Identification, Inheritance, and Linkage of B-G-like and MHC Class I ...

Identification, Inheritance, and Linkage of B-G-like and MHC Class I Genes in Cranes S. I. Jarvi, R. M. Goto, G. F. Gee, W. E. Briles, and M. M. Miller

We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of a-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a longterm association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes. The major histocompatibility complex (MHC) is one of the most polymorphic and polygenic regions in the genomes of vertebrates. Particular MHC class I and class II loci strongly influence the effectiveness of immune responses mounted against particular pathogens, for example, to avian leukosis and other viruses (Mustonen et al. 1996; Thacker et al. 1995). Individuals heterozygous for MHC alleles appear to have an advantage for survival over homozygotes (overdominant selec-

From the Department of Molecular Biology, Beckman Research Institute of the City of Hope National Medical Center, Duarte, CA 91010 (Jarvi, Goto, and Miller), Patuxent Wildlife Research Center, Laurel, Maryland (Gee), and Department of Biological Sciences, Northern Illinois University, DeKalb, Illinois ( Briles). S. I. Jarvi is currently at the Wildlife Disease Laboratory, Pacific Island Ecosystem Research Center, Hawaii National Park, Hawaii. The authors thank Johanna Taylor, Jane Nicolich, and other members of the Captive Propagation Research Group at the Patuxent Wildlife Research Center, and Claire Miranda, Scott Swengel, Julie Langenberg, and others at the International Crane Foundation. This work was supported by the NSF program for Basic Research in Conservation and Restoration Biology ( DCB 9000031 to M.M.M. and W.E.B.), NSF BIR 9220534, and NCI CA33572. Address correspondence to M. M. Miller at the address above. q 1999 The American Genetic Association 90:152–159

152

tion) (e.g., Briles 1954; Thursz et al. 1997). Conservation of genetic variability at the MHC is likely important for the preservation of fitness in small breeding populations. Knowledge of MHC genotypes, if available, should be included in the information considered in captive breeding of small populations to increase the likelihood that rare MHC alleles or haplotypes are retained. More than half of the world’s crane species are listed as threatened in the 1996

Figure 1. Restriction map of clone 3, a whooping crane genomic DNA clone of approximately 15 kb that contains the sequences of two B-G-like genes, wcbg1 and wcbg2. The position of wcbg2B1.5, the probe used in Figures 3, 4, and 7, is noted.

Figure 2. Alignment of the predicted amino acid sequences of the IgV-like domains of wcbg1 and wcbg2 with those of the chicken B-G cDNA clones, bg14/8 and bg11/4 from Miller et al. 1991. “*” indicates full identity, “.” marks sites of amino acid conservation and “↑” marks residues typically conserved in IgV-like domains.

Figure 3. Restriction fragment patterns revealed in the DNA of the whooping crane dam from which wcbg2B1.5 was obtained ( lane 1) and in DNA from the sire, ( lane 2) and 10 progeny ( lanes 3–12). DNA was digested with PvuII. Dam, sire, and progeny 1–10 are whooping crane genealogy book nos. 1053, 1019, 1096, 1114, 1133, 1139, 1161, 1171, 1185, 1187, 1188, and 1201, respectively. Fragments of 3 kb ( large arrow) and 1.9 kb (small arrow) segregate within the family.

IUCN Red List of Threatened Animals. Members of all 15 known species are represented among breeding animals for captive propagation at the International Crane Foundation ( Baraboo, Wisconsin) and for propagation and research at the Patuxent Wildlife Research Center ( Laurel, Maryland). The availability of blood samples and extensive pedigree records, as well as the need for further genetic information which might be useful in mate selection, provided part of the impetus for MHC studies in cranes. Much of the current knowledge of avian MHC molecular genetics originates from studies conducted primarily in the chicken (as reviewed by Kaufman and Wallny 1996). Only recently have DNA-based studies extended to the MHC of other galliformes including pheasant (Jarvi et al. 1996; Wittzell et al. 1994, 1995), turkey ( Emara et al. 1993; Zhu et al. 1996), and quail ( Drake BM et al., in preparation; Shiina et al. 1995), and passeriformes ( Edwards et al. 1995; Jarvi SI et al., in preparation; Vincek et al. 1995). The gruine species groups are thought to have arisen in the late Miocene or early Pliocene ( Krajewski and Fetzner 1994) and to represent an evolutionary lineage distinct from galliformes and from the more recently derived passeriformes. Serological studies of the MHC in cranes (Jarvi et al. 1995) provide a starting point for this DNA-based study. With the immediate goal of establishing MHC haplotype identities and measuring genetic variability in cranes using methods based on DNA, we chose to investigate initially the restriction fragment patterns provided by crane B-G genes. B-G and other similar genes are known to be linked to the MHC in other species (Goto et al. 1988; Pham-Dinh et al. 1993). Since polymorphic MHC class I and class II genes in birds have been found to be organized into two or more genetically independent systems ( Briles et al. 1993, Jarvi et al. 1996; Miller et al. 1994, Wittzell et al. 1995), it may be difficult to accurately gauge MHC variability in avian species on the basis of class I or class II gene se-

Jarvi et al • B-G-like and MHC Class I Genes in Cranes 153

vector (Stratagene). The library was screened with the chicken MHC class I probe, B-F10. Nucleotide Sequence Determinations Nucleotide sequences were determined by the PCR dye-terminator method on a 373 ABI automated sequencer using primers to the T3 and T7 promoter sequences within the polylinker of pBluescript (Stratagene). Sequences were analyzed with PC/Gene and DNAstar software. To fully determine the sequence of wcbg2 and the crane class I cDNA clone, shcf51, subclones were made using several different restriction enzyme digestions. Oligonucleotide primers were prepared as needed to complete the full sequence determinations. Southern Hybridization Analyses Southern hybridizations were carried out as described previously at either 608C or 658C ( Briles et al. 1993). Images were collected both on film and in a PhosphorImager (Molecular Dynamics). Figure 4. Restriction fragment patterns provided by wcbgB1.5 in DNA from 15 different species of cranes. Samples include lane 1, black-crowned crane (Balearica pavonina); lane 2, gray crowned crane (B. regulorum); lane 3, Demoiselle crane (Anthropoides virgo); lane 4, Stanley crane (A. paradisea); lane 5, wattled crane (Bugeranus carunculatus); lane 6, Siberian crane (G. leucogeranus); lane 7, Florida sandhill crane (G. canadensis pratensis); lane 8, eastern Sarus crane (G. antigone antigone; lane 9, Brolga crane (G. rubicundus); lane 10 white naped crane (G. vipio); lane 11, common crane (G. grus); lane 12, hooded crane (G. monachus); lane 13, whooping crane (G. americana); lane 14, black necked crane (G. nigricollis); lane 15, red crowned crane (G. japonensis). DNA from the whooping crane ( lane 13) and from a chicken ( lane 16) were included as controls.

quences alone. Chicken B-G alleles can be scored in Southern hybridizations and correlate well with serologically defined chicken MHC B system haplotypes (Miller et al. 1988). We postulated that B-G genes, if present, might provide an efficient means for studying MHC haplotypic variability in cranes. Further the polymorphism inherent in the B-G genes themselves may be of adaptive value. Experiments were conducted to identify B-G-like genes in cranes to ascertain whether they are polymorphic and to determine whether they are linked within the MHC.

Materials and Methods Birds and DNA Samples The International Crane Foundation and the Patuxent Wildlife Research Center provided blood cells collected from cranes of different species during annual health checks. DNA was isolated as previously described (Miller et al. 1988). The families of Florida sandhill cranes (Grus canadensis pratensis) used in this study are a portion of those used previously (Jarvi et al.

154 The Journal of Heredity 1999:90(1)

1995). Chicken DNA is from a white Leghorn stock in which B2 is segregating. Blood sampling and handling techniques conformed to protocols approved by the local animal care and use committees. DNA Probes Probes included a chicken B-G cDNA clone, bg11/4 (Miller et al. 1991), a chicken MHC class I probe, B-F10 (Guillemot et al. 1988), and wcbg2B1.5, a BamHI 1.5 kb subclone from wcbg2 as described below. Library Construction A lFix II (Stratagene) genomic library was constructed following the manufacturer’s protocol. DNA from a single female whooping crane, whooping crane genealogy book no. 1053 (also known as Mrs. C or #71001), was used. Standard methods were followed for screening, excision, and subcloning. To prepare a Florida sandhill crane cDNA library, RNA was isolated with Rnazol By (Cinna Scientific, Inc.) from a late development embryo, mRNA purified, and a library constructed with the Uni-Zap XR

Single-Strand Conformational Polymorphism (SSCP) Assays Primers for SSCP were chosen to encompass a region of 174 bp in the second exon (a1 domain) of the crane MHC class I cDNA clone, shcf51. The 59 and 39 primer sequences were GACGGCAACCTCATTTCACG and TCTGGTTGTAGCGGCCCCGCA, respectively. PCR reactions were carried out with Perkin Elmer Taq DNA polymerase following the manufacturer’s suggested protocol. Thirty cycles of amplification were carried out with 45 s intervals consisting of denaturation at 958C, annealing at 638C, and elongation at 728C with a 5 min interval at 728C following the final round of amplification. Products were examined first by electrophoresis in 1.5% agarose TBE gels. SSCP gels containing 10% polyacrylamide were prepared and used for SSCP essentially as described by Ota et al. (1993). Gels were stained with Biorad Silver Staining Plus Kit and dried in BioDesignGelWrap ( BioDesign, Inc.).

Results Isolation of Crane B-G-like Genes A crane genomic DNA library was screened with a chicken B-G cDNA clone, bg11/4 at 558C. Numerous plaques were unequivocally positive and 10 were chosen for purification. The longest, clone 3,

Figure 5. Alignment of the predicted amino acid sequence of the Florida sandhill crane class I cDNA clone, clone shcf51, and the sequence of a chicken MHC class I gene, BFIV21 (from Fulton et al. 1995). Regions corresponding to the 59 and 39 primer sites used in the SSCP assays are noted.

was selected for restriction mapping ( Figure 1) and partial sequencing. Clone 3 contained BamHI restriction fragments hybridizing with bg11/4. Two BamHI sites separated by 7–8.5 kb ( Figure 1) were found to be conserved in association with sequences encoding two IgVlike domains highly similar to the IgV-like domains of the chicken B-G genes ( Figure 2). The two sequences had homology of 77% in predicted amino acid sequence. Although both crane sequences are two codons longer than the equivalent sequence in the chicken, they are 56% identical in predicted amino acid sequence to the IgVlike domains of the B-G genes of the chicken. They share many of the residues that define the IgV-domain motif, noted by the arrows in Figure 2. Based on the high sequence homology of these sequences with equivalent regions within chicken B-G genes and on the strong hybridization with the bg11/4 probe, we tentatively concluded that clone 3 contains two whooping crane B-G-like genes, which we designated wcbg1 and wcbg2. The nucleotide se-

quence of wcbg2 and adjacent DNA has been fully determined (Genbank AF033107). We found the initial similarity of wcbg2 with chicken B-G genes was further supported by the presence of exons encoding a transmembrane domain and a single seven amino acid ( heptad) sequence with predicted amino acid sequences 29% and 86% identical to counterparts in chicken B-G sequences, respectively. We identified an additional exon located between the exon for the IgV domain and the exon for the transmembrane domain. This exon shares homology with the exon for the IgC-like domains of mammalian butyrophilin (Jack and Mather 1990). We will examine the structural similarities of the crane B-G-like genes with butyrophilin molecules elsewhere (Goto RM et al., in preparation). Because of the presence of a second extracellular domain and the much abbreviated intracytoplasmic region of the crane genes, we have chosen to describe the genes in cranes as B-G-like genes to make clear that structural differ-

ences exist between the crane and chicken molecules. We selected the 1.5 kb BamHI fragment (wcbg2B1.5) noted in Figure 1, containing the bulk of the exon for the IgV-like domain (234 of 348 bp), intron (489 bp), second domain (285 bp), intron (244 bp), exon (156 bp) for transmembrane domain, and 71 bp of the following intron in wcbg2, to use as a probe in the studies described below. Hybridization of wcbg2b1.5 with Whooping Crane Genomic DNA To determine the nature of the B-G-like gene family in the whooping crane, we used PvuII-digested genomic DNA samples from the female from which the library was constructed, the male to which she was mated, and 10 progeny in Southern hybridizations with the wcbgB1.5 probe. The complex patterns containing numerous restriction fragments ( Figure 3) suggest that the wcbg2 gene is a member of a large family of highly similar genes. The patterns in Figure 3 are nearly identical in both parents and progeny. The most

Jarvi et al • B-G-like and MHC Class I Genes in Cranes 155

of the chicken (sample 16) is far weaker, illustrating the significant differences that exist between the nucleotide sequences of B-G-like genes in the crane and the chicken. Additional Southern hybridizations between wcbg2B1.5 and the DNA from a variety of evolutionarily more distant bird species (not shown) provide mostly only faint banding patterns similar to those seen with chicken DNA.

Figure 6. MHC class I gene SSCP patterns provided by Florida sandhill crane families 1 and 2. Family 1 samples are dam, sire, and nine progeny and correspond to Patuxent nos. 83015, 83020, 89063, 90006, 90010, 91003, 91004, 93002, 93003, 93022, and 93024. Family 2 samples are dam, sire, and seven progeny and correspond to Patuxent nos. 85033, 85040, 89035, 89061, 90008, 90011, 93025, 93027, and 93056, respectively.

prominent exception is a strongly hybridizing restriction fragment of approximately 3 kb segregating in the progeny. Two of the progeny entirely lack this fragment. In others the band varies in intensity suggesting that one or two copies of the 3 kb restriction fragment has been inherited by these individuals and that the dam and sire may be heterozygous for alleles represented by this restriction fragment. Less prominent bands, including a band of approximately 1.9 kb, also appear to segregate in the family. These represent additional genetic differences between dam and sire. These polymorphisms provide evidence that some genetic variability resides in the B-G-like genes of the whooping crane despite the severe bottleneck

156 The Journal of Heredity 1999:90(1)

through which this species has passed ( Ellis et al. 1996). Further analyses of MHC genetic variability in the whooping crane will be described elsewhere (Jarvi SI et al., in preparation). B-G-like Genes in Different Species of Cranes To ascertain whether the wcbg2 gene is representative of similar genes in other species of cranes, we carried out Southern hybridizations with samples of PvuII-digested DNA from 15 other species of cranes (Figure 4). The patterns of wcbg2B1.5 revealed that the restriction fragments are equally complex in pattern and intensity in all the species examined. In contrast, hybridization of wcbg2B1.5 with the DNA

Correspondence of Restriction Fragment Patterns with Assignment of MHC Haplotypes by Serology and by PCR-SSCP To test the assumption that the B-G-like genes represented by wcbg2 are linked within the MHC in cranes it was necessary to turn to Florida sandhill cranes, a surrogate species for the endangered whooping cranes. We used families of Florida sandhill cranes bred in captivity. These families were subjected to alloimmunizations to produce alloantisera used to characterize a polymorphic alloantigen system in Florida sandhill cranes that was defined as the MHC (Jarvi et al. 1995). Two large families and additional smaller families of known parentage are suitable for examining the inheritance of polymorphic markers, in this case the genes identified by wcbg2B1.5. In order to have an additional means by which to test the correspondence between the segregation of alleles at the crane B-G-like loci and the MHC, we developed an SSCP assay based on exon 2 (a1 domain) sequences of the crane MHC class I genes. To obtain the sequence needed for the SSCP assay a MHC class I cDNA clone, shcf51, was isolated from a Florida sandhill embryo library and fully sequenced (Genbank AF033106). The shcf51 clone was one of eight identical clones apparently representing transcripts from a single gene. The sequence provides evidence that the crane class I transcripts are 66% similar in nucleotide sequence and 55% in predicted amino acid sequence to those of the chicken ( Figure 5). There is strong conservation between the crane and chicken genes in the predicted amino acid sequences in discreet regions in the a1, a2, and particularly the a3 domains. Based on previous experience in adapting the SSCP assay for MHC typing of the chicken (Afanassieff M et al., in preparation), we selected a set of primers for the PCR step of SSCP, as noted in Figure 5, to encompass a region within exon 2 of the crane MHC class I genes that, by extrapolation, we expected to be polymorphic.

Figure 7. Restriction fragment patterns revealed by wcbg2B1.5 in PstI-digested DNA from family 1 and 2 of Florida sandhill cranes. Samples are as in Figure 6.

Further, we located the primers in regions likely to provide specificity for the MHC class I genes associated with the B-G-like gene region (i.e., similar to the B system class I genes B-FI and B-FIV) and not to class I genes present within the Rfp-Y system (i.e., the two class I genes mapped to Rfp-Y and now called Y-FV and Y-FVI) in a second cluster of avian MHC genes that could be present (Miller et al. 1994). SSCP patterns provided by members of two large families of Florida sandhill cranes are provided in Figure 6. SSCP bands present in dams and sires segregate in the progeny and can be assigned to linkage groups defining four alleles in each family which we have designated w1–w4 in family 1 and w5–w8 in family 2. These are presented in Table 1 together with serological haplotypes assigned previously. Good correspondence is found between the SSCP-determined class I allele assignments and the serological haplotypes determined using alloantisera (Jarvi et al. 1995). Assignments were found to agree

for 30 of 32 alleles among the progeny. The lack of correspondence for single alleles in two different individuals (P6 of family 1 and P2 of family 2) may be clarified in further serological testing using reagents subjected to additional selective adsorptions. With the serological haplotypes and SSCP MHC class I alleles providing a reference, we undertook Southern hybridizations to examine the segregation of wcbg2B1.5 restriction fragments in the two sandhill crane families. We digested DNA samples from the families with three different restriction enzymes: PstI, PvuII, and TaqI. A summary of the segregation of informative restriction fragments in the two families is presented in Table 1. The patterns obtained with PstI are illustrated in Figure 7. The patterns of inheritance of polymorphic restriction fragments transmitted by dam and sire in both families were most often found to correspond to the MHC class I alleles assigned on the basis of SSCP patterns. In each family three

of the four alleles were revealed in the DNA digested with the three enzymes chosen for this analysis. In family 1 w4 and in family 2 w6 are undefinable using the current enzymes. It is likely that additional restriction enzyme digestions would reveal polymorphic bands associated with these alleles. In both families a small number of particular restriction fragments could not be assigned to MHC alleles. In family 1, P2 appears to have inherited PstI, PvuII, and TaqI restriction fragments from the dam associated with both w1 and w2 alleles. The basis of this deviation is not clear. But since this pattern was found in only one of the progeny, meiotic recombination may have occurred in the production of the female gamete contributed to this individual such that restriction fragments associated with w1 are now combined with fragments representing w2 in P2. In family 2 the dam appears to have transmitted PstI and TaqI restriction fragments to four of her seven progeny independently of her MHC genotype. In this instance it would appear that the restriction fragments may be evidence of a second cluster of polymorphic B-G-like genes in the Florida sandhill cranes. Unlinked restriction fragments were also observed in smaller families of Florida sandhill cranes (not shown). They are especially prominent in Mississippi sandhill crane families as well (Jarvi SI et al., in preparation). These findings provide evidence for a complex pattern of inheritance of B-G-like genes in the Florida sandhill cranes in which only a portion of the genes are linked within the MHC.

Discussion We have established that cranes possess a large family of B-G-like genes that are similar to, yet structurally distinct from, the B-G genes identified in gallinaceous birds (Jarvi et al. 1996; Miller et al. 1991). Evidence for polymorphism of the crane BG-like genes was found in both whooping cranes and Florida sandhill crane families as revealed by variations in restriction fragment patterns among individuals within families. These findings indicate that crane B-G gene variation exists among individuals and that the B-G-like genes may be used as a means of identifying different MHC haplotypes. While the patterns of BG bands in Southern hybridizations are complex, analyses of the patterns within families have made it possible to assign a portion of the polymorphic restriction

Jarvi et al • B-G-like and MHC Class I Genes in Cranes 157

Table 1. Comparison of genotype assignments in two families of Florida sandhill cranes determined by alloantisera, SSCP of Mhc class I genes, and B-G-like gene restriction fragment patterns C. B-G-like gene restriction fragment banding patterns A. Alloanti- B. gensa SSCPb Family Dam Sire P1 P2 P3 P4 P5 P6 P7 P8 P9

1

Family Dam Sire P1 P2 P3 P4 P5 P6 P7

2

2/17 13/20 17/20 17/13 17/20 17/13 2/20 2/13 2/13 n.t. 2/13 1/9 5/8 1/8 9/5 9/8 1/5 9/8 9/5 1/8

B5 A?

PstI 7.2

4.1

3.5

3.1

3.0

2.4

2.3

2.2

2.0 1.8

w1/w2 w3/w4 w2/w4 w2/w3 w2/w4 w2/w3 w1/w4 w1/w4 w1/w3 w1/w3 w1/w3

Yes Yes Yes Yes Yes Yes Yes Half Yes ? Yes

o o o o o o o o o o o

o o o o o o o o o o o

o 1w3 o 1w3 o 1w3 o o 1w3 1w3 1w3

1w1 o 1o? 1?c o o 1w1 1w1 1w1? 1w1? 1w1?

o 1w3 o 1w3 o 1w3 o o 1w3? 1w3? 1w3?

o o o o o o o o o o o

o o o o o o o o o o o

1w2 o 1w2 1w2 1w2 1w2 o o o o o

o o o o o o o o o o o

w5/w6 w7/w8 w6/w8 w6/w7 w5/w8 w6/w7 w5/w8 w5/w7 w6/w8

Yes Yes Yes Half Yes Yes Yes Yes Yes

o/1? 1w8 1w8 o 1w8 o 1w8 o 1w8

1?d 1w7 o 1w7?/?d o 1w7?/?d 1?d 1w7?/?d 1?d

o 1w7 o 1w7 o 1w7 o 1w7 o

o 1w8 1w8 o 1w8 o 1w8 o 1w8?

o 1w7 o 1w7 o 1w7 o 1w7 o

o 1w8 1w8 o 1w8 o 1w8 o 1w8

1w5 o o o 1w5 o 1w5 1w5? o

o 1w7 o 1w7 o 1w7 o 1wo7? o

1 1 1 1 1 1 1 1 1

PvuII

TaqI

9.7

7.0

4.7

7.0

6.7

6.0

5.8 kb C 5 B?

1 1 1 1 1 1 1 1 1 1 1

1w2 o 1w2 1w2 1w2 1w2 o o o o o

1w1 o o 1?c o o 1w1 1w1 1w1 1w1 1w1

1w2 o 1w2 1w2 1w2 1w2 o o o o o

o o o o o o o o o o o

o o o o o o o o o o o

o o o o o o o o o o o

1w1 o o 1?c o o 1w1 1w1 1w1 1w1 1w1

Yes Yes Yes No, recombinant? Yes Yes Yes Yes Yes Yes Yes

o 1w7 o 1w7 o 1w7 o 1w7 o

o o o o o o o o o

o o o o o o o o o

1 o 1 1 1 1 1 1 1

1?d o o 1?d o o 1?d 1?d 1?d

o 1w8 1w8 o 1w8 o 1w8 o 1w8

1w5 o o o 1w5 o 1w5 1w5 o

o o o o o o o o o

No, Yes Yes No, Yes Yes No, No, No,

2nd system?

2nd system?

2nd system? 2nd system? 2nd system?

Mhc genotype assigments based on Jarvi et al. 1995. SSCP and restriction fragment pattern defined in this study have been given interim working allele assignments w1–w8. c Restriction fragments representing an unlinked gene, or possibly a recombination event. d Restriction fragments representing a possible second polymorphic locus not linked with the Mhc. In family 2 the 4.1 kb PstI fragment is associated with w7 in the sire and is unlinked to the Mhc in the dam.

a

b

fragments to a single linkage group segregating within the MHC. This study has revealed the presence of polymorphic B-G-like gene restriction fragments that are unlinked to the MHC. This is in contrast with previous studies of the avian B-G genes, but this observation adds to growing evidence for variation among species in the linkage organization of MHC and MHC-related genes (Amadou et al. 1995; Briles et al. 1993; Flajnik et al. 1993; Hashimoto et al. 1995; Jarvi et al. 1996; Wittzell et al. 1995). Further variation within the B-G-like genes themselves across species of birds is evident when both the wcbg2B1.5 and chicken B-G probes are used to examine the DNA of other species. While cross-hybridization is strong within closely related species, hybridization is generally weak when the crane and chicken B-G probes are used to search for analogous genes in other species. This may be a reflection of rapid, possibly pathogendriven evolution of the B-G-like genes (Miller et al. 1991). The function of the B-G-like genes remains to be defined. The high level of allelic polymorphism apparent in the B-G loci in both cranes and chickens is highly unusual for genes other than MHC class I and class II genes. Since the polymorphism of the latter genes is known to be

158 The Journal of Heredity 1999:90(1)

associated with antigenic peptides, the polymorphism of B-G-like genes in birds may be inherent in their function having either to do with pathogen recognition or recognition of another polymorphic element of the immune system itself. As has been mentioned here and will be described in more detail elsewhere (Goto RM et al., in preparation), the crane B-G-like genes are structurally intermediate between the B-G genes of the gallinaceous birds and the BT genes of man ( Henry et al. 1997; Ruddy et al. 1997). A family of six BT genes ( Henry et al. 1997, Ruddy et al. 1997) exists near the MHC in man ( Vernet et al. 1993). At least one BT gene is highly expressed in mammary glands during lactation and the gene product is thought to have a role in the secretion of milk fat. Of interest, the BT genes in man have apparently little allelic variability, suggesting that polymorphic variation is not necessarily inherent in the function of these molecules. The method of MHC typing based on MHC class I SSCP patterns described here is potentially useful in investigating MHC conservation genetics in cranes. SSCP involves no radioisotopes, requires only small quantities of DNA, and can be applied readily to large numbers of samples. The SSCP patterns containing two to six

bands obtained in the analysis of the sandhill cranes indicate that the number of class I loci is small. The genes revealed appear to be in a single linkage group. Most of the eight alleles in the two families produced unique patterns. Hence it is likely that additional pattern variations would be revealed in a larger survey of individuals, and that the SSCP patterns constitute a relatively simple means of detecting MHC variation within a population.

References Amadou C, Ribouchon MT, Mattei MG, Jenkins NA, Gilbert DJ, Copelane NG, Avoustin P, and Pontarotti P, 1995. Localization of new genes and markers to the distal part of the human major histocompatibility complex (MHC) region and comparison with the mouse: new insights into the evolution of mammalian genomes. Genomics 26:9–20. Briles WE, 1954. Evidence for overdominance of the B blood group alleles in the chicken. Genetics 39:961–962. Briles WE, Goto RM, Auffray C, and Miller MM, 1993. A polymorphic system related to but genetically independent of the chicken major histocompatibility complex. Immunogenetics 37:408–414. Edwards SV, Wakeland EK, and Potts WK, 1995. Contrasting histories of avian and mammalian Mhc genes revealed by class II B sequences from songbirds. Proc Natl Acad Sci USA 92:12200–12204. Ellis DH, Gee GF, and Mirande CM, 1996. Cranes: their biology, husbandry and conservation. Washington, D.C.: Department of the Interior, National Biological Service. Emara MG, Nestor KE, and Bacon LD, 1993. The turkey

major histocompatibility complex: characterization by mixed lymphocyte, graft vs. host splenomegaly and skin graft rejections. Poult Sci 72:60–66. Flajnik MF, Kasahara M, Shum BP, Salter-Cid L, Taylor E, and Du Pasquier L, 1993. A novel type of class I gene organization in vertebrates: a large family of non-MHClinked class I genes is expressed at the RNA level in the amphibian Xenopus. EMBO J 12:4385–4396. Fulton JE, Thacker EL, Bacon LD, and Hunt HD, 1995. Functional analysis of avian class I ( BFIV) glycoproteins by epitope tagging and mutagenesis in vitro. Eur J Immunol 25:2069–2076. Goto R, Miyada CG, Young S, Wallace RB, Abplanalp H, Bloom SE, Briles WE, and Miller MM, 1988. Isolation of a cDNA clone from the B-G subregion of the chicken histocompatibility (B) complex. Immunogenetics 27: 102–109. Guillemot F, Billault A, Pourquie O, Behar G, Chausse A-M, Zoorob R, Kreibich G, and Auffray C, 1988. A molecular map of the chicken major histocompatibility complex: the class II b genes are closely linked to the class I genes and the nucleolar organizer. EMBO J 7: 2775–2785. Hashimoto K, Hirai M, and Kurosawa Y, 1995. A gene outside the human MHC related to classical HLA class I genes. Science 269:693–695. Henry J, Ribouchon M-T, Depetris D, Mattei M-G, Offer C, Tazi-Ahini R, and Pontarotti P, 1997. Cloning, structural analysis and mapping of the B30 and B7 multigenic families to the major histocompatibility complex (MHC) and other chromosomal regions. Toward the identification of the ancestral MHC. Immunogenetics 46:383–385. Jack LJ and Mather IH, 1990. Cloning and analysis of cDNA encoding bovine butyrophilin, an apical glycoprotein expressed in mammary tissue and secreted in association with the milk-fat globule membrane during lactation. J Biol Chem 265:14481–14486. Jarvi SI, Gee GF, Miller MM, and Briles WE, 1995. A complex alloantigen system in Florida sandhill cranes Grus canadensis pratensis: evidence for the major histocompatibility (B) system. J Hered 86:348–353.

Jarvi SI, Goto RM, Briles WE, and Miller MM, 1996. Characterization of Mhc genes in a multigenerational family of ring-necked pheasants. Immunogenetics 43: 125–135.

Fullan A, Mapa FA, Moore T, Thomas W, Loeb DB, Harmon C, Tsuchihashi Z, Wolff RK, Schatzman RC, and Feder JN, 1997. A 1.1-Mb transcript map of the hereditary hemochromatosis locus. Genome Res 7:441–456.

Kaufman J and Wallny HJ, 1996. Chicken MHC molecules, disease resistance and the evolutionary origin of birds. Curr Top Microbiol Immunol 212:129–141.

Shiina T, Hanzawa K, Mizutana M, and Watanabe S, 1995. RFLP analysis of Japanese quail’s genomic DNA using chicken’s MHC class I probe. Jpn Poult Sci 32: 415–419.

Krajewski C and Fetzner JW Jr, 1994. Phylogeny of cranes (Gruiformes: Gruidae) based on cytochrome b DNA sequences. Auk 111:351–365. Miller MM, Abplanalp H, and Goto R, 1988. Genotyping chickens for the B-G subregion of the major histocompatibility complex using restriction fragment length polymorphisms. Immunogenetics 28:374–379. Miller MM, Goto R, Young S, Chirivella J, Hawke D, and Miyada G, 1991. Immunoglobulin variable-region-like domains of diverse sequence within the major histocompatibility complex of the chicken. Proc Natl Acad Sci USA 88:4377–4381. Miller MM, Goto R, Bernot A, Zoorob R, Auffray C, Bumstead N, and Briles WE, 1994. Two Mhc class I and two Mhc class II genes map to the chicken Rfp-Y system outside the B complex. Proc Natl Acad Sci USA 91: 4397–4401. Mustonen J, Partanen J, Kanerva M, Pietila K, Vapalahti O, Pasternack A, and Vaheri A, 1996. Genetic susceptibility to severe course of nephropathia epidemica caused by Puumala hantavirus. Kidney International 49:217–221. Ota M, Miyake S, and Yuasa Y, 1993. Optimization of nonradioisotopic single strand conformation polymorphism analysis with a conventional minislab gel electrophoresis apparatus. Anal Biochem 213:19–22. Pham-Dinh D, Mattei MG, Nussbaum JL, Roussel G, Pontarotti P, Roeckel, N, Mather IH, Artzt K, Lindahl KF, and Dautigny A, 1993. Myelin/oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex. Proc Natl Acad Sci USA 90:7990–7994. Ruddy DA, Kronmal GS, Lee VK, Mintier GA, Quintana L, Domingo R Jr, Myer NC, Irrinki A, McClelland EE,

Thacker EL, Fulton JE, and Hunt HD, 1995. In vitro analysis of a primary, major histocompatibility complex (MHC)-restricted, cytotoxic T-lymphocyte response to avian leukosis virus (ALV), using target cells expression MHC class I cDNA inserted into a recombinant ALV vector. J Virol 69:6439–6444. Thursz MR, Thomas HC, Greenwood BM, and Hill AVS, 1997. Heterozygote advantage for HLA class-II type in hepatitis B virus infection. Nat Genet 17:11–12. Vernet C, Boretto J, Mattei MG, Takahashi M, Jack LJW, Mather IH, Rouquier S, and Pontarotti P, 1993. Evolutionary study of multigenic families mapping close to the human MHC class I region. J Mol Evol 37:600–612. Vincek V, Klein D, Graser RT, Figueroa F, O’hUigin C, and Klein J, 1995. Molecular cloning of major histocompatibility complex class II B gene cDNA from the Bengalese finch Lonchura striata. Immunogenetics 42:262– 267. Wittzell H, von Schantz T, Zoorob R, and Auffray C, 1994. Molecular characterization of three Mhc class II B haplotypes in the ring-necked pheasant. Immunogenetics 39:395–403. Wittzell H, von Schantz T, Zoorob R, and Auffray C, 1995. Rfp-Y-like sequences assort independently of pheasant Mhc genes. Immunogenetics 42:68–71. Zhu J, Nestor KE, and Tang Y, 1996. Frequencies and genetic diversity of major histocompatibility complex class II haplotypes in commercial turkey lines. Poult Sci 75:954–958. Received November 12, 1997 Accepted April 30, 1998 Corresponding Editor: Stephen E. Bloom

Jarvi et al • B-G-like and MHC Class I Genes in Cranes 159