Identification of a novel molecular partner of the E2A gene in ... - Nature

Leukemia (1999) 13, 369–375  1999 Stockton Press All rights reserved 0887-6924/99 $12.00 http://www.stockton-press.co.uk/leu

Identification of a novel molecular partner of the E2A gene in childhood leukemia F Brambillasca1, G Mosna1, M Colombo1, A Rivolta2, C Caslini2, M Minuzzo1, G Giudici2, L Mizzi1, A Biondi2 and E Privitera1 1

Dipartimento di Genetica e di Biologia dei Microrganismi, Universita` di Milano; and 2Clinica Pediatrica Universita` di Milano, Ospedale San Gerardo, Monza, Italy

The ‘promiscuous’ E2A gene, at 19p13.3, is fused with two different molecular partners, PBX1 and HLF, following two chromosome translocations recurrent in childhood pre-B ALL. We have identified a novel gene, FB1, by virtue of its fusion with E2A and by a combination of molecular techniques. FB1 was localized on 19q13.4, suggesting that the novel chimera originated by a cryptic rearrangement of chromosome 19. Two FB1 transcripts, of 1.2 kb and 1.1 kb, are differentially expressed at low level in a variety of human tissues, including hemopoietic cell lines from different lineages. Accordingly, FB1 cDNA displays high homology with a number of cDNA clones from different human tissues. High homology was found also with cDNA clones from mouse and rat, suggesting that the sequence might be conserved at least among mammals. The function of the putative FB1 protein, however, is currently unknown as database sequence comparisons have failed to reveal strong homology with known proteins. The E2A/FB1 fusion appears to be a recurrent feature of pre-B ALLs, suggesting that it might have a role in the development and/or progression of leukemogenesis. Keywords: pre-B ALL; E2A; fusion genes

Introduction A number of genes involved in chromosome alterations associated with leukemias display a ‘promiscuous’ feature, in that they can be fused to different molecular partners. This peculiarity has highly increased the chances of isolating new genes involved in leukemogenesis. The E2A gene, on chromosome band 19p13.3, has been found frequently rearranged in childhood pre-B cell acute lymphoblastic leukemia (ALL) and fused to two different molecular partners PBX1 and HLF following the chromosome translocations t(1;19)(q23;p13) and t(17;19)(q22;p13), respectively.1–7 E2A encodes for proteins (E47/E12/E2–5) belonging to a family of eukaryotic transcriptional regulators characterized by the basic helix–loop–helix motif.8 PBX1 and HLF, identified by virtue of their rearrangement with E2A, appear to be transcriptional regulators as well. PBX1 encodes for proteins belonging to a small subclass of the homeodomain family whose expression is observed in a wide variety of adult tissues with the exception that PBX1 is absent in lymphoid cells.4,5 HLF encodes for proteins of the PAR subfamily of the bZip transcription factors and is not expressed in lymphocytes, as well.6,7 The genomic breakpoints leading to the t(1;19) generally occur in one intron of E2A (intron 13), but rare exceptions.9–11 As to PBX1, the breakpoints are similarly clustered in one intron and the gene exonic structure provides the in-frame fusion with the E2A coding sequence.12 More complex rearrangements occur at the genomic breakpoints of the

Correspondence: E Privitera, Dipartimento di Genetica e di Biologia dei Microrganismi, Via Celoria 26, 20133 Milano, Italy; Fax: 39 02 266 4551 Received 26 October 1998; accepted 18 November 1998

t(17;19), with the involvement of either E2A exon 12 or exon 13, the splicing of a cryptic exon and the addition of random nucleotides that provide the maintenance of the open reading frame in the chimeric mRNA.6,7,13 The chimeric genes E2A-PBX1 and E2A-HLF are expressed in chimeric proteins that retain the transactivation domain of E2A but substitute either the homeobox domain of PBX1 or the bZip domain of HLF for the bHLH domain of E2A,4–7 displaying altered transcriptional properties and transforming potential in NIH 3T3 cells.7,14–21 The E2A proteins are widely expressed and form heterodimers with tissue-restricted bHLH partners, that may influence their DNA-binding affinity. They are involved in differentiation of skeletal muscles, in transcriptional activation of pancreatic and immunoglobulin genes and in cell cycle regulation.22–24 Recently it has been reported that E2A knockout mice fail in developing mature B cells and that the B cellspecific factor BCF1 results from B cell-restricted E2A homodimeric complexes (E47), suggesting that E2A plays a crucial role in B cell differentiation.25–27 Here we report the molecular identification of a novel gene, FB1 at 19q13.4, by virtue of its fusion with E2A in childhood pre-B cell ALL. Materials and methods

PCR based techniques RT-PCR: Total RNA was extracted from cryopreserved PB samples of leukemia cases or from cell lines by the method of Chomczynski and Sacchi.28 cDNA was synthesized from 0.5–1 ␮g of total RNA with SuperScript II reverse transcriptase (200 U) (BRL, Life Technologies, Gaithersburg, MD, USA) in PCR buffer containing random examers (100 pmol) and deoxynucleotide triphosphates (250 ␮m) at 37°C for 1 h (final reaction volume, 20 ␮l). For amplification of the cDNA fragments, 2 ␮l of cDNA were added to PCR buffer containing dNTPs (200 ␮m) and specific oligoprimers (10 pmol each) in a final volume of 50 ␮l. Finally, Taq polymerase (Gold; Perkin Elmer, Branchburg, NJ, USA) and oil were added and amplification was performed for 30–35 cycles by a step-wise program using annealing temperatures specific for each couple of oligoprimers. Similarly, amplification of genomic DNA fragments was performed using 10–100 ng of template. Amplified products were subjected to agarose gel electrophoresis, transferred to nylon filters and hybridized to specific oligoprobes labelled by non-isotopic systems (ECL 3⬘-oligolabelling and detection systems, Amersham, Bucks, UK). 3⬘ RACE: An oligo(dT)-adaptor was used to synthesize the cDNA. Amplification was then achieved by using a sense

A novel molecular partner of the E2A gene F Brambillasca et al

370

primer on E2A (E5) and the adaptor primer (Marathon cDNA amplification kit; Clontech, Palo Alto, CA, USA).

5⬘ RACE: cDNA synthesis was performed by an antisense specific primer (XAN) and the cDNA was tailed by TdT. An oligo(dG) + adaptor primer coupled with a specific nested primer (X3) were used for PCR. A second round of amplification was performed by the adaptor primer and an X3 nested primer (X4) (5⬘ RACE System; Life Technologies).

Fluorescence in situ hybridization (FISH) FISH experiments were performed essentially as described.29 Total yeast DNA was extracted from the two positive clones and labelled with biotin-16-dUTP (Boehringer, Mannheim, Germany). Hybridization signals were detected by FITC conjugated avidin (Vector, Burlingame, CA, USA) and the chromosomes were counterstained with propidium iodide.

Molecular marker analysis Oligonucleotides All the FB1 and E2A oligonucleotides used in this study are shown in Table 1. A few of them were used both as primers and as probes, as indicated in the text.

Cloning and sequencing Amplification products were sequenced either after single band purification by agarose gel (Gel Nebulizer, Micropure, Microcon system; Amicon, Beverly, MA, USA) or after cloning in TA vector (Topo TA cloning kit, Invitrogen, Leek, The Netherlands). In the latter case the clones were screened by hybridization with specific oligoprobes. Sequencing was performed by Thermosequenase sequencing kit (Amersham) or by Circumvent Thermal Cycle Sequencing Kit (Biolabs, Beverly, MA, USA). The sequence obtained was submitted to computer analysis (BLAST n, x, p and FASTA), and finally to GenBank (FB1 cDNA, accession number Banklt 176430 AF052052).

YAC library screening CEPH human Mega-YAC library pools (provided by the Italian Genome Resource Center, IGER) were screened by PCR using the oligoprimers XA and X2 to detect FB1 specific YACs Two positive YACs, 902b2 and 928a10, were identified and used as probes in FISH experiments.

Table 1

DataBank research failed in finding the position of YAC 902b2 on the chromosome 19 integrated map. However, reported Alu-PCR hybridization data (CEPH Genethon data) indicated that it contains sequences from YAC 955g11, that in turn shares sequences with YACs 744a11 and 171b11. These two YACs have been localized on 19q13.4.30 To verify the position of YAC 902b2, we selected five molecular markers spanning a chromosome region of about 5 Mb flanking the two mapped YACs. For each marker, specific oligoprimers were obtained and used in PCR experiments to test the DNA from YAC 902b2 and 928a10. Wild-type DNA was used as positive control, meanwhile YAC clones specific for a chromosome other than 19 were used as negative control.

Northern blot analysis Northern blot (Multiple Choice Northern blot; OriGene, Rockville, MD, USA) prepared with 2 ␮g of Poly A+ RNA from different human tissues was hybridized according to the suggestions of the manufacturer. 2 ␮g of Poly A+ was purified from different hemopoietic cell lines (Dynabeads mRNA purification kit, Dynal, Oslo, Norway) and similarly subjected to Northern analysis. A 547 bp fragment of the FB1 cDNA was amplified by the oligoprimers XD and X4, purified from agarose gel, radiolabelled and used as probe. Hybridization with ␤-actin cDNA was similarly performed as a control of the RNA amount loaded.

FB1 and E2A oligonucleotides used in this study

FB1 oligos

E2A oligos

sense

sense

XD 5⬘AGGGCTCCGGAGCGAGATG3⬘

E5 5⬘TGCACAACCACGCGGGCCCTC3⬘ E5N 5⬘CCCTCCCCAGCCAGCCAGGC

XA 5⬘GCACCCCCAGAACCCGGCA3⬘ XSE 5⬘TAAGGTTGAGGAAGACTTTGG3⬘ antisense

antisense

XAN 5⬘TGGGGTCAGTTTATTGGGCATC3⬘

EANTI 5⬘TAGGAGTCGGGAGGCCGAGA3⬘ E3 5⬘CTTCTCCTCCTCCGAGTGGT3⬘

X2 5⬘GGTCGGGTAGGGCAGCAGTTT3⬘ X3 5⬘AGCAGTTTGTCTGGACCCCGAGAAACC3⬘ X4 5⬘ACCCCGAGAAACCCAACTGG3⬘ X1 5⬘CCTCATCTGCTTCAAAGCCA3⬘


Results

cDNA identification

Identification of novel chimeric transcripts

To extend upstream the new sequence we performed 5⬘ RACE experiments on cord blood RNA, using progressively more upstream primers to sequence the amplification products. 5⬘ RACE experiments were repeated twice, all the amplified products were sequenced both directly and after cloning and the sequences obtained were compared to discriminate Taq polymerase errors. Figure 3 shows the cDNA sequence obtained (1077 bp) and the amino acid sequence (253 aa) of the putative protein based on the longest ORF identified (759 bp). This new sequence was submitted to GeneBank as FB1 (see Materials and methods). GeneBank homology search (BLASTn, FASTA) identified high homology (from 94% to 100%) between FB1 5⬘ and/or 3⬘ regions (196 bp to 463 bp long) and EST (expressed sequence tags) from a variety of human tissues. High homology (79% to 85%) was also found with a few clones from mouse and rat. However, the predicted amino acid sequence did not show significative homology with currently known proteins (BLAST x and p).

By molecular screening of pediatric cases of pre-B cell acute lymphoblastic leukemia (ALL), performed both on DNA by Southern analysis and on RNA by RT-PCR analysis as previously reported,31 we identified a case that displayed a rearrangement of the E2A gene but no evidence of the chimeric transcripts E2A-PBX1 or E2A-HLF. Arguing that the observed E2A rearrangement might be due to the fusion between E2A and a gene other than PBX1 or HLF, we performed 3⬘ RACE using an oligoprimer (E5) specific for the E2A portion that is consistently maintained in the known chimeras. This analysis identified a chimeric fragment that showed the 5⬘ portion of E2A interrupted at the end of exon 13 and fused to a 148 bp sequence displaying a few stop codons in frame with the E2A coding sequence and a polyadenylation signal located 13 bp upstream the poly(A) tail (Figure 1). The presence of the chimeric transcripts in the RNA from our case was confirmed using the E5 sense primer (on E2A exon 13) and the X2 antisense primer (on the new sequence), followed by a nested PCR with the primers E5N and X3. The primers XSE and X2 were used to amplify a 94 bp fragment specific for the novel sequence, that was found to be expressed in all the samples tested, including RNA from a control cell line (K562) and from cord blood (data not shown). Additional pre-B ALL cases were similarly investigated by RT-PCR to test the recurrence of the novel chimera in pediatric leukemia. Three additional cases displaying E2A-FB1 chimeric transcripts were identified and the amplified products were cloned and sequenced. Different junction sites were detected in the different cases, being the (Figure 2b) junction detected in two cases. Figure 2 shows a schematic representation of the E2A-FB1 junctions so far identified. In one case FB1 appears to be fused in-frame with the coding sequence of E2A (Figure 2c), while the remaining cases show out of frame fusions leading to the occurrence of stop codons on FB1 and to truncation of the predicted chimeric products. The presence of reciprocal FB1-E2A chimeric transcripts was similarly investigated by RT-PCR on the RNA from the cases positive for the E2A-FB1 transcripts. Despite the use of different couples of primers upstream on FB1 and downstream on E2A, we could not obtain any evidence of reciprocal chimeric transcripts.

FB1 localization To localize the FB1 gene, a human YAC library (CEPH MegaYAC library) was screened by PCR using the specific oligoprimers XA and X2. Two positive YACs, 902b2 and 928a10, were detected and used as probes in FISH experiments on both normal lymphocyte metaphases and metaphases from a cell line (697) harboring the t(1;19)(q23;p13). Unfortunately, no cytogenetic data or suitable material for FISH experiments were available from the E2A-FB1 positive cases. YAC 928a10 gave a strong fluorescent signal on chromosome band 1p12–13 and a faint signal on chromosome 19, showing its chimeric feature. YAC 902b2 hybridized only on chromosome 19, band q13. A more precise localization of FB1 was achieved using selected molecular markers from a 5 Mb chromosome region on 19q13.4 (see Materials and methods) (Figure 4). DNA from YACs 902b2 and 928a10 was analyzed by PCR for the presence of these molecular markers and specific amplification products were detected only for D19S572. According to the size of YAC 902b2 (580 kb), FB1 may be located in a region of about 1 Mb spanning the D19S572 locus, about 5 Mb from the 19q telomere.

Figure 1 Schematic representation of the chimeric fragment isolated. The sequence at the joining site (open arrow) shows two stop codons on FB1, next to the joining site. The polyadenylation signal is indicated along with the oligoprimers (arrows) and the oligoprobes used to verify the presence of the chimeric transcript in our case.

371


372

Figure 2 Schematic representation of the different junctions harbored by the E2A-FB1 transcripts from the positive cases so far analyzed. The junctions a (the same reported in Figure 1) and c were detected in one case each, while the type b in two cases. The junctions a and b lead to unscheduled stop codons on FB1, while the junction c gives rise to the in-frame fusion between FB1 and E2A.

FB1 expression pattern We tested the presence of FB1 transcripts by RT-PCR on RNA from a few hemopoietic cell lines (BJAB, K562, U937), from cell lines from different tissue tumors (HeLa from carcinoma of uterus, HepG2 from hepatocarcinoma, PC3 from prostate tumor, G1O3 and T4 from gliomas) and from fetal brain and cord blood. Similarly RNA from peripheral blood mononuclear cells from a few leukemia patients (four patients with t(1;19) positive pre-B ALL, one patient with t(17;19) positive pre-B ALL and two patients with JMML) were also tested. FB1 specific amplification products were detected in all the samples (data not shown). Northern blot analysis of poly(A) RNA from different human tissues and from different hematopoietic cell lines was performed as well. The blot was hybridized with both an FB1 cDNA probe (Figure 3) and a ␤-actin probe. Figure 5a shows the results of the analysis on adult brain, heart, kidney, spleen, liver and colon; Figure 5b shows the results on U937 (monocytes), 697 (t(1;19) positive pre-B cells), BJAB (B lymphocytes), K562 (erythroblasts), Molt 4 (T lymphocytes) cell lines. Two different transcripts of about 1.2 kb and 1.1 kb appear differentially expressed at low levels in the different tissues tested. The 1.2 kb transcript is mainly represented in liver, colon and K562 cells, while the 1.1 kb transcript is mainly evidenced in brain. In B and T cell lines (697, BJAB, Molt 4) both the transcripts appear to be expressed at similar levels. However, in pre-B cells of the 697 cell line the amount of FB1 transcripts seems to be lower than in the other hemopoietic cell lines tested. Discussion We identified a novel gene, FB1, by virtue of its fusion with the E2A gene and the use of a combination of molecular strategies. Interestingly, FB1 was localized at 19q13.4, in a chromosome region where recent LOH studies have suggested the presence of a number of tumor suppressor genes both in leukemia and in other tumors.32–36 The map position of E2A and FB1, at 19p13.3 and 19q13.4 respectively, suggests that the novel chimera may be the result of a chromosome 19 rearrangement that, due to the poor definition of the 19 telomeres by standard cytogenetics, would

be cryptic. The relevance of cryptic rearrangements in leukemia has been underlined by recent evidences, as in the case of t(12;21), giving rise to the ETV6-AML1 chimera, that has been found the most frequent rearrangement in childhood pre-B ALL by molecular and FISH methods.37 In this view, it might be suggested that other genes involved in cryptic rearrangements with ‘promiscuous’ genes in leukemia may be similarly identified. FB1 expression pattern suggests that the gene may be widely expressed at low levels, as also supported by the high homology found at nucleotide level with a number of cDNA clones from a variety of human tissues. High homology was also found between FB1 and cDNA clones from mouse and rat, suggesting that the gene might be conserved at least among mammals. However, no strong homology was detected with known proteins so that no hypothesis can currently be studied on the function of the predicted FB1 protein. As preliminary data indicate, the E2A-FB1 fusion appears to be a recurrent feature of pre-B ALLs, suggesting the involvement of this rearrangement in the development and/or progression of leukemia. Sequence analysis of the chimeric fragments amplified from the positive cases showed the occurrence of variable junctions between the coding sequence of the two genes. In most cases they result in the occurrence of unscheduled stop codons on FB1 leading to truncation of the predicted fusion proteins. In contrast with that observed for the previously identified E2A chimeras, the E2A-FB1 products would maintain only the transactivation domains of E2A (AD1 and AD2) as a common feature.38 On the other hand, we could not obtain any molecular evidence of the reciprocal FB1-E2A transcripts. This might be due either to the very low level of FB1 expression in pre-B cells, as the Northern analysis on 697 cells seems to indicate (Figure 5b), or to the occurrence of concomitant deletions at the genomic breakpoints. In this scenario, it is presently difficult to suggest a role for the E2A/FB1 fusion in leukemogenesis. It might be hypothesized that the production of truncated E2A proteins might have some role in B cell development, although it does not show any transformation properties in the 3T3 system.22 Indeed, the transactivation domains of E2A have been shown to be essential for the transformation properties of the E2A-PBX1 chimeric proteins, meanwhile the PBX1 homeodomain appears to be dispensable.39 Similarly, AD1 and AD2 have been recently


373

Figure 3 cDNA and predicted amino acid sequence of FB1. The position of the joining sites so far defined is indicated by vertical arrows. Stop codons upstream the putative first methionine codon and the termination codon are evidenced, along with the putative polyadenylation signal Oligoprimers XD (sense) and X4 (antisense) defining the 547 bp fragment used as probe are underlined.


374

Figure 4 Idiogram of chromosome 19 showing the position of the molecular markers used to localize FB1. The gene was mapped on a 1 Mb region flanking the marker D19S572 (evidenced).

found essential for the antiapoptotic role of the E2A-HLF proteins in that they are able to inhibit apoptosis in the context of disabled HLF DNA-binding and protein dimerization regions.40 On the other hand, it cannot be ruled out that the heterozygous disruption of E2A and/or FB1 might affect the balance of protein interactions involved in B cell development. Indeed reported studies on E2A knockout mice have not only assessed that E2A plays a crucial role in B cell development but also that the alteration of one E2A allele cannot be compensated by the normal one and that the levels of E2A are rate limiting in the development of B cells.25,26 Extensive molecular screening of ALL cases and further studies at protein level will clarify the role of the FB1 gene and of the novel E2A chimera and might also provide important insights into the mechanisms by which E2A alterations affect the B cell development. Acknowledgements This work was supported by grants from the Associazione Italiana per la Ricerca sul Cancro (AIRC) (to EP and AB) and from Consiglio Nazionale delle Ricerche (CNR) (CT04 9603149 to EP and PF39 9202140 to AB) and by Fondazione Tettamanti. We thank Dr AT Look and RA Ashmum (St Jude Children’s Research Hospital, Memphis, TN) for providing the 697 cell line, Dr I Magnani (Dip di Genetica per le Scienze Mediche, Universita` di Milano) for providing the cell lines G103 and T4 and Dr G Caretti for providing the cell lines HepG2 and PC3. We greatly appreciate the collaboration of The Italian Genome Resources Center (IGeR, Biomedical Science Park,

Figure 5 Northern blot analysis of poly(A) RNA from different human tissues (a) and from hemopoietic cell lines from different lineages (b). A 547 bp fragment from FB1 cDNA was used as probe and the detected transcripts are indicated. Long exposure time were needed for the detection of these bands. ␤-Actin hybridization results are shown for each blot as well. (a) Lanes 1 to 6 contain 2 ␮g of poly(A) RNA from brain, heart, kidney, spleen, liver and colon, respectively (Multiple Choice Northern Blot, Origene). (b) Lane 1 contains total RNA (5 ␮g) from U937 cells as a control. Lanes 2 to 6 contain 2 ␮g of poly(A) RNA from U937 (monocytes), 697 (t(1;19)+ pre-B cells), BJAB (B cells), K562 (erythroblasts) and Molt (T cells) cell lines.

Milano) for providing the CEPH Mega-YAC library pools and the YACs used in this study. References 1 Raimondi SC. Current status of cytogenetic research in childhood acute lymphoblastic leukemia. Blood 1993; 81: 2237–2251. 2 Hunger SP. Chromosomal translocations involving the E2A gene in acute lymphoblastic leukemia: clinical features and molecular pathogenesis. Blood 1996; 87: 1211–1224. 3 Mellentin JD, Murre C, Donlon TA, McCaw PS, Smith SD, Carrol AJ, McDonald ME, Baltimore D, Cleary ML. The gene for enhancer binding proteins E12/E47 lies at the t(1;19) breakpoint in acute leukemias. Science 1989; 246: 379–382. 4 Nourse J, Mellentin JD, Galili N, Wilkinson J, Stanbridge E, Smith SD, Cleary ML. Chromosomal translocation t(1;19) results in synthesis of a homeobox fusion mRNA that codes for a potential chimeric transcription factor. Cell 1990; 60: 535–545. 5 Kamps MP, Murre C, Sun X-H, Baltimore DA. A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B ALL. Cell 1990; 60: 547–555. 6 Inaba T, Roberts WM, Shapiro LH, Jolly KW, Raimondi SC, Smith SD, Look AT. Fusion of the leucine zipper gene HLF to the E2A


7

8

9

10

11 12

13 14 15

16

17 18

19

20

21

22

gene in human acute B-lineage leukemia. Science 1992; 257: 531–534. Hunger SP, Ohyashiki K, Toyama K, Cleary ML. Hlf, a novel hepatic bZIP protein, shows altered DNA-binding properties following fusion to E2A in t(17;19) acute lymphoblastic leukemia. Genes Dev 1992; 6: 1608–1620. Murre C, McCaw PS, Vaessin H, Caudy M, Jan LY, Jan YN, Cabrera CV, Buskin JN, Hauschka SD, Lassar AB, Weintraub H, Baltimore D. Interaction between heterologous helix–loop–helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 1989; 58: 537–544. Hunger SP, Galili N, Carrol AJ, Crist WJ, Link MP, Cleary ML. The t(1;19)(q23;p13) results in consistent fusion of E2A and PBX1 coding sequences in acute lymphoblastic leukemias. Blood 1991; 77: 687–693. Privitera E, Kamps MP, Hayashi Y, Inaba T, Shapiro LH, Raimondi SC, Behm F, Hendershot L, Carrol AJ, Baltimore D, Look AT. Different molecular consequences of the 1;19 chromosomal translocation in childhood B cell precursor acute lymphoblastic leukemia. Blood 1992; 79: 1781–1788. Numata S-I, Kato K, Horibe K. New E2A/PBX1 fusion transcript in a patient with t(1;19)(q23;p13) acute lymphoblastic leukemia. Leukemia 1993; 7: 1441–1444. Mellentin JD, Nourse J, Hunger SP, Smith SD, Cleary ML. Molecular analysis of the t(1;19)(q23;p13) breakpoint cluster region in pre-B cell acute lymphoblastic leukemias. Genes Chromos Cancer 1990; 2: 239–247. Hunger SP, Devarai PE, Foroni L, Sacker-Walker LM, Cleary ML. Two types of genomic rearrangements create alternative E2A-HLF fusion proteins in t(17;19)-ALL. Blood 1994; 83: 2970–2977. Inukai T, Inaba T, Yoshihara T, Look AT. Cell transformation mediated by homodimeric E2A-HLF transcription factors. Mol Cell Biol 1997; 17: 1417–1424. Hunger SP, Brown R, Cleary ML. DNA-binding and transcriptional regulatory properties of hepatic leukemia factor (HLF) and the t(17;19) acute lymphoblastic leukemia chimera E2A-HLF. Mol Cell Biol 1994; 14: 5986–5996. Kamps MP, Look AT, Baltimore D. The human t(1;19) translocation in pre-B ALL produces multiple nuclear E2A-Pbx1 fusion proteins with differing transforming potentials. Genes Dev 1991; 5: 358–368. Fu X, Kamps MP. E2a-Pbx1 induces aberrant expression of tissue specific developmentally regulated genes when expressed in NIH3T3 fibroblasts. Mol Cell Biol 1997; 17: 1503–1512. Knoepfler PS, Kamps MP. The highest affinity DNA element bound by Pbx complexes in t(1;19) leukemic cells fails to mediate cooperative DNA-binding or cooperative transactivation by E2a-Pbx1 and class I Hox proteins – evidence for selective targetting of E2aPbx1 to a subset of Pbx-recognition elements. Oncogene 1997; 14: 2521–2531. Inaba T, Inukai T, Yoshihara T, Seyschab H, Ashmun RA, Canman CE, Laken SJ, Kastan MB, Look AT. Reversal of apoptosis by the leukemia-associated E2A-HLF chimaeric transcription factor. Nature 1996; 382: 541–544. Altura RA, Inukai T, Ashmun RA, Zambetti GP, Roussel MF, Look AT. The chimeric E2A-HLF transcription factor abrogates p53induced apoptosis in myeloid leukemia cells. Blood 1998; 92: 1397–1405. De Lau WB, Hurenkamp J, Berendes P, Touw IP, Clevers HC, van Dijk MA. The gene encoding the granulocyte colony-stimulating factor receptor is a target for deregulation in pre-B ALL by the t(1;19)-specific oncoprotein E2A-Pbx1. Oncogene 1998; 17: 503–510. Peverali FA, Ramqvist T, Saffric R, Pepperkok R, Barone MV, Phil-

23 24 25

26 27 28 29

30 31

32

33

34 35

36

37

38

39

40

ipson L. Regulation of G1 progression by E2A and Id helix–loop– helix proteins. EMBO J 1994; 13: 4291–4301. Baker SJ, Reddy EP. B cell differentiation: role of E2A and Pax5/BSAP transcription factors. Oncogene 1995; 11: 413–426. Prabhu S, Ignatova A, Park ST, Sun XH. Regulation of the expression of cyclin dependent kinase inhibitor p21 by E2A and Id proteins. Mol Cell Biol 1997; 17: 5888–5896. Bain G. Maandag ECR, Izon DJ, Amsen D, Kruisbeek AM, Weintraub BC, Krop I, Schlissel MS, Feeney AJ, vanRoon M, van der Valk M, te Riele HPJ, Berns A, Murre C. E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell 1994; 79: 885–892. Zhuang Y, Soriano P, Weintraub H. The helix–loop–helix gene E2A is required for B cell formation. Cell 1994; 79: 875–884. Shen C-P, Kadesch T. B-cell-specific DNA binding by an E47 homodimer. Mol Cell Biol 1995; 15: 4518–4524. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-cloroform extraction. Anal Biochem 1987; 162: 156–160. Tosi S, Giudici G, Mosna G, Harbott J, Specchia G, Grosveld G, Privitera E, Kearney L, Biondi A, Cazzaniga G. Identification of new partner chromosomes involved in fusions with the ETV6 (Tel) gene in hematologic malignancies. Genes Chromos Cancer 1998; 21: 223–229. www-bio.llnl.gov/bbrp/genome. Privitera E, Luciano A, Ronchetti D, Arico` M, Santostasi T, Basso G, Biondi A. Molecular variants of the 1;19 chromosomal translocation in pediatric acute lymphoblastic leukemia (ALL). Leukemia 1994; 8: 554–559. Takeuchi S, Bartram CR, Wada M, Reiter A, Hatta Y, Seriu T, Lee E, Miller CW, Miyoshi I, Koeffler HP. Allelotype analysis of childhood acute lymphoblastic leukemia. Cancer Res 1995; 55: 5377–5382. Maintz D, Fiedler K, Koopmann J, Rollbrocker B, Nechev S, Lenartz D, Stangl AP, Louis DN, Schramm J, Wiestler OD, von Deimling A. Molecular genetic evidence for subtypes of oligoastrocytomas. J Neuropathol Exp Neurol 1997; 56: 1098–1104. Bicher A, Adult K, Kimmelman A, Gershenson D, Reed E, Liang B. Loss of heterozygosity in human ovarian cancer on chromosome 19q. Gynecol Oncol 1997; 66: 36–40. McDonald JM, Douglass EC, Fisher R, Geiser CF, Krill CE, Strong LC, Virshup D, Huff V. Linkage of familial Wilms’ tumor predisposition to chromosome 19 and two-locus model for the etiology of familial tumors. Cancer Res 1998; 58: 1387–1390. Mehenni H, Blouin J-L, Radhakrishna U, Bhardwaj SS, Bhardwaj K, Dixit VB, Richards KF, Bermejo-Fenoll A, Leal AS, Raval RC, Antonarakis SE. Peutz–Jeghers syndrome. Confirmation of linkage to chromosome 19p13.3 and identification of a potential second locus, on 19q13.4. Am J Hum Genet 1997; 61: 1327–1334. Romana SP, Poirel H, Leconiat M, Flexor MA, Mauchauffe` M, Jonveaux P, Macyntire EA, Berger R, Bernard OA. High frequency of t(12;21) in childhood B-lineage acute lymphoblastic leukemia. Blood 1995; 86: 4263–4267. Aronheim A. Shiran R, Rosen A, Walker MD. The E2A gene product contains two separable and functionally distinct transcription activation domains. Proc Natl Acad Sci USA 1993; 90: 8063– 8067. Monika K, LeBrun DP, Dedera DA, Brown R, Cleary ML. Transformation properties of the E2a-Pbx1 chimeric oncoprotein: fusion with E2a is essential, but the Pbx1 homeodomain is dispensable. Mol Cell Biol 1994; 14: 8304–8310. Inukai T, Inaba T, Ikushima S, Look AT. The AD1 and AD2 transactivation domains of E2A are essential for the antiapoptotic activity of the chimeric oncoprotein E2A-HLF. Mol Cell Biol 1998; 18: 6035–6043.

375