Identification and Validation of Reference Genes

0 downloads 0 Views 3MB Size Report
Jun 21, 2017 - Seashore Paspalum Response to Abiotic Stresses. Yu Liu 1, Jun Liu 1, Lei Xu 1, Hui Lai 1, Yu Chen 1,*, Zhimin Yang 1 and Bingru Huang 2,*.
International Journal of

Molecular Sciences Article

Identification and Validation of Reference Genes for Seashore Paspalum Response to Abiotic Stresses Yu Liu 1 , Jun Liu 1 , Lei Xu 1 , Hui Lai 1 , Yu Chen 1, *, Zhimin Yang 1 and Bingru Huang 2, * 1

2

*

College of Agro-grassland Science, Nanjing Agricultural University, Nanjing 210095, China; [email protected] (Y.L.); [email protected] (J.L.); [email protected] (L.X.); [email protected] (H.L.); [email protected] (Z.Y.) Department of Plant Biology and Pathology, Rutgers University, New Brunswick, NJ 08901, USA Correspondence: [email protected] (Y.C.); [email protected] (B.H.); Tel.: +86-025-8439-9712

Received: 19 April 2017; Accepted: 16 June 2017; Published: 21 June 2017

Abstract: Seashore paspalum (Paspalum vaginatum) is among the most salt- and cadmium-tolerant warm-season perennial grass species widely used as turf or forage. The objective of this study was to select stable reference genes for quantitative real-time polymerase chain reaction (qRT-PCR) analysis of seashore paspalum in response to four abiotic stresses. The stability of 12 potential reference genes was evaluated by four programs (geNorm, NormFinder, BestKeeper, and RefFinder). U2AF combined with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) showed stable expression in Cd-treated leaves and cold-treated roots. U2AF and FBOX were the most stable reference genes in Cd-treated roots and cold-treated leaves. In Polyethylene Glycol (PEG)- or salt-treated roots, the reference gene U2AF paired with either ACT or CYP were stable. SAND and CACS exhibited the most stability in salt-treated leaves, and combining UPL, PP2A, and EF1a was most suitable for PEG-treated leaves. The stability of U2AF and instability of UPL and TUB was validated by analyzing the expression levels of four target genes (MT2a, VP1, PIP1, and Cor413), and were shown to be capable of detecting subtle changes in expression levels of the target genes in seashore paspalum. This study demonstrated that FBOX, U2AF, and PP2A could be used in future molecular studies that aim to understand the mechanisms of abiotic stress tolerance in seashore paspalum. Keywords: seashore paspalum; quantitative real-time polymerase chain reaction (qRT-PCR); reference gene; abiotic stress

1. Introduction Quantifying the level of gene expression is a critical step for gene discovery and molecular analysis [1]. Quantitative real-time polymerase chain reaction (qRT-PCR) is commonly used and regarded as a highly effective method for measuring gene expression levels across different tissues, developmental periods, and biotic or abiotic stress conditions [2]. However, the accuracy of qRT-PCR analysis is dependent on the stability of reference genes, the quantity and purity of mRNA templates, the enzymatic efficiency in cDNA synthesis, and the efficacy of PCR amplification [3]. Among those factors, the stability of reference genes is likely a key factor in controlling the precision of qRT-PCR results. A number of reference genes have been screened from many plant species, and the specific reference genes suitable for gene expression quantification vary with plant species [4,5], as a result of their having different response mechanisms. These traditional reference genes include those associated with primary metabolism or other cellular processes, such as actin (ACT), tubulin (TUB), elongation factor 1a (EF1a), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and 18s ribosomal RNA (18S rRNA) [6,7]. However, recent studies have found that some of these commonly used reference genes present unstable expression in different plant species, tissues, or environmental conditions. For Int. J. Mol. Sci. 2017, 18, 1322; doi:10.3390/ijms18061322

www.mdpi.com/journal/ijms

Int. J. Mol. Sci. 2017, 18, 1322

2 of 14

example, ACT was unstable under salinity, drought, cold, and heat stress in Bermuda grass (Cynodon dactylon) [8] but had stable expression in Kentucky bluegrass (Poa pratensis) [4]. The expression of GAPDH and TUB in Peking willow (Salix matsudana) showed large variations under drought and salt treatments [9]. Therefore, microarray and transcriptome data were used to develop new reference genes with highly stable expression levels, such as SAND family protein (SAND), F-box/kelch-repeat protein (F-box), clathrin adapter complex subunit family protein (CACS), splicing factor (U2AF), and TIP41-like family protein (TIP41), all of which were identified in Arabidopsis thaliana [10]. Homologous genes of the new reference genes listed above were identified in other species following Basic Local Alignment Search Tool (BLAST) alignment analyses of transcriptome and EST data. Results of other studies showed that CACS of buckwheat (Fagopyrum esculentum) and cork oak (Quercus suber) and TIP41 and SAND of Caragana intermedia were demonstrated to have stable expression under different experimental conditions [11–13]. CYP and U2AF were shown to be the most stable genes in different tissues of switchgrass (Panicum virgatum) under different stress conditions [14]. The previous work strongly suggests that it is important to select suitable reference genes for different organs in specific plant species under various environmental conditions in order to accurately quantify expression levels of target genes using qRT-PCR. Seashore paspalum (Paspalum vaginatum) is a widely used forage and turfgrass species with a broad range of variability in stress tolerance genes, particularly those associated with salinity and cadmium tolerance [15]. Identification of stable reference genes under different environmental conditions is imperative for efficient molecular breeding and discovery of stress-related genes in seashore paspalum. The objective of this study was to identify stable reference genes for qRT-PCR analysis of target-gene expression levels in leaves and roots of seashore paspalum under salinity, drought, cold, and heat stress. The expression levels of four target genes (MT2a, VP1, PIP1, and Cor413) isolated from seashore paspalum were used to validate the effectiveness of the selected genes identified in the study as references. According to homolog comparison between seashore paspalum transcriptome data and Arabidopsis microarray data, 12 candidate reference genes, including the five traditional genes (EF1a, ACT, GAPDH, TUB, and UPL) and the seven new genes selected from Arabidopsis (SAND, CACS, FBOX, PP2A, CYP, U2AF, and TIP41), were examined in this study. 2. Results 2.1. Identification of PCR Amplicons, Primer Specificity, and Amplification Efficiency of qRT-PCR The names, primer sequences, and amplicon lengths of the 12 reference genes are given in Table 1. Primer specificities were confirmed by analyzing melting curve assays of qRT-PCR amplicons that produced a single peak (Figure 1). The sequences of PCR amplicons were nearly identical (97–100% in similarity) to the corresponding transcriptome data of seashore paspalum (data not shown). qRT-PCR efficiencies measured by the LinRegPCR software (Version 2012.0) for all 12 genes varied from 1.89 to 1.98 (Table 2), indicating acceptable efficiency (1.8 ≤ E ≤ 2) [16]. 2.2. Expression Levels and Variations of Reference Genes The quantification cycle (Cq) values of the 12 candidate reference genes were measured by qRT-PCR analysis and ranged from 18 to 32 (Figure 2), with the lower Cq values showing higher mRNA transcript levels. Variations in each reference gene are exhibited in the box plot (Figure 1). Among the 12 candidate reference genes, UBL had the lowest expression level with a mean Cq of 29.6, while GAPDH showed the highest expression level with a mean Cq of 20.1 (Figure 2). The coefficients of variation (lower values represent higher variability) of the 12 reference genes were 3.75% (FBOX), 3.96% (U2AF), 4.15% (ACT), 4.42% (TIP41), 5.25% (CACS), 5.31% (SAND), 5.37% (TUB), 5.40% (PP2A), 5.42% (GAPDH), 5.46% (UBL), 5.79% (CYP), and 6.65% (EF1α).

Int. J. Mol. Sci. 2017, 18, 1322

3 of 14

Table 1. Reference genes and primer sequences. Gene Symbol

Gene Name

GenBank Accession

Arabidopsis Homolog Locus

EF1a CACS GAPDH TIP41 SAND ACT TUB PP2A FBOX UPL CYP U2AF MT2a VP1 PIP1 Cor413

Elongation factor 1a Clathrin adaptor complex subunit Glyceraldehyde 3-phosphate dehydrogenase TIP41-like family protein SAND family protein Actin 7 Alpha Tubulin Protein phosphatase 2A F-box/kelch-repeat protein E3 ubiquitin protein ligase Cyclophilin Splicing factor U2af Metallothionein2a vacuolar H+ -pyrophosphatase 1 plasma membrane intrinsic protein 1 cold-regulated 413 plasma membrane protein

KU049721 KX268090 KX268091 KX268092 KX268093 KX268094 KX268095 KX268096 KX268097 KX268098 KX268099 KX268100 KX268101 KX268102 KX268103 KX268104

AT5G60390 AT5G46630 AT1G13440 AT4G34270 AT2G28390 AT5G09810 AT5G19780 AT1G13320 AT5G15710 AT3G53090 AT2G29960 AT5G42820 AT3G09390 AT1G15690 AT4G00430 AT3G50830

Amplicon Length (bp)

50 -Primer Sequences (Forward/Reverse)-30 GCGGACTGTGCTGTGCTTATC/AGTGGTGGCATCCATCTTGTT CACTGTCGAGTGGGTTCGCTAC/GCCGATGAATTTTACTTGTTGC GTCGCATGGTACGACAACGAGT/ACGGAAAACAAAAGGCAACTCA TGATGAGATTGAGGGATACTCG/TACAGACGGTGGTCACCTTTGG CGGGGATTATGTTCTATTTTGC/TTATGGTACTGCCTGTGTCGGT CTTCTCTCAGCACTTTCCAACA/AAACATAACCTGCAATCTCTCC GTCGGTGAGGGTATGGAGGAAG/ATGGAAACACACAGCAGCAGTT TAAGGTACTACGCAAACCAAGC/CAACACAATACATACACAGCACACA GTGCTAGCCAGCTCTGCAATAG/ACACATCCGACATCAACGATTC TACTTGGATTCAAATACCTACAGCC/TTAGAACCCCAGAAACACCGCT CTGGAAGAGATACAAACGGATC/GCCACTAATGACAGTTATAGAACG AGGAGCCCAGTCAGGGAAA/CACGCAGAATAGCAACTCAAAT CAGACTCTCGTCATGGGCGT/TCTCATCGGATCAGGTAGCA GTCCCTCAACATCCTCATCAAG/TAAGTCTAAGGTAACGCCTCCA AGGGCCATCCCGTTCAAGAG/ATAACAGCGGCGGCATATTA TCAGGAACGCCTTCAGGAAG/GGATGGCAGAGGAGCACACT

153 109 221 244 266 162 237 289 184 250 275 190 247 281 239 134

Table 2. Amplification efficiency of qRT-PCR for 12 reference genes. Gene

CdL

CdR

PL

PR

SL

SR

CL

CR

ACT CACS EF1α FBOX GADPH UPL SAND TUB TIP41 CYP PP2A U2AF

1.93 ± 0.01 1.94 ± 0.02 1.98 ± 0.01 1.93 ± 0.02 1.91 ± 0.02 1.93 ± 0.02 1.94 ± 0.02 1.96 ± 0.01 1.96 ± 0.02 1.93 ± 0.02 1.95 ± 0.02 1.96 ± 0.01

1.96 ± 0.03 1.97 ± 0.02 1.93 ± 0.01 1.94 ± 0.03 1.95 ± 0.02 1.95 ± 0.02 1.95 ± 0.02 1.95 ± 0.01 1.91 ± 0.02 1.94 ± 0.01 1.96 ± 0.02 1.93 ± 0.01

1.95 ± 0.02 1.93 ± 0.02 1.96 ± 0.03 1.97 ± 0.03 1.93 ± 0.02 1.95 ± 0.03 1.94 ± 0.01 1.94 ± 0.02 1.90 ± 0.02 1.94 ± 0.01 1.95 ± 0.02 1.89 ± 0.02

1.93 ± 0.02 1.92 ± 0.02 1.93 ± 0.01 1.96 ± 0.02 1.96 ± 0.02 1.97 ± 0.02 1.96 ± 0.03 1.97 ± 0.02 1.91 ± 0.02 1.96 ± 0.03 1.96 ± 0.02 1.92 ± 0.02

1.97 ± 0.02 1.96 ± 0.02 1.94 ± 0.04 1.95 ± 0.02 1.92 ± 0.02 1.95 ± 0.03 1.93 ± 0.01 1.94 ± 0.03 1.95 ± 0.02 1.93 ± 0.01 1.93 ± 0.03 1.94 ± 0.02

1.92 ± 0.02 1.96 ± 0.01 1.94 ± 0.02 1.93 ± 0.02 1.94 ± 0.03 1.92 ± 0.02 1.95 ± 0.02 1.96 ± 0.03 1.90 ± 0.03 1.95 ± 0.02 1.97 ± 0.03 1.91 ± 0.03

1.95 ± 0.03 1.92 ± 0.02 1.96 ± 0.02 1.94 ± 0.02 1.91 ± 0.02 1.94 ± 0.03 1.94 ± 0.02 1.95 ± 0.03 1.93 ± 0.03 1.94 ± 0.02 1.89 ± 0.03 1.91 ± 0.02

1.94 ± 0.01 1.97 ± 0.02 1.95 ± 0.03 1.93 ± 0.02 1.97 ± 0.02 1.93 ± 0.03 1.96 ± 0.01 1.97 ± 0.02 1.91 ± 0.02 1.96 ± 0.01 1.96 ± 0.02 1.92 ± 0.01

CdL and CdR: cadmium-treated leaves and roots, respectively; PL and PR: PEG-treated leaves and roots, respectively; SL and SR: salt-treated leaves and roots, respectively; CL and CR: cold-treated leaves and roots, respectively.

Int. Int. J.J. Mol. Mol. Sci. Sci. 2017, 2017, 18, 18, 1322 1322

4 of 14

Int. J. Mol. Sci. 2017, 18, 1322

Figure1.1.Primer Primer specificity. Melting Melting curves of 12 genes (EF1αa, CACS, GAPDH, TIP41, SAND, ACT, Figure Figure 1. Primer specificity. specificity. Melting curves curves of of 12 12 genes genes (EF1αa, (EF1αa, CACS, CACS, GAPDH, GAPDH, TIP41, TIP41, SAND, SAND, ACT, ACT, TUB, PP2A, FBOX, UPL, CYP, and U2AF) showing single peaks. TUB, PP2A, FBOX, UPL, CYP, and U2AF) showing single peaks. TUB, PP2A, FBOX, UPL, CYP, and U2AF) showing single peaks.

Figure 2. The quantification cycle (Cq) values of the 12 candidate reference genes across all samples Figure 2.four Theabiotic quantification cycle (Cq) values of the the 12 of candidate reference genes across samples under2. stresses. cycle Lines(Cq) across the of box plot Cq value represent the median values. Figure The quantification values 12 candidate reference genes across all all samples ththe th percentile. under four abiotic stresses. Lines across box plot of Cq value represent the median values. Lower Lower and upper boxes show the 25 percentile to the 75 Whiskers represent the under four abiotic stresses. Lines across the box plot of Cq value represent the median values. th percentile to the 75th percentile. Whiskers represent the maximum and and upper boxes show the 25 maximum and minimum values. Lower and upper boxes show the 25th percentile to the 75th percentile. Whiskers represent the minimum values. maximum and minimum values.

2.3. Stability of Candidate Reference Genes

2.3. Stability Stability of of Candidate Candidate Reference Reference Genes Genes 2.3. 2.3.1. geNorm Analysis The M values calculated by geNorm software (V3.5, Ghent, Belgium), were applied to evaluate 2.3.1. geNorm Analysis the stability of reference genes by comparing the average variation of a gene to all others. The M The M values calculated by geNorm software (V3.5, Ghent, Belgium), were applied to evaluate value of 1.5 was used as a threshold for expression stability, and M values lower than 1.5 indicated the stability of reference genes by comparing the average variation of a gene to all all others. others. The M value of 1.5 was used as a threshold for expression stability, and M values lower than 1.5 indicated

Int. J. Mol. Sci. 2017, 18, 1322

5 of 14

Int. J. Mol. Sci. 2017, 18, 1322

value of 1.5 was used as a threshold for expression stability, and M values lower than 1.5 indicated higher higher stability. stability. Based Based on on this this principle, principle, itit was was determined determined that that out out of of all all samples, samples, ACT ACT and and FBOX FBOX from both leaf and root tissues had the same M values and were the two most stable reference from both leaf and root tissues had the same M values and were the two most stable reference genes genes alltreatments. stress treatments. Similarly, of genes reference were including evaluated,TIP41/UPL including for all for stress Similarly, stabilitiesstabilities of reference weregenes evaluated, TIP41/UPL in cadmium-treated leaves (CdL), FBOX/U2AF in cadmium-treated roots (CdR), in cadmium-treated leaves (CdL), FBOX/U2AF in cadmium-treated roots (CdR), PP2A/SAND in PP2A/SAND in PEG-treated leaves (PL), ACT/U2AF in PEG-treated roots (PR), CACS/EF1a in PEG-treated leaves (PL), ACT/U2AF in PEG-treated roots (PR), CACS/EF1a in salt-treated leaves (SL), salt-treated leaves (SL), CYP/TUB in SAND/U2AF salt-treated roots (SR), SAND/U2AF in cold-treated leaves (CL), CYP/TUB in salt-treated roots (SR), in cold-treated leaves (CL), and GAPDH/U2AF in and GAPDH/U2AF in cold-treated roots (CR) (Figure 3). cold-treated roots (CR) (Figure 3).

Figure 3. 3. Gene Gene expression expression stability stability values values (M) (M) and and rankings rankings of of 12 12 reference reference genes genes as as assayed assayed by by Figure geNorm. The most stable genes are on the left and the least stable genes are on the right. geNorm. The most stable genes are on the left and the least stable genes are on the right.

The The geNorm geNorm program program is is typically typically used used for for determining determining the the optimal optimal number number of of reference reference genes genes required for accurate normalization. When a small variation appears between V n/n+1 and V n+1 /V n+2 n+2 or required normalization. When a small variation appears between V n/n+1 and Vn+1 /V the Vn/n+1 valuevalue is lower thanthan the the threshold of 0.15, thethe value (n)(n)can or the V n/n+1 is lower threshold of 0.15, value canbebeconsidered consideredas asthe the optimal optimal number V2/3 values for the CdR,CdR, PR, SL, samples were lower number of ofreference referencegenes. genes.The The V2/3 values for CdL, the CdL, PR,SR, SL,and SR,CR and CR samples were than 0.15 (Figure 4), indicating that two reference genes were suitable for normalization. Three lower than 0.15 (Figure 4), indicating that two reference genes were suitable for normalization. Three reference 3/4 values reference genes were selected after the V3/4 valuesof ofPL PLand andCL CLsamples sampleswere wereindicated indicated to to be be below below 0.15. The V4/5 value (0.145) of all samples showed that four genes could be useful for normalization of all the samples.

Int. J. Mol. Sci. 2017, 18, 1322

6 of 14

0.15. The V4/5 value (0.145) of all samples showed that four genes could be useful for normalization of all the Int.samples. J. Mol. Sci. 2017, 18, 1322

Figure 4. Pairwise variation (V) of the candidate reference genes calculated by geNorm. Vn/Vn+1

Figure 4. Pairwise variation (V) of the candidate reference genes calculated by geNorm. Vn /Vn+1 values were used to determine the optimal number of reference genes. values were used to determine the optimal number of reference genes.

2.3.2. NormFinder Analysis

2.3.2. NormFinder Analysis

Evaluation values detected by NormFinder (V0953, Aarhus, Denmark) are shown in Table 3, with lower values stability. Among allAarhus, samples,Denmark) the four reference genes Evaluation valuesindicating detected higher by NormFinder (V0953, are shown in with Tablethe 3, with overall were FBOX (0.519), ACT (0.604), U2AF (0.67)reference and PP2A (0.673) (Table lowerhighest valuesstability indicating higher stability. Among all samples, the four genes with the 3). highest U2AF and GAPDH were (0.519), identified as the two most in CdL(0.673) and PR(Table samples, while and stability overall were FBOX ACT (0.604), U2AFstable (0.67)genes and PP2A 3). U2AF U2AF and FBOX were ranked as having the highest stability in CdR and SR samples. UPL or SAND GAPDH were identified as the two most stable genes in CdL and PR samples, while U2AF and FBOX was the most stable gene in PL and SL samples. U2AF had the highest stability in CL and CR were ranked as having the highest stability in CdR and SR samples. UPL or SAND was the most stable samples. TUB and UPL had the lowest stability rankings out of all samples except for PL.

gene in PL and SL samples. U2AF had the highest stability in CL and CR samples. TUB and UPL had the lowest stability rankings 2.3.3. BestKeeper Analysis out of all samples except for PL. The rankings of reference genes based on CV and SD values by BestKeeper (Version1.0, 2.3.3. BestKeeper Analysis

Munich, Germany) analysis are shown in Table 4, with lower SD and CV representing higher

The rankings reference genes based on CV stability and SD of values BestKeeper (Version1.0, Munich, stability. FBOXofand U2AF exhibited the highest CdL, by CdR, and PR samples. The most stable analysis genes were andinCACS and CR samples, and ACT forhigher SR samples, PP2A Germany) areFBOX shown Tablefor 4, CL with lower SD and U2AF CV representing stability. FBOX and ACT for SL samples, and UPL and TUB for PLCdR, samples. and U2AF exhibited the highest stability of CdL, and PR samples. The most stable genes were FBOX and CACS for CL and CR samples, U2AF and ACT for SR samples, PP2A and ACT for SL 2.3.4. RefFinder Analysis samples, and UPL and TUB for PL samples. RefFinder (Version 1.0), available online: http://www.leonxie.com/referencegene.php) analysis

2.3.4.was RefFinder Analysis performed to obtain a comprehensive evaluation of candidate reference genes by integrating three common analysis programs (geNorm, Normfinder, and BestKeeper) and the ΔCq method.

RefFinder (Version 1.0), available online: http://www.leonxie.com/referencegene.php) analysis According to the analysis of RefFinder and geNorm (Table 5), the four most stable genes for all was performed to obtain comprehensive evaluation of candidate reference by integrating samples were FBOX, aACT, U2AF and PP2A, while UPL was the least stable genes reference gene. U2AF three common analysis (geNorm, and BestKeeper) and the According combined withprograms different genes couldNormfinder, be used as reference genes for CdL, CdR,∆Cq PR, method. SR, CL, and CR to thesamples. analysisUPL, of RefFinder geNorm 5), and the four most forsamples all samples PP2A, andand EF1a from PL(Table samples SAND andstable CACS genes from SL were were suitable genes, while UPL presented unstable expression in total samples that included with FBOX, ACT, reference U2AF and PP2A, while UPL was the least stable reference gene. U2AF combined CdR, PR, SR, and CR. different genes could be used as reference genes for CdL, CdR, PR, SR, CL, and CR samples. UPL, PP2A, and EF1a from PL samples and SAND and CACS from SL samples were suitable reference genes, while UPL presented unstable expression in total samples that included CdR, PR, SR, and CR.

Int. J. Mol. Sci. 2017, 18, 1322

7 of 14

Table 3. Stability analysis of reference genes assayed by NormFinder software. Total FBOX ACT U2AF PP2A TIP41 CYP GAPDH CACS SAND TUB EF1α UPL

Stability CdL 0.519 0.604 0.67 0.673 0.703 0.773 0.778 0.811 0.963 1.073 1.131 1.496

Stability CdR

U2AF GAPDH ACT UPL PP2A SAND TIP41 CYP FBOX CACS TUB EF1α

0.374 0.444 0.471 0.506 0.529 0.53 0.594 0.606 0.619 0.689 0.747 0.833

Stability

U2AF FBOX TIP41 EF1α GAPDH CYP TUB ACT SAND CACS PP2A UPL

0.223 0.37 0.376 0.441 0.474 0.478 0.484 0.519 0.527 0.553 0.815 1.163

PL

Stability

UPL PP2A EF1α SAND TUB FBOX CACS ACT U2AF GAPDH TIP41 CYP

0.391 0.402 0.466 0.474 0.563 0.583 0.618 0.638 0.724 0.857 0.953 1.09

PR

Stability

U2AF GAPDH EF1α FBOX TIP41 ACT CYP CACS TUB PP2A SAND UPL

0.392 0.397 0.522 0.535 0.55 0.592 0.687 0.687 0.689 0.73 0.999 1.612

SL

Stability

SAND CACS TUB PP2A EF1α FBOX CYP ACT UPL TIP41 U2AF GAPDH

0.461 0.54 0.594 0.618 0.669 0.674 0.738 0.755 0.775 0.9 0.948 1.042

SR

Stability

U2AF FBOX CYP TUB TIP41 CACS GAPDH EF1α ACT PP2A SAND UPL

0.383 0.455 0.512 0.519 0.553 0.562 0.656 0.657 0.681 0.769 1.059 1.355

CL U2AF PP2A FBOX GAPDH CYP SAND ACT TIP41 EF1α CACS UPL TUB

Stability 0.326 0.392 0.443 0.48 0.529 0.535 0.577 0.651 0.755 0.776 0.886 1.497

CR U2AF TIP41 GAPDH CYP TUB FBOX ACT CACS PP2A EF1α SAND UPL

Stability 0.294 0.458 0.465 0.525 0.528 0.555 0.555 0.589 0.694 0.869 1.036 1.154

Total: pooled samples from all treatments; CdL and CdR: cadmium-treated leaves and roots, respectively; PL and PR: PEG-treated leaves and roots, respectively; SL and SR: salt-treated leaves and roots, respectively; CL and CR: cold-treated leaves and roots, respectively.

Table 4. Stability analysis of reference genes assayed by BestKeeper software. Rank 1 2 3 4 5 6 7 8 9 10 11 12

Total

CV ± SD

FBOX U2AF ACT TIP41 SAND UPL GAPDH PP2A CACS TUB CYP EF1α

2.95 ± 0.80 3.15 ± 0.79 3.39 ± 0.68 3.67 ± 1.04 3.77 ± 0.99 4.10 ± 1.22 4.18 ± 0.84 4.32 ± 0.97 4.50 ± 1.07 4.70 ± 1.08 4.74 ± 1.06 5.74 ± 1.18

CdL FBOX U2AF UPL CACS SAND ACT GAPDH PP2A CYP TIP41 TUB EF1α

CV ± SD 1.61 ± 0.44 1.73 ± 0.44 1.85 ± 0.54 1.89 ± 0.47 1.92 ± 0.50 1.97 ± 0.40 2.02 ± 0.40 2.04 ± 0.46 2.17 ± 0.49 2.54 ± 0.72 2.7 ± 0.66 3.22 ± 0.69

CdR FBOX U2AF TUB GAPDH TIP41 CACS ACT PP2A EF1α CYP SAND UPL

CV ± SD 1.36 ± 0.35 1.58 ± 0.38 1.96 ± 0.42 2.02 ± 0.39 2.04 ± 0.56 2019 ± 0.49 2.44 ± 0.47 2.46 ± 0.52 2.54 ± 0.49 2.60 ± 0.54 2.65 ± 0.67 3.04 ± 0.89

PL UPL TUB FBOX EF1α SAND U2AF CACS PP2A ACT GAPDH TIP41 CYP

CV ± SD 1.42 ± 0.41 1.51 ± 0.36 1.52 ± 0.41 1.86 ± 0.41 1.92 ± 0.49 1.95 ± 0.49 2.04 ± 0.49 2.10 ± 0.47 2.36 ± 0.48 3.41 ± 0.69 3.58 ± 1.01 3.89 ± 0.90

PR U2AF FBOX CACS ACT TUB TIP41 EF1α GAPDH CYP PP2A UPL SAND

CV ± SD 2.62 ± 0.67 3.67 ± 1.03 3.75 ± 0.91 3.79 ± 0.79 3.81 ± 0.89 4.02 ± 1.17 4.17 ± 0.85 4.20 ± 0.90 4.83 ± 1.12 4.89 ± 1.16 5.33 ± 1.67 5.42 ± 1.49

SL PP2A ACT CYP TUB CACS EF1α FBOX SAND TIP41 GAPDH UPL U2AF

CV ± SD 2.43 ± 0.54 2.62 ± 0.53 3.63 ± 0.81 2.00 ± 0.48 2.84 ± 0.69 3.46 ± 0.74 1.55 ± 0.42 1.80 ± 0.47 3.45 ± 0.96 4.66 ± 0.92 2.39 ± 0.68 2.89 ± 0.75

SR U2AF ACT PP2A FBOX CACS TUB EF1α CYP TIP41 SAND GAPDH UPL

CV ± SD 2.28 ± 0.55 2.44 ± 0.47 2.49 ± 0.53 2.54 ± 0.67 2.56 ± 0.58 2.75 ± 0.61 2.75 ± 0.53 2.86 ± 0.60 3.44 ± 0.95 3.83 ± 0.99 4.03 ± 0.79 4.08 ± 1.22

CL FBOX CACS U2AF PP2A TIP41 CYP EF1α ACT SAND GAPDH UPL TUB

CV ± SD 1.89 ± 0.52 1.92 ± 0.48 1.95 ± 0.51 2.15 ± 0.50 2.32 ± 0.67 2.33 ± 0.55 2.47 ± 0.54 2.56 ± 0.52 2.58 ± 0.68 2.96 ± 0.59 3.09 ± 0.90 4.21 ± 0.97

CR FBOX CACS EF1α TUB U2AF ACT GAPDH TIP41 CYP UPL PP2A SAND

CV ± SD 1.09 ± 0.28 1.62 ± 0.37 1.88 ± 0.35 2.13 ± 0.46 2.32 ± 0.58 2.47 ± 0.48 2.78 ± 0.56 2.85 ± 0.79 3.13 ± 0.67 3.35 ± 1.01 3.63 ± 0.81 4.47 ± 1.17

Total: pooled samples from all treatments; CdL and CdR: cadmium-treated leaves and roots, respectively; PL and PR: PEG-treated leaves and roots, respectively; SL and SR: salt-treated leaves and roots, respectively; CL and CR: cold-treated leaves and roots, respectively.

Int. J. Mol. Sci. 2017, 18, 1322

8 of 14

Table 5. Most stable and least stable combination of reference genes based on RefFinder analysis. Experimental Treatments Total Most FBOX ACT U2AF PP2A

Least UPL

CdL Most U2AF GAPDH

Least EF1a

CdR Most U2AF FBOX

Least UPL

PL Most UPL PP2A EF1a

PR Least CYP

Most U2AF ACT

SL Least UPL

Most SAND CACS

SR Least Most GAPDH U2AF CYP

CL Least UPL

Most U2AF PP2A FBOX

CR Least TUB

Most U2AF GAPDH

Least UPL

Int. J. Mol. Sci. Sci. 2017, 2017, 18, 18, 1322 1322

9 of 14

2.4. Detection of Four Target Gene Expression Levels Normalized by Screened Reference Genes 2.4. Detection of Four Target Gene Expression Levels Normalized by Screened Reference Genes To confirm the utility of the reference genes, the expression patterns of four target genes were To confirm of the reference genes, the expression patterns of four target genes were detected (Figurethe 5), utility including MT2a in cadmium-treated roots (CdR) samples, PIP1 in PEG-treated detected (Figure 5), including MT2a in cadmium-treated roots (CdR) samples, PIP1 in PEG-treated roots (PR) samples, VP1 in salt-treated roots (SR) samples, and Cor413 in cold-treated leaves (CL) roots (PR)The samples, salt-treated roots (SR) samples, Cor413genes, in cold-treated (CL) samples. most VP1 stablein reference gene, U2AF, and two and unstable UPL and leaves TUB, were samples. The most stable reference gene, U2AF, and two unstable genes, UPL and TUB, were selected selected for qRT-PCR analysis out of the four samples, and the results exhibited significant for qRT-PCRinanalysis out of the four samples,timing and the(Figure results 5). exhibited fold differences fold changes and response Undersignificant cadmium differences treatment, inMT2a changes andnormalized response timing (Figure 5). Under cadmium treatment, normalized by expression by U2AF exhibited a 20-fold increase afterMT2a 3 h, expression but showed a three-fold U2AF exhibited a 20-fold increase after 3 h, but showed a three-fold increase when normalized by UPL. increase when normalized by UPL. The expression of PIP1 was highest at 6 h when controlled by The expression of PIP1but wasreached highestthe at 6same h when controlled by reference but reached the reference gene U2AF level of expression at 3 h gene whenU2AF normalized by UPL. same level of expression 3 h found when normalized Similar differences also found SR Similar differences wereatalso in SR and by CLUPL. samples. These results were demonstrate thatin the and CL samples. These results demonstrate that the accuracy of qRT-PCR analysis could be altered by accuracy of qRT-PCR analysis could be altered by the use of different reference genes. the use of different reference genes.

Figure 5. Relative expression expression of of four four target (A) MT2a MT2a expression expression detection detection normalized normalized by by Figure 5. Relative target genes. genes. (A) reference genes U2AF and UPL; (B) PIP1 expression detection normalized by reference genes U2AF reference genes U2AF and UPL; (B) PIP1 expression detection normalized by reference genes U2AF and UPL; detection normalized normalized by by reference reference genes genes U2AF U2AF and and UPL; UPL; (D) and UPL; (C) (C) VP1 VP1 expression expression detection (D) Cor413 Cor413 expression detection normalized by reference genes U2AF and TUB. expression detection normalized by reference genes U2AF and TUB.

3. Discussion Discussion 3. Previous studies studies have have shown shown that that there there is is no no single single reference reference gene gene that that can can be be used Previous used for for the the quantification of target gene expression levels for all experimental conditions or plant species. quantification of target gene expression levels for all experimental conditions or plant species. Reference genes genes have have been been identified for several grass species, species, including including Poa Poa pratensis pratensis [4], [4], Reference identified for several perennial perennial grass Cynodon dactylon [8], [8], Lolium perenne [17], virgatum [14], [14], Agrostis [18], and Cynodon dactylon Lolium perenne [17], Panicum Panicum virgatum Agrostis stolonifera stolonifera [18], and Festuca Festuca arundinacea [19]. This study is the first to identify several reference genes suitable for qRT-PCR arundinacea [19]. This study is the first to identify several reference genes suitable for qRT-PCR normalization in and roots of seashore paspalum exposed to fourto abiotic normalization inboth bothleaves leaves and roots of seashore paspalum exposed four stresses abiotic (salinity, stresses heavy metal cadmium, drought, and cold). (salinity, heavy metal cadmium, drought, and cold). In previous geNorm, NormFinder, and BestKeeper, produced different results, because In previousstudies, studies, geNorm, NormFinder, and BestKeeper, produced different results, each of the three software have different calculation methods [8,18]. RefFinder, a because each of the three software have different calculation methods [8,18].comprehensive RefFinder, a program that integrates geNorm, BestKeeper and the ∆Cq method, is used comprehensive programdata that from integrates dataNormfinder, from geNorm, Normfinder, BestKeeper and the ΔCq method, is used to screen reference genes and obtain an accurate evaluation [8,13,18]. By

Int. J. Mol. Sci. 2017, 18, 1322

10 of 14

to screen reference genes and obtain an accurate evaluation [8,13,18]. By interpreting results from four commonly used methods (GeNorm, NormFinder, BestKeeper, and RefFinder), several stable reference genes under different conditions in seashore paspalum were identified in this study. U2AF was reported to serve as a stable reference gene associated with nematode inoculation in Pinus massoniana [20]; however, its use as a stable reference gene for abiotic stresses has not yet been reported. The current study found that U2AF showed stable expression in most samples with the exception of leaves under salinity and drought stress in seashore paspalum. FBOX was used as a stable reference gene for the normalization of cold-stressed or salicylic acid-treated rapeseed (Brassica napus) and for different tissues, organs, and developmental stages of aromatic litsea (Litsea cubeba) [21,22], as well as for cadmium-stressed soybean (Glycine max) samples [23]. By contrast, FBOX exhibited unstable expression in large leaf gentian (Gentiana macrophylla) leaves and roots in response to silver and copper stress [24]. FBOX was the most stable reference gene for total samples, cadmium-treated roots, and cold-treated leaves in this study. The expression levels of PP2A and CACS in Bermuda grass were stable in roots and leaves under salt stress, in leaves under drought stress, and in roots exposed to cold and heat stress [8]. In previous studies on PEG-treated roots of buckwheat and C. intermedia, SAND was identified as having the most stable expression following abiotic stress [11,13]. The current study indicated that SAND and CACS in salt-treated leaves and PP2A in PEG- and cold-treated leaves exhibited stable expression. It is particularly interesting to note that several reference genes exhibited differential expression patterns in seashore paspalum with respect to other grass species under same types of abiotic stresses. It was previously reported that UPL was the most stable reference gene in salt-treated roots and cold-treated roots of Bermuda grass and creeping bentgrass [8,18]; however, UPL exhibited the most unstable expression in salt-treated roots and cold-treated roots of seashore paspalum in this study. Several other widely used reference genes, including TUB, GAPDH, and EF1α, have been utilized for gene expression normalization in different plant species, but expression patterns in different species under different environmental conditions are variable [12,13,23]. EF1α and TUB showed the most stable expression under salinity and drought stress in soybean and black gram (Vigna mungo) [25,26] and under cold treatment in desert poplar (Populus euphratica) [27]. In this study, however, stabilities of EF1α and TUB were lower than those of several other reference genes under the four abiotic stresses. GAPDH was a more stable reference gene for PEG-treated leaves of buffalo grass (Buchloe dactyloides) [28], but it exhibited unstable expression in rice (Oryza sativa) under various environmental conditions [29]. In the current study, GAPDH showed stable expression in cadmium-treated leaves but unstable expression in salt-treated leaves. The results from this study, when compared to those produced previously by others, suggest that unique reference genes should be used for the accurate quantification of gene expression in seashore paspalum. Expression levels of target genes were found to vary significantly when normalized using stable and unstable reference genes, which led to misinterpretation of experimental results. In this study, stabilities of reference genes were further validated by examining the expression patterns of four target genes. The results showed that expression patterns of the target genes in response to cadmium, salt, drought, and cold stress were variable due to the use of different references genes, indicating the importance of internal control genes for qRT-PCR analysis. The stable reference genes identified and validated in this study have provided accurate qRT-PCR results that may be used for target gene expression of seashore paspalum under different abiotic stresses in the future. Findings from this study will help facilitate the identification of stress-responsive genes and molecular mechanisms conferring stress tolerance to seashore paspalum in future work. The current results furthermore provide suitable resources for qRT-PCR analysis in other species closely related to seashore paspalum.

Int. J. Mol. Sci. 2017, 18, 1322

11 of 14

4. Materials and Methods 4.1. Plant Materials and Stress Treatments Seashore paspalum (cv. ‘SeaIsle 2000’) was collected from field plots located at the Grass Research Centre of Nanjing Agricultural University in Nanjing, China. Stolons measuring 4–5 cm in length and having two nodes were hydroponically cultivated for 10 days in half strength Hoagland’s nutrient solution in a controlled-climate growth chamber (MT8070iE, shoreline Technology, Xubang, Jinan, China) with 12 h photoperiod (850 µmol photons m−2 ·s−1 ), 28/25 ◦ C (day/night) and 60% relative humidity. Seedlings were transferred to nutrient solution containing 250 mM NaCl for salinity treatment, 1 mM cadmium for heavy metal treatment, or 20% PEG6000 for drought treatment. Cold stress was imposed at 3 ◦ C in an incubator (Haier, Qingdao, China). Each treatment was performed using three biological replicates having three plants in each replicate. Leaves and roots were separately collected at 0, 1, 3, 6, 12, and 24 h of each treatment, and the tissue was immediately frozen in liquid nitrogen and stored at −80 ◦ C for further analysis. 4.2. Total RNA Isolation and cDNA Synthesis Total RNA was isolated according to the RNAiso kit (TaKaRa, Dalian, China) and was then treated with RNase-free DNaseI (TaKaRa). RNA concentration was detected spectrophotometrically (NanoDrop 2000, Thermo, Waltham, MA, USA) at wavelengths of 230, 260, and 280 nm, and the 260/280 nm ratio within the range of 1.80–2.20 and 260/230 nm ratio at approximately 2.00 were obtained. First-strand cDNA was synthesized based on 0.5 µg total RNA using the M-MLV reverse transcription system (TaKaRa), according to the manufacturer’s instructions. The cDNAs were diluted in a 1:20 ratio of CDNA to nuclease-free water prior to the qRT-PCR analyses. 4.3. Selection of Reference Genes and Primer Design Arabidopsis nucleotide sequences from the potential reference genes served as query sequences for a TBLASTX search of the seashore paspalum transcriptome database (unpublished). Twelve candidate reference genes (EF1a, ACT, GAPDH, TUB, UPL, SAND, CACS, F-box, PP2A, CYP, U2AF, and TIP41) were identified and corresponding NCBI accession numbers and gene ontologies are given in Table 1. Specific primers for qRT-PCR were designed using Primer Premier 5.0 software to have melting temperatures between 55–65 ◦ C, primer lengths between 19–24 bp, and amplicon lengths between 100–300 bp (Table 1). 4.4. qRT-PCR Analysis The qRT-PCR procedure was performed using the LightCycler 480 SYBR Green I Master reaction system with a LightCycler 480 II instrument (Roche, Basel, Switzerland). Each 15-µL reaction mixture consisted of 7.5 µL of 2× concentrated SYBR Green I Master Mix, 5 µL of diluted cDNA, 0.4 µL of each primer (10 µM total), and 1.7 µL double-distilled water. The reaction conditions included an initial denaturation step at 95 ◦ C for 10 min followed by 45 cycles of 95 ◦ C for 15 s, 58 ◦ C for 15 s, and 72 ◦ C for 30 s, after which a melt curve was produced at 60–95 ◦ C. Each qRT-PCR analysis was performed in triplicate. 4.5. Stability Analysis Amplification efficiencies of each qRT-PCR were calculated by the slope of the line (E = 10slope ), with the software LinRegPCR, based on Log (fluorescence) per cycle number data as an assumption-free method to calculate starting concentrations of mRNAs, which is available on request [30]. The stability of reference genes was determined with four programs, including GeNorm [1], NormFinder [31], BestKeeper [32] and RefFinder (available online: http://www.leonxie.com/referencegene.php). For GeNorm and NormFinder analysis, quantification cycle (Cq) values were converted into relative

Int. J. Mol. Sci. 2017, 18, 1322

12 of 14

quantities using the formula 2−∆Cq , in which ∆Cq = each corresponding Cq value-minimum Cq value. The expression stability measurement (M) was determined by the GeNorm program based on the average variations of a particular gene against all the other control genes in their expression levels. Through the NormFinder program, the stability value represented inter- and intra-group variation and lowest stability was ranked highest. The BestKeeper program was applied to measure the comparisons of the coefficient of variance (CV) and the standard deviation (SD), and the lowest SD and CV were used as detection indexes for the most stable reference genes. RefFinder was used to make a comprehensive analysis based on the data from GeNorm (M values), NormFinder (Stability values), BestKeeper (CV and SD), and ∆Cq values. 4.6. Validation of Reference Genes by Expression Analysis of Four Stress-Related Genes under Abiotic Stresses Previous reports showed that MT2a, VP1, PIP1, and Cor413 were responsive to various abiotic stresses [33–36]. The four homologs MT2a, VP1, PIP1, and Cor413 (Genbank accession numbers shown in Table 1) from seashore paspalum were obtained from the transcriptome data (unpublished). For the validation of selected reference genes from qRT-PCR data, the expression levels of these four genes were analyzed using the most stable and highly varying reference genes under different treatments, calculated using the 2−∆∆Cq method. Three technical replicates were performed for each biological sample. 4.7. Statistical Analysis A one-way analysis of variance (ANOVA) was performed to calculate whether treatment means were statistically different from one another (p = 0.05) using the SPSS v13.0 software (IBM, Chicago, IL, USA). 5. Conclusions This study provides the first systematic study for screening stable reference genes for use as the internal control in qRT-PCR analysis in leaves and roots of seashore paspalum under four different abiotic stresses. FBOX, U2AF, and PP2A could be applied as stable reference genes in future molecular studies that aim to understand the mechanisms of abiotic stress tolerance in seashore paspalum. Acknowledgments: This work was supported by the program of National Natural Science Foundation of China (NSFC, 31672193) and the China Postdoctoral Science Foundation (2017M611842). Author Contributions: Yu Liu, Jun Liu, Yu Chen, and Bingru Huang conceived the study and designed the experiments. Yu Liu, Jun Liu, and Yu Chen performed the experiments. Lei Xu and Hui Lai analyzed the data with suggestions from Yu Chen, Zhimin Yang, and Bingru Huang. Yu Liu and Yu Chen wrote the manuscript. All authors read and approved the final manuscript. Conflicts of Interest: The authors declare no conflict of interest.

References 1.

2.

3.

4.

Vandesompele, J.; de Preter, K.; Pattyn, F.; Poppe, B.; van Roy, N.; de Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [CrossRef] [PubMed] Nicot, N.; Hausman, J.F.; Hoffmann, L.; Evers, D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot. 2005, 56, 2907–2914. [CrossRef] [PubMed] Saraiva, K.C.; Fernandes de Melo, D.; Morais, V.; Vasconcelos, I.; Costa, J. Selection of suitable soybean EF1α genes as internal controls for real-time PCR analyses of tissues during plant development and under stress conditions. Plant Cell. Rep. 2014, 33, 1453–1465. [CrossRef] [PubMed] Niu, K.; Shi, Y.; Ma, H. Selection of Candidate Reference Genes for Gene Expression Analysis in Kentucky Bluegrass (Poa pratensis L.) under Abiotic Stress. Front. Plant Sci. 2017, 8, 193. [CrossRef] [PubMed]

Int. J. Mol. Sci. 2017, 18, 1322

5. 6.

7.

8.

9.

10.

11.

12. 13.

14.

15.

16. 17.

18.

19.

20.

21.

22.

13 of 14

Yang, Q.; Yin, J.; Li, G.; Qi, L.; Yang, F.; Wang, R. Reference gene selection for qRT-PCR in Caragana korshinskii Kom. under different stress conditions. Mol. Biol. Rep. 2014, 41, 2325–2334. [CrossRef] [PubMed] Bao, W.L.; Qu, Y.L.; Shan, X.Y.; Wan, Y.L. Screening and Validation of Housekeeping Genes of the Root and Cotyledon of Cunninghamia lanceolata under Abiotic Stresses by Using Quantitative Real-Time PCR. Int. J. Mol. Sci. 2016, 17, 1198. [CrossRef] [PubMed] Niu, L.J.; Tao, Y.B.; Chen, M.S.; Fu, Q.T.; Li, C.Q.; Dong, Y.L.; Wang, X.L.; He, H.Y.; Xu, Z.F. Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR. Int. J. Mol. Sci. 2015, 16, 12513–12530. [CrossRef] [PubMed] Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol. Plant 2015, 155, 138–148. [CrossRef] [PubMed] Zhang, Y.; Han, X.; Chen, S.; Zheng, L.; He, X.; Liu, M.; Qiao, G.; Wang, Y.; Zhuo, R. Selection of suitable reference genes for quantitative real-time PCR gene expression analysis in Salix matsudana under different abiotic stresses. Sci. Rep. 2017, 7, 40290. [CrossRef] [PubMed] Czechowski, T.; Stitt, M.; Altmann, T.; Udvardi, M.K.; Scheible, W.R. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005, 139, 5–17. [CrossRef] [PubMed] Demidenko, N.V.; Logacheva, M.D.; Penin, A.A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data. PLoS ONE 2011, 6, e19434. [CrossRef] [PubMed] Marum, L.; Miguel, A.; Ricardo, C.P.; Miguel, C. Reference gene selection for quantitative real-time PCR normalization in Quercus suber. PLoS ONE 2012, 7, e35113. [CrossRef] Zhu, J.; Zhang, L.; Li, W.; Han, S.; Yang, W.; Qi, L. Reference Gene Selection for Quantitative Real-time PCR Normalization in Caragana intermedia under Different Abiotic Stress Conditions. PLoS ONE 2013, 8, e53196. [CrossRef] [PubMed] Gimeno, J.; Eattock, N.; Van Deynze, A.; Blumwald, E. Selection and Validation of Reference Genes for Gene Expression Analysis in Switchgrass (Panicum virgatum) Using Quantitative Real-Time RT-PCR. PLoS ONE 2014, 9, e91474. [CrossRef] [PubMed] Chen, Y.; Chen, C.; Tan, Z.; Liu, J.; Zhuang, L.; Yang, Z.; Huang, B. Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance. Front. Plant Sci. 2016, 7, 102. [CrossRef] [PubMed] Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [CrossRef] [PubMed] Huang, L.; Yan, H.; Jiang, X.; Yin, G.; Zhang, X.; Qi, X.; Zhang, Y.; Yan, Y.; Ma, X.; Peng, Y. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions. PLoS ONE 2014, 9, e93724. [CrossRef] [PubMed] Chen, Y.; Hu, B.; Tan, Z.; Liu, J.; Yang, Z.; Li, Z.; Huang, B. Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep. 2015, 34, 1825–1834. [CrossRef] [PubMed] Yang, Z.; Chen, Y.; Hu, B.; Tan, Z.; Huang, B. Identification and Validation of Reference Genes for Quantification of Target Gene Expression with Quantitative Real-time PCR for Tall Fescue under Four Abiotic Stresses. PLoS ONE 2015, 10, e0119569. [CrossRef] [PubMed] Wei, Y.C.; Liu, Q.H.; Dong, H.Y.; Zhou, Z.C.; Hao, Y.P.; Chen, X.L.; Xu, L.Y. Selection of Reference Genes for Real-Time Quantitative PCR in Pinus massoniana Post Nematode Inoculation. PLoS ONE 2016, 11, e0147224. [CrossRef] [PubMed] Lin, L.; Han, X.; Chen, Y.; Wu, Q.; Wang, Y. Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba. Mol. Genet. Genom. 2013, 288, 727–737. [CrossRef] [PubMed] Wang, Z.; Chen, Y.; Fang, H.; Shi, H.; Chen, K.; Zhang, Z.; Tan, X. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions. Mol. Genet. Genom. 2014, 289, 1023–1035. [CrossRef] [PubMed]

Int. J. Mol. Sci. 2017, 18, 1322

23.

24. 25. 26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

14 of 14

Gao, M.M.; Liu, Y.P.; Ma, X.; Shuai, Q.; Gai, J.Y.; Li, Y. Evaluation of Reference Genes for Normalization of Gene Expression Using Quantitative RT-PCR under Aluminum, Cadmium, and Heat Stresses in Soybean. PLoS ONE 2017, 12, e0168965. [CrossRef] [PubMed] He, Y.H.; Yan, H.L.; Hua, W.P.; Huang, Y.Y.; Wang, Z.Z. Selection and Validation of Reference Genes for Quantitative Real-time PCR in Gentiana macrophylla. Front. Plant Sci. 2016, 7, 945. [CrossRef] [PubMed] Kundu, A.; Patel, A.; Pal, A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo. Plant Cell Rep. 2013, 32, 1647–1658. [CrossRef] [PubMed] Ma, S.H.; Niu, H.W.; Liu, C.J.; Zhang, J.; Hou, C.Y.; Wang, D.M. Expression Stabilities of Candidate Reference Genes for RT-qPCR under Different Stress Conditions in Soybean. PLoS ONE 2013, 8, e75271. [CrossRef] [PubMed] Wang, H.L.; Chen, J.; Tian, Q.; Wang, S.; Xia, X.; Yin, W. Identification and validation of reference genes for Populus euphratica gene expression analysis during abiotic stresses by quantitative real-time PCR. Physiol. Plant 2014, 152, 529–545. [CrossRef] [PubMed] Li, W.; Qian, Y.Q.; Han, L.; Liu, J.X.; Sun, Z.Y. Identification of suitable reference genes in buffalo grass for accurate transcript normalization under various abiotic stress conditions. Gene 2014, 547, 55–62. [CrossRef] [PubMed] Jain, M.; Nijhawan, A.; Tyagi, A.K.; Khurana, J.P. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2006, 345, 646–651. [CrossRef] [PubMed] Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.; Karlen, Y.; Bakker, O.; van den Hoff, M.J.; Moorman, A.F. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [CrossRef] [PubMed] Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [CrossRef] [PubMed] Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper−Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [CrossRef] [PubMed] Chen, Y.; Jiang, J.; Chang, Q.; Gu, C.; Song, A.; Chen, S.; Dong, B.; Chen, F. Cold acclimation induces freezing tolerance via antioxidative enzymes, proline metabolism and gene expression changes in two chrysanthemum species. Mol. Biol. Rep. 2014, 41, 815–822. [CrossRef] [PubMed] Chen, Y.; Li, L.; Zong, J.; Chen, J.; Guo, H.; Guo, A.; Liu, J. Heterologous expression of the halophyte Zoysia matrella H+-pyrophosphatase gene improved salt tolerance in Arabidopsis thaliana. Plant Physiol. Biochem. 2015, 91, 49–55. [CrossRef] [PubMed] Zhou, S.; Hu, W.; Deng, X.; Ma, Z.; Chen, L.; Huang, C.; Wang, C.; Wang, J.; He, Y.; Yang, G.; He, G. Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco. PLoS ONE 2012, 7, e52439. [CrossRef] [PubMed] Gu, C.S.; Liu, L.Q.; Zhao, Y.H.; Deng, Y.M.; Zhu, X.D.; Huang, S.Z. Overexpression of Iris lactea var. chinensis metallothionein llMT2a enhances cadmium tolerance in Arabidopsis thaliana. Ecotoxicol. Environ. Safe 2014, 105, 22–28. [CrossRef] [PubMed] © 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).