most target reporter genes within the context of IE2 itself (36). The intact 579-amino-acid IE2 protein contains two proven nuclear localization signals mapping at codons 145 to 151 (NLS-1) and 321 to 328 (NLS-2) and several consensus casein kinase II substrate motifs such as 203-
Infection with cytomegalovirus (CMV) is a very cell-typeand host-type-specific event, even in cell culture. Typical of herpesviruses, the lytic cycle of CMV progresses through a programmed series of events that include positive and negative transcriptional and posttranscriptional regulation of both viral and cellular genes (4, 40, 41, 43). Some of the activation events can be mimicked by superinfection of transiently DNA-transfected cells receiving reporter genes driven by a variety of heterologous target promoters (32, 34). Depending on the circumstances, the triggering events that lead into the lytic cycle in infected cells may also be shut down or overcome by viral and cellular factors that favor establishment of a latent state or in other ways block or prevent the lytic cycle cascade at various points (17, 18). Apart from possible regulatory virion components such as pp69/71(UL82/83) (27), the initial viral gene products that have the greatest effects in triggering and controlling the lytic cycle are believed to be the IE1 (72-kDa form) and IE2 (80-kDa form) proteins and perhaps also the minor 55-kDa form of IE2 encoded by differentially spliced transcripts from the major immediate-early (MIE) gene (2, 15, 19, 30, 36, 45, 46, 47). Other minor IE viral products such as TRL-1/TRS-1, US3, and UL36/37 clearly contribute also either at later stages or in ways that are still poorly defined (10, 44, 49). The 80-kDa IE2 protein, an important transcriptional regulatory protein, has received the most attention. This has
*
Corresponding author. 6201
6202
CHIOU ET AL.
SDSEEEQGEE-212, 255-DEDSSSSSSS-264, and 265-SDS ESESEE-277 (36). The down-regulation phenotype of IE2 requires only the C-terminal segment encompassed between codons 290 to 579 but is disrupted by insertions placed at many locations within this region (30, 46). Curiously, both transactivation and down-regulation are abolished by removal of the C-terminal 33-amino-acid activator domain (35, 37). Recent studies have indicated that, similar to other viral transactivators such as ElA, VP16, and Zta, IE2 can form direct protein-protein contacts with the TATAA-binding protein (TBP) component of human TFIID in vitro (5, 13). In the present study, we demonstrate that the 80-kDa form of the HCMV IE2 protein forms dimers and possibly higherorder oligomers in solution in vitro and that the DNAbinding domain and the dimerization domain occupy overlapping segments of the most highly conserved C-terminal portion of the protein.
MATERIALS AND METHODS In vitro transcription and translation vectors for IE2 proteins. For in vitro transcription and reticulocyte translation in rabbit reticulocyte extracts, we used high-efficiency vectors containing black beetle virus (BBV) leader and initiator region sequences (23). Various portions of the IE1 and IE2 coding regions were placed in frame behind the phage T7 promoter in the appropriate reading frame versions of a BglII linker-adapter plasmid series (pGH253, pGH254, and pGH255) derived from pBD7 (11). Initially, the complete IE2 exon 5 region (codons 86 to 579) was moved from the genomic HCMV(Towne) effector plasmid pRL45 (37) as a 1.5-kb BamHI-BamHI fragment with the previously described polymerase chain reaction (PCR) linker-primers LGH320 and LGH369 (36) and placed into pGH255 to create pCJC182. Next, the same PCR primers were used with a pRL45-derived template containing an in-frame BglII insertion linker at the XhoI site (pMP32) to place an 880-bp BglII-BglII fragment (codons 290 to 579) into pGH255 as plasmid pGH313. Plasmid pCJC185 containing exons 2 and 3 only (codons 1 to 86) was prepared by placing a 260-bp BamHI-SacI PCR fragment from pMP71a and an IEl cDNA template derived from pIE1 (a gift from R. Spaete, Chiron) into pGH255 with linker-primers LGH401 and LGH367 (36). A complete IE1 exon 2, 3, and 4 version (codons 1 to 495) in plasmid pCJC181 was generated by addition of a SacI-BamHI-SacI linker into pIE1 and moving a 1.5-kb BamHI-BamHI fragment into pGH255. Finally, a complete BBV IE2 exon 2, 3, and 5 version (codons 1 to 579) in plasmid pCJC186 was reconstructed in three steps. Firstly, codons 86 to 143 were added as a 180-bp SacI-Sacl fragment from pMP65a (LGH368/LGH367) in frame behind codons 1 to 86 in the SV2-GAL4 fusion construction plasmid pMP71a to create pCJC183. Secondly, codons 1 to 143 were moved from pCJC183 into the in vitro expression vector pGH255 as a 430-bp BamHI-BclI fragment (pCJC184). Thirdly, exon 5 codons 136 to 579 as a 1,300-bp SmaI-EcoRI fragment from pCJC182 were added in frame behind codon 135 of pCJC184 to create pCJC186. Several series of additional C-terminaltruncated in vitro-translated products ending at codons 135 (SmaI), 197 (NaeI), 290 (XhoI), 379 (RsaI), 504 (HaeII), and 542 (StuI) were generated from these constructions by linearizing the appropriate plasmid DNA template at internal restriction sites before incubation with T7 polymerase. A set of internally initiated IE2 exon 5 constructions were placed in frame at the BglII site in pGH253 by using a variety
J. VIROL.
of N-terminal 5'-truncation PCR linker-primers beginning at codons 313 (pCJC45 and LGH797), 346 (pCJC46 and LGH798), 388 (pCJC47 and LGH799), 428 (pCJC48 and LGH800), 479 (pCJC49 and LGH831), 504 (pCJC50 and LGH832), and 530 (pCJC43 and LGH833), together with a new 3' PCR linker-primer LGH888. In addition, a similar construction (pCJC188) starting at codon 493 was created by inserting a BclI-EcoRI fragment from CJC182 into pGH255. The 5'-to-3' sequences of previously undescribed PCR primers used above were as follows: LGH797, CTAGAGAT CTCCATCAGAGCAGCGGCGGGGCG; LGH798, CTAGA GATCTCAACACCCCCTTCTGCACACCC; LGH799, CT AGAGATCTCAGTATGCACCAGGTGTTAGAT; LGH800, CTAGAGATCTCTGTCGCCTGGGCACCATGTGC; LGH 831, CTAGAGATCTCACCCACCAATTATGCCCCCGT; LGH832, CTAGAGATCTCCTCAACCTGTGCCTGCCCC TG; LGH833, CTAGAGATCTCGGTGGGTTCATGCTGC CTATC; LGH888, CTAGAGATCTGAATTCTTAGGGAT CCTGAGACTITGTTCCTCA. Oct2 DNA-binding domain fusion proteins. The DNAbinding domain (codons 1 to 359; 35 kDa) for human Oct2 protein (pBS-ATG/Oct2) (9), including the T3 polymerase site and leader and initiator sequences from an in vitro translation cDNA vector, was placed in frame in front of various segments of HCMV IE2 as follows. Initially, a PstI-BglII-PstI adaptor was inserted into the pBS-ATG/Oct2 plasmid (pCJC140). For construction of intact Oct2/IE1(1495) and Oct2/IE2(1-579) genes in plasmids pCJC141 and pCJC146, BamHI-EcoRI fragments from pCJC181 or pCJC186 were inserted into the BglII site of pCJC140. Similarly, to create Oct2/IE2(87-579) and Oct2/IE2(266579), a 1.8-kb BamHI-EcoRI fragment from pCJC182 or a 1.0-kb PstI-EcoRI fragment from pCJC186 was added to pCJC140 to create plasmids pCJC142 and pCJC187, respectively. For C-terminus-truncated forms of the latter, the plasmid was linearized with XhoI or BclI (instead of EcoRI) before the RNA was synthesized. In vitro transcription and translation. The BBV IE2 template plasmids were linearized downstream of the coding region and in vitro transcribed by using the T7 polymerase plus mRNA capping kit from Stratagene. In vitro translation or cotranslation was carried out with rabbit reticulocyte lysates according to the manufacturer's protocol (Promega). Each 50-pl reaction mixture contained a total of 1 ,ug of template mRNA (whether singly translated or cotranslated) and was incubated in the presence of 1 mCi of [35S]methionine (1,000 Ci/mmol; Amersham) per ml. All parallel samples for electrophoretic mobility shift assay (EMSA) or immunoprecipitation experiments used equal amounts of total reticulocyte protein whether singly translated, cotranslated, or mixed. In all immunoprecipitation experiments, the control in vitro-translated samples contained 40% as much protein as was initially used in the sample that was incubated with antibody. The human P53 in vitro transcription and translation vector contained a 1.8-kb XbaI-XbaI cDNA fragment and a T3 promoter in a pBSK (Stratagene)-derived background and was obtained from Ken Kinsler and Bert Vogelstein (Oncology Center, Johns Hopkins University). All samples were evaluated for size and integrity by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) followed by autoradiography. MAbs and peptide antibodies. Mouse monoclonal antibody (MAb) directed against an epitope within the common exon 2/3 region (codons 1 to 86) of HCMV IE1 and IE2 (19) was obtained from Chemicon (MAb810; Chemicon, El Segundo, Calif.) and used at a 1:200 dilution for immunoprecipitation
VOL. 67, 1993
HCMV IE2 DIMERIZATION AND DNA-BINDING DOMAINS
experiments. Rabbit monospecific polyclonal antibodies (PAbs) directed against HCMV IE exon5 peptides containing codons 142 to 156 (P1), 171 to 184 (P2), 367 to 382 (P3), and 550 to 564 (P4) were generated as described by Pizzorno et al. (36). Mouse monoclonal P53(Ab-1) directed against the C-terminal domain of mammalian P53 proteins was obtained from Oncogene Science (catalog no. OP03, PAb 421) and was used at a 1:80 dilution for immunoprecipitation assays. Immunoprecipitation and cross-linking assays. Immunoprecipitations were carried out with in vitro-translated or cotranslated proteins and 2 to 5 ,ul of undiluted antisera in 400,ul of TSET buffer (150 mM NaCl, 50 mM Tris-HCl, 0.1 mM EDTA, 2% Triton X-100 [pH 8.0]). After 90 min at 4°C, the mixtures were absorbed to protein A-Sepharose for 1 h and then pelleted and washed three times in TSET. The precipitate was resuspended and boiled for 5 min in loading buffer before electrophoretic separation on an SDS-9% polyacrylamide gel. For cross-linking assays, 10 RI of in vitrotranslated protein lysate samples was diluted with 90 RI of 10 mM potassium phosphate buffer (pH 8.0) and incubated in 0.01% glutaraldehyde at room temperature for 1 h (33). The mixtures were then immunoprecipitated with appropriate antisera. Bacterial GST/1E2 fusion genes. For expression in Eschenichia coli, fragments of IE2 were inserted in frame behind the GST domain from mammalian glutathione S-transferase in the pGEX-3X vector system (Pharmacia). Firstly, BglII linker-adaptors for all three reading frames were inserted at the SmaI site in pGEX-3X (pGH416, pGH417, and pGH418). To construct an N-terminus-truncated series of GST/IE2 fusions, BglII-EcoRI or BamHI-EcoRI fragments from plasmids pCJC45, pCJC46, pCJC47, pCJC48, pCJC49, pCJC50, and pCJC43 were added to pGH417 to make pCJC175 (codons 313 to 579), pCJC176 (346 to 579), pCJC177 (388 to 579), pCJC178 (428 to 579), pCJC179 (479 to 579), pCJC170 (506 to 579), and pCJC173 (530 to 579). Finally, three additional GST/IE2 fusion genes that contained triple terminators at codons 493 (pCJC75) or 542 (pCJC73) and an in-frame deletion between codons 493 and 542 (pCJC77) were constructed. These were prepared by PCR with 5' linker-primer LGH798 and 3' linker-primer LGH888 from plasmids pMP25, pMP14, and pRL93, respectively. Synthesis and purification of GST fusion proteins. Overnight cultures of E. coli JM101 harboring appropriate pGEXbased plasmids were diluted 1:10 in 200 ml of Luria broth medium containing 100 jig of ampicillin per ml and grown for 1 h at 37°C. After the addition of isopropyl-o-D-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM, cells were incubated for a further 5 h and harvested by centrifugation at 3,000 x g for 5 min at 4°C. The cell pellets were resuspended in 4 ml of phosphate-buffered saline (PBS) buffer (137 mM NaCl, 2.7 mM KCI, 4.3 mM Na2HPO4, 1.4 mM KH2PO4 [pH 7.3]) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and lysed on ice by sonication. Triton X-100 was added to 1% before centrifugation at 10,000 x g for 5 min at 4°C. The supernatant was mixed gently at 4°C with 300 ,ul of glutathione-agarose beads (Pharmacia). After absorption for 15 min, beads were pelleted and washed three times with PBS. Fusion proteins were eluted by adding 300 pul of 50 mM Tris-HCl (pH 8.0) plus 5 mM glutathione and analyzed on SDS-polyacrylamide gels. Proteins were visualized by Coomassie blue staining. Electrophoretic mobility shift DNA-binding and supershift assays. The DNA-binding probes representing the HCMV MIE cap site (35, 37) were prepared by annealing the following complementary 30-mer CRS (wild-type) oligonu-
6203
cleotide pairs: LGH546 (5'-GATCCCGGGAGCTCGTT TAGTGAACCGTCA-3') and LGH547 (5'-GATCTGACG GTTCACTAAACGAGCTCCCGG-3'), or the 31-mer ACRS (insertion at -8) LGH548 (5'-GATCCCGGGAGCTCGTT TAGGTGAACCGTCA-3') and LGH549 (5'-GATCTCACG GTTCACCTAAACGAGCTCCCGG-3'), or the 48-mer TAT AA/CRS (wild-type) oligonucleotide pairs, LGH860 (5'-
GATCTGAGGTCTATATAAGCAGAGCTCGTlTAGTGA
(5'-GATCCGATCT GACGGTTCACTAAACGAGCTCTGCTIrATATAGACCT CA-3'). Alternatively, for in vitro-translated Oct2/IE2 bind-
ACCGTCAGATCG-3') and LGH861
ing assays, the probes were prepared from wild-type immunoglobulin (Ig) octamer 30-mer oligonucleotide pair LGH49 and LGH50 (5'-GATCCTATGCTAATGAGATTCATCAG CTGA-3' and 5'-GATCTCAGCTGATGAATCTCATTAG CATAG-3') or point mutant Ig octamer oligonucleotides LGH696 and LGH697 (5'-GATCCTATGCTCCTGAGAT TCATCAGCTGA-3' and 5'-GATCTCAGCTGATGAATCT CAGGAGCATAG-3'). Labelling was accomplished by filling in the recessed ends with E. coli DNA polymerase Kienow fragment and deoxynucleoside triphosphates in the presence of [a-32P]dATP. Binding reactions with GST/IE2 fusion proteins (500 ng) and in vitro-translated IE2 or Oct2/IE2 fusion proteins were performed in 20 ,ul of binding buffer (10 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid], 50 mM KCI, 1 mM MgCl2, 0.1 mM dithiothreitol, 0.1 mM PMSF, 0.1% Triton X-100, 5% glycerol, pH 7.5) containing poly(dA-dT) poly(dA-dT), poly(dI-dC) poly(dI-dC), poly (dI). poly(dC), or salmon sperm DNA. After 15 min at 20°C or 4°C, 3 P-labelled probe DNA (20,000 cpm) was added for 30 min at 20°C, and then the mixtures were loaded onto either 4.5% nondenaturing (30:0.8 polyacrylamide-bisacrylamide) gels containing low-ionic-strength electrophoresis buffer (10 mM HEPES, 1 mM EDTA, 0.5 mM EGTA [ethylene glycol-bis(13-aminoethylether)-N,N,N',N'-tetraacetic acid], pH 7.5) or 2% agarose gels containing Tris-borate-EDTA buffer. After electrophoresis (EMSA) at 20°C, the gels were dried and autoradiographed. For antibody supershift assays, P3 or P4 rabbit antipeptide PAb antisera were added at various dilutions to the binding buffer before the probe DNA was added. When 35S-labelled samples and 32P-labelled DNA probes were used, the lower-energy 35S-labelled isotope was filtered out by interposing a blank plastic sheet between the dried gel and the X-ray film. -
RESULTS Immunoprecipitation of in vitro-translated forms of the HCMV IEl and IE2 proteins. Previous results with IE2 domain swap variants containing the VP16 acidic activator domain substituting for the N- or C-terminal IE2 activator domain have indicated that the ability to target to a heterologous promoter (such as that from the herpes simplex virus IE175 gene) requires only codons 290 to 542, whereas the ability to down-regulate requires in addition codons between 543 and 579 (36, 50a). The necessary domains within these regions could encode potential dimerization or oligomerization motifs, protein-protein interaction motifs, and, for down-regulation at least, a specific DNA-binding motif. To attempt to define some of these possibly overlapping functions, we first constructed intact versions of both IE1 and IE2 coding regions with the introns removed for use in preparing both in vitro transcription and translation products and bacterially expressed versions of the proteins. The intact IEl coding region (exons 2, 3, and 4) from a
6204
CHIOU ET AL. mm.
J. VIROL.
IE t IEl
Co-Transl.
Precip. 4-
IE2
P53
IE2
r--
+ P53
)
f--
r-
kD -
68kD
ON
a-
200
-
97
-
67
53kD
10
35kD
1
IE2/P4 PAb P53 MAb
2
3
4
5
+
+
6
7 8 9 10 11 12
+
13 14 15 16
+
+
+ + + + + + FIG. 1. Confirmation of the specificity of antibodies used for immunoprecipitation of in vitro-translated IEl and IE2 products. [35S]Met-labelled proteins were synthesized in reticulocyte extracts from template RNA transcribed in vitro with T7 or T3 polymerase from EcoRI-linearized plasmid DNA and analyzed either after immunoprecipitation with the indicated antibodies bound to protein A-Sepharose beads (lanes 1 to 12) or directly, without immunoprecipitation (lanes 13 to 16). Lanes: 1 to 3 and 13, 68-kDa IE1(1-494) from pCJC181 cleaved with EcoRI; 4 to 6 and 14, 35-kDa IE2(290579) from pGH313 cleaved with EcoRI; 7 to 9 and 15, cotranslated IEl and P53; 10 to 12 and 16, cotranslated IE2 and P53. Immunoprecipitations were carried out with either Chemicon mouse MAb against an IE1 exon 2/3 epitope (lanes 1, 4, 7, and 10), rabbit P4 PAb against IE2 exon 5 codons 550 to 560 (lanes 2, 5, 8, and 11), or mouse MAb against human P53 (lanes 3, 6, 9, and 12).
IEI
MAb +
cDNA clone was moved into a high-efficiency in vitro transcription and translation vector described previously (6). This construction yielded a prominent 35S-labelled polypeptide of approximately 68 kDa, which was immunoprecipitated with an N-terminal mouse MAb that recognizes an exon 2/3 epitope, but not by an exon 5 rabbit PAb (P4) or by a commercial anti-P53 antiserum (Fig. 1, lanes 1 to 3 and 13). A similar approach was used to prepare a shortened C-terminal form of IE2 containing exon 5 sequences from 290 to 579, which yielded a 35-kDa 35S-labelled polypeptide that was immunoprecipitated with the P4 antipeptide PAb generated against IE2 amino acids 550 to 564 but was not recognized by the other two antisera used (Fig. 1, lanes 4 to 6 and 14). To further confirm the specificity of these reagents in immunoprecipitation assays, each RNA was cotranslated along with RNA encoding the human P53 proto-oncogene (Fig. 1, lanes 15 and 16). The 35S-labelled P53 protein was selectively immunoprecipitated out of those mixtures with the P53 antiserum as a predominant 53-kDa form, together with several minor species (Fig. 1, lanes 9 and 12), whereas both IE1 (lane 7) and IE2 (lane 11) were also selectively immunoprecipitated out of the mixtures with the appropriate antisera described above. Therefore, there was no coimmunoprecipitation or cross-reaction between these two HCMV proteins and antisera, either with each other or with P53, under these conditions. Both a complete IE2 exon 5 and a fully intact form of IE2 (exons 2, 3, and 5) were also generated by adding exons 2 and 3 (codons 1 to 86) from IE1 in frame onto the front of
exon 5 (codons 86 to 579) by PCR procedures. These yielded predominant 65- and 80-kDa 35S-labelled proteins that were each immunoprecipitated by both the P1 and P4 rabbit PAb antisera (not shown). As expected, the intact 80-kDa form was also recognized by the IE1/IE2 common N-terminal IE2 MAb. Two additional N-terminal fragments of IE2 were derived from fusions of exons 2, 3, and 5 (codons 1 to 86 and 1 to 143), and C-terminal-truncated variations of intact IE2 were made by linearizing the plasmid templates with restriction enzymes that cleaved the DNA within the IE coding region, e.g., at NaeI (codon 197), XhoI (codon 290), HaeII (codon 504), BclI (codon 492), or StuI (codon 542) to yield shortened T7 polymerase-generated RNA species for in vitro translation in rabbit reticulocyte extracts (see below). Evidence for dimerization of IE2 by cross-linking assay. In initial attempts to evaluate the possibility of dimer formation by IE2, we carried out glutaraldehyde cross-linking studies similar to those that had been successfully used previously for both the EBNA-1 and Zta proteins of Epstein-Barr virus (1, 6). The results were positive for the complete exon 5 form of IE2 (codons 87 to 579) but negative for intact IE1 containing exons 2, 3, and 4 (data not shown). Similar cross-linking experiments with smaller segments of the IE2 protein are shown in Fig. 2. In vitro-translated forms of IE2 containing codons 1 to 143, 1 to 197, 87 to 290, and 290 to 579 were each labelled with 35S-methionine (Fig. 2, lanes 1, 3, 5, and 7) and then treated with glutaraldehyde directly (Fig. 2, upper panel, lanes 2, 4, 6, and 8) or with an additional immunoprecipitation step with appropriate antisera (Fig. 2, lower panel, lanes 2, 4, 6, and 8). For the first three proteins, only the correctly sized monomeric polypeptide species were recovered after SDS-PAGE. However, the 35-kDa IE2(290-579) protein (Fig. 2, open arrow) gave a second major band after cross-linking, which was also recovered after immunoprecipitation, and proved to migrate as an approximately 70-kDa species, compatible with the notion of cross-linked dimeric subunits (Fig. 2, solid arrow). Use of Oct2/IE2 fusion proteins in gel shift assays. Because we were unable to find conditions in which any of the in vitro-translated forms of IE2 bound directly to labelled DNA or oligonucleotides containing the CRS target sequence (see below), we prepared additional in vitro-translated proteins in which a series of IE2 fragments were fused downstream of the DNA-binding domain of the human Oct2 Ig gene transcription factor (9). These proteins and the parent Oct2 N-terminal fragment (codons 1 to 359) all bound efficiently to a 30-mer oligonucleotide containing the wild-type consensus ATGCAAAT target sequence. The Oct2 protein is thought to bind to its cognate DNA target as a monomer and therefore was not expected to interfere with our attempts to demonstrate heterodimer formation by gel shift assay between two different-sized cotranslated forms of the Oct2/IE2 fusion proteins. In the initial experiment, an Oct2 fusion protein containing the entire IE2(1-579) coding region was cotranslated with either an Oct2 fusion protein containing the C-terminal half of IE2 (linearized with EcoRI) or with two smaller truncated versions synthesized from RNA made from templates linearized with BclI or XhoI (Fig. 3A). The [35S]methioninelabelled proteins produced gave measured molecular masses on SDS-polyacrylamide gels of approximately 110 kDa for Oct2/IE2(1-579), 70 kDa for Oct2/IE2(266-579), 60 kDa for Oct2/IE2(266-493), and 38 kDa for Oct2/IE2(266-290) (not shown). When bound to a 32P-labelled 30-mer octamer oligonucleotide probe, the intact fusion protein yielded a very slowly migrating shifted species referred to as complex
VOL.
In Vitro Transl./X-Linking IE2(1-143] IE2(1-197]
1t +
+ + + + +
-
+
-
+
-
_~ ~ ~ Probe
OCT2/lE2 CXhol)
44
+
-
4ii-
O"
.!W
-
694 46 30
21 1
2
3
4
5
6
7
8
M
kD
FIG. 2. Evidence that IE2(290-579) forms cross-linked dimers in solution. Four different [35S]Met-labelled segments of the IE2 protein were synthesized in vitro and analyzed either directly after cross-linking with glutaraldehyde (upper panel, lanes 2, 4, 6, and 8) or after glutaraldehyde treatment followed by immunoprecipitation with a mixture of the Chemicon mouse MAb and the P2 and P4 rabbit antipeptide PAb (lower panel, lanes 2, 4, 6, and 8). In both panels, untreated input samples are shown in lanes 1, 3, 5, and 7. Lanes: 1 and 2, IE2(1-143) from pCJC184(EcoRI); 3 and 4, IE2(1197) from pCJC186(NaeI); 5 and 6, IE2(87-290) from pCJC182 (XhoI); 7 and 8, IE2(290-579) from pGH313(EcoRI); M, standard 14C-labelled protein size markers. The open and solid arrows show the monomer and expected dimer positions for IE2(290-579), respectively.
A (Fig. 3, lanes 6, 7, 12, 13, 18, and 19), whereas all three of the C-terminal forms gave much faster-migrating gel-shifted species referred to as complex B (Fig. 3, lanes 2, 3, 8, 9, 14, and 15). All three samples also contained some degraded fragments migrating at the position of DNA-bound Oct2(1359). No complexes were formed with the unprogrammed reticulocyte lysate (Fig. 3, lane 1) or with a DNA probe containing point mutations within the consensus octamer sequence element (not shown). Cotranslation of the intact IE2 fusion protein with the largest of the C-terminal fusion proteins produced a novel gel-shifted species referred to as complex AB that migrated slightly above complex B (indicated by an arrow in Fig. 3, lanes 16 and 17). Note that this apparently hybrid AB species predominated and that very little of either of the parent complexes remained. In distinct contrast, cotranslated samples in which one partner was a C-terminal-truncated form produced gel shift patterns that represented simple mixtures of the parental A and B complexes (Fig. 3, lanes 4, 5, 10, and 11). Evidently, some form of mixed-subunit DNA-binding complex results from cotranslation, but the very large dif-
+-
-
-
1-579
++
266-492
+ + 2-6-66-579
A
A
-
_ X-Link/ Imm. Prec. 200 97
ii
+
266-290
-
+
-i
"W
70 kD
< 35 kD
-
OCT2/lE2 (EcoRi)
-
X-Linking
+
OCT2/lE2 (Bcl 1) 1
+ ± + 4- + + +
IE2C87-290) 1E2(290-579)
+ + -
6205
HCMV IE2 DIMERIZATION AND DNA-BINDING DOMAINS
67, 1993
12
4 5 6 7
j
8 9 10 11 12 13
B--
V
-
AB
14 15 16 17 18 19
FIG. 3. DNA-binding complexes formed by cotranslated Oct2/ IE2 fusion proteins in gel shift assays. In vitro-translated protein mixtures were incubated with the 32P-labelled wild-type octamer oligonucleotide probe (LGH49/LGH50) and fractionated on a 4.5% polyacrylamide gel at 20°C. All samples were run in pairs with twofold differences in input protein amounts. Lanes: 1, unprogrammed reticulocyte lysate; 2 and 3, Oct2/IE2(266-290) only from pCJC187 linearized with XhoI; 4 and 5, cotranslated Oct2/IE2(266290) and Oct2/IE2(1-579); 6, 7, 12, and 13, Oct2/IE2(1-579) only from pCJC146 linearized with EcoRI; 8 and 9, Oct2/IE2(266-492) only from pCJC187 linearized with BclI; 10 and 11, cotranslated Oct2/IE2(266-492) and Oct2/IE2(1-579); 14 and 15, Oct2/IE2(266579) only from pCJC187 linearized with EcoRI; 16 and 17, cotranslation of Oct2/IE2(266-579) and Oct2/IE2(1-579); 18 and 19, Oct2/ IE2(1-579) only. A, B, and AB, positions of Oct2/IE2(1-579) DNAbound complex, Oct2/IE2(266-579) DNA-bound complex, and the novel cotranslated hetero-oligomeric complex (lanes 16 and 17), respectively.
ference in relative mobility between the two principal homodimeric forms of the Octl/IE2 fusion proteins (A and B) and the similarity in mobility between the shorter homodimer (B) and the predicted heterodimer (AB) forms complicated the interpretation. Evidence that the cotranslated AB complexes contain mixed subunits. To investigate whether the AB shifted complexes did indeed represent hybrid proteins with distinct subunits derived from both parents, we carried out two additional sets of experiments (Fig. 4). First, the Oct2/IE2(1-579) and Oct2/IE2(266-579) forms were translated alone and then mixed together for comparison with parallel cotranslated samples. Gel mobility shift assays revealed that the cotranslated samples again gave the predominant novel AB species (Fig. 4A, lanes 6 and 7), whereas the mixed samples failed to produce an AB type of complex (Fig. 4A, lanes 4 and 5). In a second experiment, the singly translated and cotranslated forms were each split into three samples, one of which was incubated with the DNA only and the other two of which were incubated with both DNA and either the N-terminal exon 2/3 MAb or the P2 exon 5 rabbit PAb. Virtually all of the presumed homo-oligomeric A complex formed by the intact Oct2/IE2(1-579) protein interacted with both the MAb to produce a new, very slowly migrating supershifted complex (referred to as SA; Fig. 4B, lane 17) and with the P2 PAb to produce a faster-migrating and apparently partially dissociated complex (referred to as DA; Fig. 4B, lane 18). As
6206
CHIOU ET AL. OCT2/1E2
A
J. VIROL.
OCT2/1E2
B
MIXTURE
++
COTRANS
4+ + + + + ++
1-579 266- 57 9
-+
--+
+
-
MAb P2 1-579 266-579
II consensus motifs, profoundly alters the structure and
++ + + + A±
COTRANS
+
+
t
mobility of the
+
+
+ + + + + + t ++
= w
" A44
A-
w
S -_
A-
Detection of IE2 dimerization by coimmunoprecipitation.
.. r *'
i
AB
AB
w w
B--
_
+. SA
W U-
I
DA
M1 Probe
2 3 4 5 6 7 8 9
10 11
2 13 1415 16 17 18
t.
FIG. 4. Evidence for formation of stabli e by Oct2/IE2 DNA-binding proteins. (A) proteins compared with cotranslated protein meric AB complexes in gel shift assays. In vsitro-translated Oct/IE2 fusion proteins were incubated with the 32P-labelled wild-type octamer DNA probe and analyzed by EMS3A as described in the legend to Fig. 3B, except that electrophores;is was carried out in a 6% polyacrylamide gel. Lanes: 1, unprogra immed reticulocyte lysate; 2 and 3, Oct2/IE2(266-579) alone from EpCJC187(EcoRI); 4 and 5, mixture of singly translated Oct2/IE2(266>-579) and Oct2/IE2(1579); 6 and 7, cotranslation of Oct2/IE2(266>-579) and Oct2/IE2(1579); 7 and 8, Oct2/IE2(1-579) alone from pCJC146(EcoRI). (B) Ability of the cotranslated Oct2/IE2 hetero-olligomeric complexes to supershift with antibody. In vitro-translated (Oct/1E2 fusion proteins were incubated with the 32P-labelled octam4 er DNA probe with or without addition of antibody and analyzed b)y EMSA as described above. Lanes: 10 to 12, Oct2/IE2(266-579) alc)ne; 13 to 15, cotranslation of Oct2/IE2(266-579) and Oct2/IE2(1-579 1); 16 to 18, Oct2/IE2(1579) alone. Lanes 10, 13, and 16 contain no anttibody; lanes 11, 14, and 17 contain Chemicon mouse MAb (epitope m apping between codons 1 and 86); and lanes 12, 15, and 18 contain ratbbit P2 antipeptide PAb (epitope mapping between codons 171 and 1834). A, B, AB, SA, and DA, positions of homo-oligomeric Oct2/IE2(1complex, hetplex, homo-oligomeric Oct2/IE2(266-579) DN ero-oligomeric DNA-bound complex, supershlifted MAb-Oct2IIE2(1579) DNA-bound complexes, and apparently dissociated PAb-Oct2/ IE2(1-579) homo-oligomeric DNA-bound connplexes, respectively. mers
Strong evidence for stable oligomerization was also obtained
by coimmunoprecipitation assays. In an initial experiment,
__________ 1
native homodimer protein, although it has little effect in the heterodimer form. The possibilities of (i) unusual stoichiometric ratios of the two subunits, (ii) the formation of higher-order oligomers with the intact Oct2/ IE2(1-579) species, or (iii) other heterologous protein-protein interactions associated with the N terminus of the IE2 A in its native state cannot be excluded, especially protein considering the apparent dissociation of complex A by the P2 antibody directed against codons 171 to 184.
mIxed-subunitoligo-
Isnablihetero oligox
5A-bound
expected, the homo-oligomeric DNA,-bound B complex (containing only exon 5 C-terminal armino acids) did not interact with either of these two antibodiies (Fig. 4B, lanes 11 and 12). In contrast, the putative he tero-oligomeric AB complex supershifted completely to the slowly migrating SA position with the exon 2/3 MAb (Fig. a4B, lane 14), but its mobility was unaffected by addition of t.he P2 PAb (Fig. 4B, lane 15). A small portion of the cotransllated product (representing all of the homodimeric A cormplex present) also interacted with both the MAb and P2 PAb antibodies to produce minor supershifted SA and disaggregated DA forms, respectively. Clearly, complex AB must contain A type subunits despite its rapid mobillity, although these apparently cannot be recognized by the P2 antibody when in a heterodimeric form. The simplest interpretation of these results would be that complex AB is a mixed-subunit heterc)dimer and that the presence of the N-terminal half of the IE2 protein, with its charged motifs, activator domain, and mtultiple casein kinase
RNA encoding the intact 80-kDa 35S-labelled in vitro-translated form of IE2(1-579) was cotranslated with four other smaller IE2 RNAs, none of which encode the exon 5 C-terminal epitope for P4 PAb recognition. The top panel in Fig. 5 shows each polypeptide either translated alone (lanes 1 to 5) or cotranslated with the intact protein (lanes 6 to 9). The bottom panel shows the same samples after immunoprecipitation with P4 antiserum. As expected, amongst the single proteins only IE2(1-579) was immunoprecipitated (Fig. 5, lane 5). However, amongst the cotranslated samples, the 33-kDa IE2(290-542) protein (Fig. 5, lane 9), but not the IE2(1-143), IE2(1-197), or IE2(87-290) proteins (Fig. 5, lanes 6 to 8), was also efficiently coprecipitated along with the IE2(1-579) form. No coprecipitation was obtained when singly translated samples of the same two proteins were mixed together rather than cotranslated (not shown; see Fig. 6). This result indicates that a true mixed-subunit stable homodimer (or oligomer) type of interaction is involved, rather than just low-affinity interactions between native fomofteptin forms of the protein. Mapping the boundaries of the IE2 dimerization domain. The results described above clearly support the idea that the C-terminal half of IE2 exists as a stable multisubunit (prob-
ably dimeric) form in solution. To define the outer limits of the interaction domain, we compared two C-terminus-truncated forms of the protein which terminated at either codon 542 or 504. The 33-kDa IE2(290-542) and 30-kDa IE2(290504) proteins were cotranslated with the 65-kDa intact exon 5 IE2(87-579) protein and immunoprecipitated with P4 PAb (Fig. 6). The input samples are shown in the left panel and the recovered immunoprecipitated products are shown in the right panel. The results clearly delineated a boundary in which amino acids beyond codon 542 are not required for coimmunoprecipitation (Fig. 6, lanes 4), whereas truncation to codon 504 abolished the dimerization interaction in vitro (Fig. 6, lanes 5). Neither truncated polypeptide was precipitated in the absence of the cotranslated tagged partner (Fig. 6, lanes 2 and 3). To identify the N-terminal boundary, a new series of IE2-derived proteins were prepared from constructions in which internal PCR primers were used to fuse IE2 C-terminal fragments in frame behind the leader-initiator region for our in vitro translation vector. Three such constructions were used to produce 35S-Met-labelled proteins that began at codon 346, 388, or 428 and terminated at codon 504, 542, or 579. These proteins were either mixed together with a previously synthesized sample of the 65-kDa IE2(87-579) protein (Fig. 7, top panel, lanes 1 to 3 and 13 and 14) or their in vitro-transcribed RNAs were cotranslated with RNA encoding the same 65-kDa protein (Fig. 7, top panel, lanes 4 to 6 and 7 to 12). The results of the coimmunoprecipitation experiments (Fig. 7, lower panel) revealed that a polypeptide initiating at codon 388 was still positive (Fig. 7, lanes 5 and
71
HCMV IE2 DIMERIZATION AND DNA-BINDING DOMAINS
VOL. 67, 1993
+
Co-Transl. + + + ++
+
+
+
kD 80
33
80
1-579
+
+
+
1-143
+
1-197 87-290 290-542
Uu * mh
65 -
ft"
la
In Vitro Transl.
1,
1.
..,
+
+
++ + + +
+
+ + +
87-579 290-542
+
290-504
+
kD
'. ..-o
=4
p4 mm. Prec
In Vitro Transl.
+
6207
_
3330-
-
-
-+M 1
2
3
4
5
M E2
65 kD
P4 Imm. Prec
1
2
3
* MEMO=
4
5 87-5 79
33 kD
2 9 0 -5 4 2
30 k.D
290-504
FIG. 6. The C-terminal boundary of the IE2 dimerization domain maps between codons 504 and 542. In vitro-transcribed RNAs were either translated singly or cotranslated in reticulocyte extracts to 33 produce [35S]Met-labelled proteins. The untreated products (left panel) and polypeptides recovered after immunoprecipitation with P4 antipeptide PAb (right panel) were subjected to SDS-PAGE. 1 2 3 4 5 6 7 8 9 Lanes: M, 14C-labelled protein size markers; 1, 2, and 3, single P4 translations of IE2(87-579) from pCJC182(EcoRI), IE2(290-542) 1-579 from pGH313(StuI), and IE2(290-504) from pGH313(HaeII), re:~~~~~~~~~~-143 spectively; 4 and 5, cotranslations of IE2(290-542) and IE2(87-579) f X and of IE2(290-504) and IE2(87-579), respectively. The solid arrow IE2 indicates the position of the 33-kDa IE2(290-542) species and the 1-19 7 star indicates the position of the 65-kDa IE2(87-579) species con87-290 taining the P4 epitope. The solid bar in the diagram indicates the inferred location of the dimerization domain, and the hatched bar 290-542 denotes the inner and outer limits of the C-terminal boundary of the FIG. 5. Evidence for IE2 dimerization obtained by coimmunodimerization domain. precipitation of in vitro-translated proteins. Segments of IE2 were labelled with [35S]Met in rabbit reticulocyte extracts by synthesis from T7 in vitro-transcribed RNA templates. Lanes 1 to 5 contain precipitated from all samples (Fig. 7, lanes 1, 4, 7, and 8). single translations and lanes 6 to 9 contain cotranslations. The upper However, both the IE2(346-542) and IE2(388-542) polypeppanel shows untreated samples after SDS polyacrylamide gel fractionation, and the lower panel shows samples incubated with rabbit tides also gave positive dimerization bands in parallel P4 P4 antipeptide PAb (epitope mapping between codons 550 and 564) coimmunoprecipitation assays (not shown). and recovered from immunoprecipitation with protein A-Sepharose Overall, the results of these experiments revealed that a beads and then subjected to SDS-polyacrylamide gel fractionation. stable IE2 homodimerization domain lies within the 155Lanes: 1, IE2(1-143) from pCJC184(EcoRI); 2, IE2(1-197) from amino-acid stretch between codons 388 and 542 and that the pCJC186(NaeI); 3, IE2(87-290) from pCJC182(XhoI); 4, IE2(290ability to dimerize is severely or totally disrupted by deletion 542) from pGH313(StuI); 5, IE2(1-579) from pCJC186(EcoRI); 6, 7, to amino acid 428 on the amino-terminal side or to 504 on the 8, and 9, cotranslations of IE2(1-143) and IE2(1-579), IE2(1-197) carboxyl-terminal side. and IE2(1-579), IE2(87-290) and IE2(1-579), and IE2(290-542) and IE2(1-579), respectively. The solid arrows indicate the position of Mapping of the minimal DNA-binding domain of IE2. In the 33-kDa IE2(290-542) species and the stars indicate the position numerous attempts to detect DNA-binding activity in gel of the 80-kDa IE2(1-579) species containing the P4 epitope. The shift assays, we have never succeeded with any of the in solid bar in the diagram indicates the inferred location of the vitro-translated versions of the HCMV IE2 protein (34a). dimerization domain. However, in contrast to the lack of success with in vitro-
9), whereas those initiating at codon 428 failed to interact efficiently (Fig. 7, lanes 6, 11, and 12). Again, when the same partners were simply mixed together rather than cotranslated, the coimmunoprecipitation did not occur (Fig. 7, lanes 2 and 14), which precludes nonspecific aggregation effects. Importantly, although cotranslated IE2(388-542) gave a positive result (Fig. 7, lane 9), cotranslated IE2(388-504) failed to do so (Fig. 7, lane 10), consistent with the C-terminal mapping data for the versions beginning at codon 290 (Fig. 6). Note that in this particular experiment, because the P3 antipeptide PAb was used, those polypeptides initiating at codon 346 (which encodes the P3 epitope) were directly
translated IE2 proteins, we have been able to demonstrate specific DNA binding in gel shift assays with bacterially expressed IE2 proteins. Both an IgG-column-purified Staph Prot-A/IE2(290-579) fusion protein (50a) and the affinitypurified GST/IE2(346-579) fusion protein described here have been used with positive results (Fig. 8 and 9). A series of N-terminus- and C-terminus-truncated GST fusion proteins were prepared in an attempt to identify the outer boundaries of the DNA-binding domain. All of these proteins were synthesized in approximately equivalent amounts in the induced E. coli bacterial hosts (Fig. 8A, top panel), and all were recovered from the crude affinity purification step in an intact stable form as measured by SDSPAGE (Fig. 8A, lower panel). Only the largest N-terminal
6208
CHIOU ET AL.
J. VIROL.
e
r.b 4' 5. .b Mixture Cotrans
,, ~(b, 6 254'+ 5O e _
+ + + + + +
+ + +
65kD-
,
#
A
+ + +
^
-
1-SWT/IE
,.
..,
.:
_
200 69 4A16
4
INPUT-T
l2f,, P3 IMM PREC
_200 97 _ 69
-
0
0
-.1-
1
2
3
4
5
6
GST/IE2
-
-
M
9 10 11 12 13 14
8
_--
46 30
-- - _
M
_
*
579
1
173qlMMVMMMV7A--l
3
B
.
IE2 .'
2
=
version tested, i.e., GST/IE2(346-579), gave a positive gelshifted complex (C) with the 32P-labelled 48-bp TATATAA/ CRS wild-type oligonucleotide probe in an EMSA experiment (Fig. 8B, lane 1), whereas GST/IE2(388-579) and all four smaller N-truncated forms tested were negative (Fig. 8B, lanes 2 to 6). Surprisingly, DNA binding could only be demonstrated with poly(dA-dT) poly(dA-dT) competitor (Fig. 8B, lanes 7 to 13) and was completely abolished at all concentrations of poly(dI-dC) poly(dI-dC) tested (Fig. 8B, lanes 15 to 21). Poly(dI) poly(dC) gave similar results to poly(dI-dC) poly(dI-dC), and salmon sperm DNA was intermediate in competitive efficiency (not shown). The partially purified GST/IE2(346-579) fusion protein also bound efficiently at either 4 or 20°C to a 30-mer wild-type oligonucleotide motif from -19 to +7 in the MIE promoter containing CRS sequences without the TATATAA consensus (Fig. 9A, lanes 2 to 5). However, no binding
-f
t-
21
B M 6 7 GST/IE2 (346-579)
polydA:dT
-
'PI a," e° Fe, FIG. 7. The N-terminal boundary of the IE2 dimerization domain maps between codons 388 and 428. In vitro-transcribed RNAs were either cotranslated or translated singly and then mixed to produce [35S]Met-labelled proteins in reticulocyte lysates. The upper panels show SDS-polyacrylamide gel fractionation of untreated samples (INPUT) and the lower panels show polypeptides recovered from immunoprecipitation with the rabbit P3 antipeptide PAb (IMM PREC). Lanes: 1 to 3, 13, and 14, mixtures with IE2(87-579) from pCJC182(EcoRI); 4 to 6 and 7 to 12, cotranslation with IE2(87-579) from pCJC182(EcoRI); 1, 4, and 7, IE2(346-542) from pCJC46(StuI); 2, 5, 9, and 14, IE2(388-542) from pCJC47(StuI); 3, 6, and 12, IE2(428-542) from pCJC48(StuI); 8, IE2(346-504) from pCJC46(HaeII); 10, IE2(388-504) from pCJC47(HaeII); 11 and 13, IE2(428-579) from pCJC48(EcoRI); M, 14C-labelled protein size markers. Arrows indicate the locations of the 33-kDa coimmunoprecipitated species (lanes 5 and 9), and stars denote the position of the 65-kDa IE2(87-579) test protein species and the map locus of the P3 epitope. Solid bars in the diagram indicate species that dimerize and show the location of the minimal core dimerization domain, open bars denote species that do not interact, and hatched bars indicate the inner and outer limits of the N-terminal and C-terminal boundaries of the dimerization domain.
5
4
-
polydl-dC -
--
c T/CRS Probe
(LGH 860/861)
48-bp
u 1
2 3
4
DOo
7
9 Iu iU i,12 13 14 lb i b IIU 19 20 21
FIG. 8. Use of bacterial GST/IE2 fusion proteins to demonstrate specific DNA-binding properties of the C terminus of IE2. Unlabelled GST/IE2 fusion proteins were prepared and partially purified from E. coli as described in Materials and Methods. (A) Relative sizes and purity of an N-terminally truncated series of GST/IE2 fusion proteins. The upper and lower panels show proteins before and after recovery from GST-Sepharose columns, respectively. The proteins were stained with Coomassie blue after electrophoresis through an SDS-4.5% polyacrylamide gel. Lanes: 1, GST/IE2(346-579) from pCJC176; 2, GST/ IE2(388-579) from pCJC177; 3, GST/IE2(428-579) from pCJC178; 4, GST/IE2(479-579) from pCJC179; 5, GST/IE2(506-579) from pCJC 170; 6, GST/IE2(530-579) from pCJC173; 7, GST/IE2(346-542) from pCJC73 (48 kDa); 8, GST/IE2(346-492/543-579) from pCJC77 (46 kDa); M, standard unlabelled protein size markers. Numbers to the right indicate molecular mass (in kilodaltons). (B) DNA-binding properties of N-terminus-truncated GST/IE2 fusion proteins detected by gel shift analysis (EMSA) and differential sensitivity of the bound complex to poly(dI-dC) poly(dI-dC) compared with poly(dA-dT) poly(dAdT) competition. The 32P-labelled DNA probe was prepared from the annealed 48-mer synthetic TATATAAA/CRS (T/CRS) oligonucleotide pair (LGH860/LGH861) containing the wild-type HCMV MIE promoter cap site. For lanes 1 to 6, binding was carried out at 20°C with 40 ,ug of poly(dA-dT) poly(dA-dT) competitor per ml, and for lanes 7 to 21, binding of GST/IE2(346-579) was carried out in the presence of various amounts of competitor. Lanes: 1, GST/IE2(346-579) from pCJC176; 2, GST/IE2(388-579) from pCJC177; 3, GST/IE2(429-579) from pCJC178; 4, GST/IE2(479-579) from pCJC179; 5, GST/IE2(506579) from pCJC170; 6, GST/IE2(530-579) from pCJC173; 7 to 13, twofold decreasing amounts of poly(dA-dT) poly(dA-dT) competitor from 320 to 5 ug/rml; 14, no competitor DNA; 15 to 21, twofold increasing amounts of poly(dI-dC) poly(dI-dC) competitor from 5 to 320 ,ug/ml. Electrophoresis was performed in an SDS-4.5% polyacrylamide gel. U, unshifted probe DNA; C, DNA-bound GST/IE2 protein complex.
HCMV IE2 DIMERIZATION AND DNA-BINDING DOMAINS
VOL. 67, 1993
A
wt CRS Probe
pm
CRS
Probe
(LGH548/549)
(LGH546-5 47) ,~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
++++
++ +
346-579 346-542
+
+
346-492
+
+
+
c
dl(492-542)
s
u 1 2 3 4 5 6 7 8
B
GST/IE2
9 10111213141516 (346-579)
occurred with an oligonucleotide that was mutated by insertion of a single additional base at position -8 in the center of the CRS palindromic motif (Fig. 9A, lanes 10 to 13). All alterations on the C-terminal side of GST/IE2(346-579) fusion proteins, either by truncation at codons 492 and 542 or by deletion between codons 493 and 542, also abolished DNA-binding activity (Fig. 9A, lanes 6, 7, 8, 14, 15, and 16). Confirmation of the presence of IE2 in the DNA-bound C complex was obtained by additional incubation with increasing amounts of the P4 rabbit PAb against codons 550 to 564, which supershifted the complex to a more slowly migrating position (SS) in an agarose gel (Fig. 9B, lanes 1 to 4). In contrast, the P3 rabbit PAb against codons 367 to 382 interfered with formation of the DNA-bound IE2 complex at the highest concentrations used, rather than producing a supershifted species (Fig. 9B, lanes 6 to 9). Therefore, our results confirm the recent report by Lang and Stamminger (20) of specific DNA-binding activity by an intact bacterially expressed IE2 protein. They also observed the selective effects of poly(dA-dT) poly(dA-dT) compared with poly(dI-dC) poly(dI-dC). However, in addition, we have demonstrated that the region upstream of codon 346 is dispensable for this activity, that the N-terminal and C-terminal boundaries for the DNA-binding domain lie between codons 346 to 388 and 543 to 579, and that the TATATAAbox region is not necessary for efficient IE2 binding to the CRS in vitro.
P3
P4
Ss
U. S.*
6209
c
-u 12 3 4 5 6 7 8 9 FIG. 9. Properties of the GST/IE2 C-terminal DNA-binding protein. The partially purified GST/IE2(346-579) DNA-binding protein from pCJC176 was used in gel shift assays (EMSA) with various 32P-labelled oligonucleotide probes covering the HCMV MIE CRS. (A) Loss of binding by a single-base-pair insertion in the CRS and by C-terminal truncation of the GST/IE2 binding protein. A comparison of binding at 4'C (lanes 2 and 4) and 20°C (lanes 3 and 5) with the GST/IE2(346-579) protein to a wild-type 30-mer CRS oligonucleotide pair (LGH546/547; lanes 2 to 8) and to an equivalent 31-mer ACRS probe containing a single extra base at position -8 (LGH548/ 549; lanes 9 to 16) is shown. Lanes: 1 and 9, no protein added; 2 to 5 and 10 to 13, GST/IE2(346-579) from pCJC176; 6 and 14, GST/ IE2(346-542) from pCJC73; 7 and 15, GST/IE2(346-492) from pCJC75; 8 and 16, GST/IE2(346-579dl493-542) from pCJC77. Electrophoresis was carried out in a 4.5% polyacrylamide gel. (B) Confirmation of the presence of IE2 in the DNA-bound complexes and different effects of P4 and P3 rabbit PAb in supershift experiments. The annealed wild-type 32P-labelled 30-mer LGH546/547 wild-type CRS oligonucleotide pair was used as a DNA probe in EMSAs carried out in a 2% agarose gel. Binding with GST/IE2(346579) protein was carried out at 20°C in the presence of 10-fold increasing amounts of antiserum. Lanes: 1 to 4, P4 rabbit PAb at 2,000-, 200-, 20-, and 2-fold dilutions; 6 to 9, P3 rabbit PAb at 2,000-, 200-, 20-, and 2-fold dilutions. U, unbound probe; C, bound GST/ IE2 complex; SS, supershifted P4 PAb-GST/IE2 complex.
DISCUSSION Lytic cycle gene expression in HCMV-infected cells is triggered by initial synthesis of the two MIE nuclear phosphoproteins called IE1 and IE2, which act in concert with several minor IE species to activate downstream promoters. IE2 on its own behaves as both a nonspecific transactivator of heterologous reporter genes (14, 35) and as a specific repressor of the MIE promoter (8, 26, 35, 37). To attempt to understand these processes, we have been interested in defining the activator, promoter targeting, DNA-binding, and protein-protein interaction domains of the 80-kDa IE2
protein (36, 50a). There is increasing evidence that the HCMV IE2 transcriptional regulator, like the ElA protein of adenovirus, may interact functionally with several or possibly even many cellular proteins. All transcriptional transactivators may do this to some degree, but the likelihood that IE2 does so appears to be increased by both its known ability to complement ElA-negative mutants of adenovirus and the wide range of heterologous viral and cellular promoters that respond to IE2 transactivation (37). IE2 has already been demonstrated to interact specifically with the C-terminal basic repeat domain of TBP (13), a feature that is shared with ElA (21), the VP16 transactivator of herpes simplex virus (25, 48), and the Zta transactivator of Epstein-Barr virus (22). ElA is also known to interact specifically with the cellular ATF-2 and RB proteins (28, 51). However, in contrast to our findings here for IE2, ElA is not known to either dimerize or have specific DNA-binding properties. In addition, the presence of two acidic activator domains in IE2 (36) makes this protein differ from ElA, which has a single zinc finger-related activator domain (24). Our experiments define a second specific protein-protein interaction by the IE2 protein, namely, an interaction with
itself to form a classical stable homodimer in solution. This feature is not unexpected now that IE2 has also been shown to bind directly to DNA through a target site that has
6210
J. VIROL.
CHIOU ET AL.
A
IE2 In Phase Splice
EXC)N- 5
EXON-2 ,EXON-31
! I
+
Hu
- 579AA
529
I 365
m
NH2
Si
H~I CO O
O
C
-UI
I
+
T
-S
+
S
583AA
-
I NLS 2 *
A ->
-
36%
B-
+
|MAb|
C -*
P1
P2
ED
n
P3
CKII
LZIL 98
P4
EJ3
136 1
D 59%
23%
52%
493
289
II
TRANSACTIV
I
AUTOREG
195
543
579
-r
_
290
579
I l_ 290
I
DIMER
388 428 TBP BINDING
I 346
388
| 504 542
504 DNA BINDING
l 542
579
FIG. 10. Mapped domains within the intact HCMV IE2 protein and conserved amino acid motifs within the C-terminus of betaherpesvirus IE2 proteins. (A) Relative map boundaries of known domains within the 579-amino-acid HCMV IE2 protein, including activation domains (solid bars); nuclear localization signals (vertical lines); MAb epitopes and P1, P2, P3, and P4 PAb epitopes (boxes); and the known minimal protein domain requirements (open bars) for transactivation and negative autoregulation (36), for TBP interaction in solution (5), and for dimerization and DNA binding as defined here. The primate CMV IE2 protein is considered to consist of four regions (A, B, C, and D) with overall amino acid similarity values between HCMV(Towne) and SCMV(Colburn) as shown. Hatched bars denote the locations of the most highly conserved short amino acid blocks (amino acid identity between 65 and 90%). Numbers 1 to 13 within exon 5 denote CMs. (B) Comparison of the predicted primary amino acid sequences within the conserved C-terminal half of the equivalent IE2 proteins from six betaherpesvirus family viruses on the basis of DNA sequence analysis. T, HCMV(Towne) sequence (7, 46, 47); S, African green monkey simian CMV (Colburn) (5a); Rh, Rhesus simian CMV (GenBank accession number M93360); M, mouse CMV(Smith) (31); R, rat CMV (39a); H, HHV-6 (33a). Identity and stringently defined similarity (K/R, D/E, Y/F/W, S/T, L/I/V/M) are denoted by colons and asterisks, respectively. CM numbers indicate individually defined conserved motifs. Open circles denote Cys and His residues within the postulated HCMV(Towne) zinc finger region between codons 399 to 485 (30, 46). The boundaries of the various deletion and truncation mutants used here are indicated above the sequences by HCMV IE2 codon numbers.
obvious palindromic features (20, 35). Precise mapping of the protein dimerization domain has added importance here because this feature will greatly complicate future efforts to define both the DNA-binding motifs of IE2 and any proteinprotein interactions which may depend upon dimerization. Note that we have not yet shown directly that IE2 binds to DNA as a dimer because of the curious inability of in vitro-translated IE2 to bind to its target site, which at present precludes the usual simple approach of demonstrating intermediate gel shift species after cotranslation of different-sized DNA-binding subunits. The same procedures that were previously successful in our laboratory with in vitro-translated Epstein-Barr virus EBNA-1 and Zta proteins (1, 6) and with the herpes simplex virus IE175 protein (38) all failed for IE2, and so also did our attempts to unmask cryptic DNAbinding activity by protease digestion and treatment with phosphatase or deoxycholate (data not shown). These experiments have involved a variety of DNA-binding conditions and gel buffers with either large 48-bp double-stranded
oligonucleotides covering positions -36 to +10 surrounding the CRS site or with smaller 30- or 23-bp oligonucleotides encompassing positions -19 to +7. We can only suggest at present that either high-affinity protein-protein interactions in the reticulocyte lysate preclude or inhibit DNA binding by the IE2 moiety itself (but not by the Oct2 domain in the fusion proteins) or that the higher protein concentrations and the absence of phosphorylation or other modifications in the bacterial versions of IE2 are critical. The actual stoichiometry of the subunits in the IE2 protein in solution have also not been determined definitively. The immunoprecipitation experiments give unambiguous evidence for the formation of stable multimeric species containing mixed subunits. Similarly, the cross-linking results support the idea of dimeric (rather than trimeric) subunit interactions, but the possibility of higher-order complexes cannot be excluded. The ability to detect IE2-IE2 interactions between admixed native bacterial GST/IE2 protein and labelled in vitro-translated IE2 proteins in Sepharose bead
HCMV IE2 DIMERIZATION AND DNA-BINDING DOMAINS
VOL. 67, 1993
B
