Identification of a putative human mitochondrial thymidine ...

Identification of a putative human mitochondrial thymidine monophosphate kinase associated with monocytic/macrophage terminal differentiation

Y-L X Original Human XX Chen mitochondrial Articles etAuthors al. TMPK Blackwell Malden, Genes GTC © 1365-2443 1356-9597 Journal > 2008 tocompilation The USA Cells Publishing ©Inc 2008 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Yen-Ling Chen†, Da-Wei Lin† and Zee-Fen Chang* Graduate Institute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, No. 1, Section 1, Jen-Ai Road, Taipei 100,Taiwan

Mitochondrial DNA synthesis requires the supply of thymidine triphosphate (dTTP) independent of nuclear DNA replication. In resting and differentiating cells that withdraw from the cell cycle, mitochondrial thymidine kinase 2 (TK2) mediates thymidine monophosphate (dTMP) formation for the dTTP biosynthesis in mitochondria. However, a thymidine monophosphate kinase (TMPK) that phosphorylates dTMP to form thymidine diphosphate (dTDP) in mitochondria remains undefined. Here, we identified an expressed sequence tag cDNA, which encodes a TMPK with a mitochondrial import sequence at its N-terminus designated as TMPK2. HeLa cells expressing TMPK2 fused to green fluorescent protein (GFP) displayed green fluorescence in mitochondria. Over-expression of TMPK2 increased the steady-state level of cellular dTTP and promoted the conversion of radioactive labeled-thymidine and -dTMP to dTDP and dTTP in mitochondria. TMPK2 RNA was detected in several tissues and erythroblastoma cell lines. We also generated TMPK2 antibody and used it for immunofluorescence staining to demonstrate endogenous expression of TMPK2 in mitochondria of erythroblastoma cells. Finally, we showed that TMPK2 protein expression was upregulated in monocyte/macrophage differentiating cells, suggesting the coordinated regulation of TMPK2 expression with the terminal differentiation program.

Introduction In eukaryotic cells, DNA synthesis can occur in mitochondrial and nuclear compartments, separately (Bogenhagen & Clayton 1977) .The supply of thymidine triphosphate (dTTP) for DNA synthesis is dependent on the de novo and salvage pathways. In the de novo pathway, thymidylate synthase (TS) catalyzes the rate-limiting step of converting dUMP to thymidine monophosphate (dTMP). In the salvage pathway, thymidine kinase (TK) is the key enzyme responsible for dTMP formation from thymidine. There are two TK isoforms in eukaryotic cells, one is cytoplasmic TK1 and the other is mitochondrial TK2 (Johansson & Karlsson 1997; Wang & Eriksson 2000). Thymidine monophosphate kinase (TMPK), also known as thymidylate kinase, phosphorylates dTMP either from TK-mediated salvage pathway or from TS-mediated de novo pathway in

Communicated by: Carl-Henrik Heldin *Correspondence: Email: [email protected] † These authors made equal contributions to the work.

all living cells to give thymidine diphosphate (dTDP), which is subsequently converted to dTTP by nucleotide diphosphate kinase for DNA synthesis. Therefore, the function of TMPK is essential for dTTP synthesis (Lee & Cheng 1977; Van Rompay et al. 2000). In proliferating cells, the expression levels of TS, TMPK and TK1 in the cytoplasm are increased in the S phase to coordinate with genomic DNA replication for cell proliferation (Coppock & Pardee 1987; Huang et al. 1994; Ke & Chang 2004). Unlike nuclear DNA synthesis, mitochondrial DNA replication is uncoupled with the S phase progression (Bogenhagen & Clayton 1977). In growing cells, dTDP synthesized in the cytoplasm is transported into mitochondrial matrix and converted to dTTP synthesis by mitochondrial NDP kinase (Pontarin et al. 2003). In non-cycling cells, expression levels of ribonucleotide reductase and cytoplasmic TK1 and TS are significantly reduced due to withdrawal from the cell cycle. Therefore, the dTTP supply for mitochondrial DNA replication in differentiating and quiescent cells is mainly dependent on a separate mitochondrial TK2 (Rampazzo et al. 2004; Ferraro et al. 2005). Genetic defect

DOI: 10.1111/j.1365-2443.2008.01197.x © 2008 The Authors Journal compilation © 2008 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Genes to Cells (2008) 13, 679–689

679

Y-L Chen et al.

of TK2 causes mitochondrial DNA depletion syndrome in patients who developed severe myopathy, indicating that TK2-mediated salvage pathway is required for maintaining the integrity of mitochondrial DNA in post-mitotic cells (Saada et al. 2001). Since expression of cytoplasmic TMPK is also downregulated in a cell cycledependent manner (Ke et al. 2005), a TMPK isoform might exist in non-proliferating cells for dTTP synthesis in mitochondria. However, a functional isoform of TMPK localized in mitochondria remains undefined. A recent study has used the mitochondria isolated from mouse liver as an in vitro system to demonstrate that dTMP at the nm range is imported to mitochondria and becomes concentrated at least 100-fold in the mitochondrial matrix through a transport mechanism highly specific to dTMP. Upon imported into mitochondria, dTMP is converted into dTTP, indicating the presence of dTMPK and dTDK kinase inside the mitochondria (Ferraro et al. 2006). In the present study, we reported a novel human mitochondrial TMPK, designated TMPK2. We showed its mitochondrial localization and its functional effect on the steady-state level of cellular dTTP and metabolic conversion of dTDP and dTTP in mitochondria. By generating its specific antibody, we proved the endogenous expression of TMPK2 in erythroblastoma cells and further showed its upregulation associated with monocyte/ macrophage differentiation.

Results Cloning and expression of human mitochondrial TMPK cDNA

By blast search, we found that the predicted amino acid sequences of several human expressed sequence tag cDNA clones deposited in GenBank contain the TMPK functional domain. Among them, two expressed sequence tag (EST) sequences, Loc129607and Hxm059368, encode proteins with a mitochondrial targeting sequence located in their N-terminal regions.The only difference of these two EST sequences encoded proteins is their N-terminus mitochondrial targeting motifs, in which an additional N-terminal 26-amino acid is present in Loc129607 but not Hxm059368 coding sequence. HeLa cells were transfected with pLoc-GFP, pHxm-GFP and pGFP, and the cell lysates were analyzed by Western blot using GFP antibody to detect the GFP-fusion proteins of Loc129607 (Loc-GFP), Hxm059368 (Hxm-GFP) and GFP, respectively (Fig. 1A). By the MitoTracker mitochondrial dye staining and fluorescent microscopic analysis, the results showed that Loc-GFP was distributed in the cytosol in a dotted green fluorescent pattern and co-localized with 680

Genes to Cells (2008) 13, 679– 689

red fluorescence of the MitoTracker dye. In contrast, Hxm-GFP and GFP were distributed in the cytosol and nucleus as well without colocalization signal with MitoTracker staining (Fig. 1B).This suggests that Loc129607 encodes a mitochondrial protein because of an intact signal sequence for mitochondrial import (Fig. 1C). Sequence analysis of N-terminal presequence of TMPK2 by MitoPortII indicated the presence of amphipathic α-helix at the position 4–21 amino acid residues required for mitochondrial import receptor Tom20 (Pfanner 2000) (Fig. 1C). After translocation to mitochondria, the mitochondrial import signal sequence of the imported protein is processed to produce a mature mitochondrial protein (Voos et al. 1999). A matrix processing peptidase cleavage site required for this processing (Schneider et al. 1998) is located at the position of Gly48-Ala49 of Loc129607 encoded protein. Because of a complete TMPK functional domain composed of P-loop, catalytic site and lid motif (Fig. 1D), here we designated Loc129607 encoded protein TMPK2. While this manuscript was in preparation, we found that Hxm059368 was removed from GenBank database. Gene structure and expression of human TMPK2 RNA in tissues and cell lines

The TMPK2 gene is annotated on the Locus 129607 of human genome with five exons and is located on chromosome 2 (2p25.2) (Fig. 2A). Analysis of EST databases by alignment with the corresponding vertebrate homologues revealed that TMPK2 is conserved in higher vertebrate species (Fig. 2B). Semi-quantitative PCR analysis was used to determine the expression levels of TMPK2 and TMPK1 RNA in different tissues.We used a panel of cDNAs synthesized from polyA(+) RNA of different human tissues for PCR reaction using a primer set specific to exons 2 and 3 of TMPK2 (Fig. 3A) to give rise to a single DNA fragment of 395 bp as expected. The results showed that TMPK2 is ubiquitously expressed in different tissues (Fig. 3B). In accordance, TMPK2 sequence is found in the cDNA sequences from various tissues deposited in GenBank. PCR reaction using primer set specific to TMPK1 produced a specific DNA fragment of 268 bp. Using cDNA synthesized from RNA of different human cell lines, including K562, a chronic myeloid leukemia cell line, D2, a GM-CSF-independent erythroblastoma line derived from TF-1,THP1, an acute monocytic leukemia cell line, HEK 293T, an embryonic kidney cell line, HeLa, a cervical cancer cell line, and SH-SY5Y, a neuroblastoma cell line, as the templates for the PCR reaction, we found that TMPK2 RNA was readily detectable in erythroblastoma

© 2008 The Authors Journal compilation © 2008 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Human mitochondrial TMPK

Figure 1 Subcellular localization of GFP-fusion proteins that have TMPK domain with putative mitochondrial targeting sequence. (A) HeLa cells were transfected with pGFP-N1-hxm059368 (Hxm-GFP), pGFP-N1-Loc129607 (Loc-GFP) and pGFP-N1 (GFP) expression plasmids.Western blot analysis of GFP-fusion protein expressed in HeLa cells using antibody against GFP. (B) After transfection for 16 h, cells were stained with MitoTracker and examined by fluorescent microscope. Green: GFP and GFP fusion protein; Red: MitoTracker. (C) N-terminal presequence required for mitochondrial import. Arrow indicates the putative mitochondrial matrix peptidase cleavage site of TMPK2. Amino acid residue in potential α-helix forming peptide is marked by “*”. A helical wheel view of amphipathic α-helix peptide covering 4–21 amino acids of TMPK2. (D) Sequence alignment for the TMPK catalytic domain in Loc129607, Hxm059368 and cytosolic TMPK. P-loop, Putative catalytic site and Lid motif were indicated by “*”. Multiple alignments were performed using CLUSTAL W.


Genes to Cells (2008) 13, 679–689

681

Y-L Chen et al.

Figure 2 Gene structure and vertebrate conservation of TMPK2. (A) The annotated sequence of TMPK2 on the Locus 129607 of human genome, Exons are shown as boxes. (B) Sequence alignment for TMPK2 in higher vertebrate species. P-loop, Putative catalytic site and Lid motif were indicated by “*”. Multiple alignments were performed using CLUSTAL W.

D2, K562 and THP1, but not in HeLa, SH-SY5Y and HEK293T cells (Fig. 3C). Unlike TMPK2 RNA, TMPK1 RNA was detected in all these proliferating cell lines. In contrast with THP1 monocytic leukemia cells that are highly proliferative and express both TMPK1 and TMPK2, 682

Genes to Cells (2008) 13, 679– 689

primary CD14+ monocytes isolated from fresh peripheral blood expressed TMPK2 but not TMPK1. Because TMPK1 RNA expression is cell-cycle-dependent, lack of TMPK1 in monocytes from peripheral blood is due to withdrawal from the cell cycle of these differentiated cells.



Figure 3 Expression of TMPK2 RNA in human tissues and various cell lines. (A) Location of PCR primer set for detecting TMPK2 RNA expression. Oligonucleotide sequences in exons 2 and 3 of TMPK2 as indicated by the arrow were synthesized and specificity of each primer was confirmed with blast analysis. (B) Human multi-tissue cDNAs were subjected to PCR reaction using primer set as described above to have a product size at 395 bp for TMPK2; 268 bp for TMPK1 and 245 bp for GAPDH. N.C.: no template control; P.C. : plasmid control. Asterisk indicates a nonspecific band. (C) RT-PCR reactions were performed with RNAs isolated from the indicated cell lines. Top panel: expression of TMPK2; middle panel: expression of TMPK1 and bottom panel: expression of GAPDH.

Functional effect of ectopic expression of TMPK2 on dTTP formation

In order to ascertain the in vivo function of TMPK2, we ectopically expressed different amounts of TMPK2 in 293T cells and measured the total cellular dNTP levels. Increasing ectopic expression of TMPK2-GFP expanded the dTTP pool size up to 61% (Fig. 4A,B), confirming that TMPK2 is functionally involved in dTTP formation. In the meanwhile, the levels of dGTP, dCTP and dATP were slightly elevated by ectopic expression of TMPK2-GFP. We further isolated mitochondria from cells expressing TMPK2-GFP or GFP.The mitochondria freshly prepared from cells were incubated with H3-thymidine and H3-TMP, separately.After incubation for 10 min, mitochondria were extensively washed for nucleotide extraction. Using TLC to separate thymidine, dTMP, dTDP and dTTP, we determined the amounts of radiolabeled thymidine, dTMP, dTDP and dTTP, and calculated the relative conversion to dTTP and dTDP.The results showed that cells expressing TMPK2-GFP increased conversion of dTMP or thymidine to dTTP and dTDP by twofold, further indicating the functional role of TMPK2 in mitochondria (Fig. 4C). Figure 4 Over-expression of TMPK2 increases the total cellular dTTP pool and mitochondrial dTDP/dTTP conversion. HEK293T cells were transfected with pGFPN1 (GFP) and different amounts of pGFPN1-TMPK2 (TMPK2-GFP) as indicated for 48 h. Cells were harvested for dNTP determination. The results shown represented the average ± SD from three separate experiments. Statistics were conducted as student t-test; *P < 0.1 and **P < 0.05 denote significant differences from control or pEGFP-TMPK2 transfected cells. (B) Cell lysates were analyzed by Western blot using GFP Ab. (C) Mitochondria

prepared from HEK293T cells transfected with control vector or pGFPN1-TMPK2 were incubated with 10 µCi of each [H3]thymidine or [H3]-TMP for 10 min as indicated. Nucleotides were extracted and separated as described in Methods section. Relative conversion of thymidine and dTMP to dTDP and dTTP in mitochondria was calculated by dividing radioactive counts of dTDP and dTTP by total counts of thymidine, dTMP, dTDP and dTTP. The results represented the average from two separate experiments.


Genes to Cells (2008) 13, 679–689

683

Y-L Chen et al.

Figure 5 Reciprocal expression of TMPK1 andTMPK2 during monocytic differentiation. (A) GST-TMPK2 was expressed in BL21 E. coli and purified by Glutathione Sepharose 4B. After purification, GST-TMPK2 was separated by SDS-PAGE and the gel was stained with Coomassie Blue. The gel-purified GST-TMPK2 was then used to generate antiserum against hTMPK2 by immunizing rabbit. (B) Immunostaining of endogenous TMPK2. D2 cells adhering to fibronectin-coated cover slip were immunostained using TMPK2 antibodies with or without GST-TMPK (∆N48) protein neutralization together with MitoTracker for mitochondrial staining. (C) Western blot analysis using TMPK2 antibody. D2 cells treated with 32 nm PMA for 3 days were harvested for Western blot analysis using TMPK2 antibody that had been neutralized with or without purified GST-TMPK2 (∆N48) protein or GST-TMPK1 protein.The same blot was probed with β-tubulin antibody. (D) Differential expression of TMPK1 and TMPK2 during differentiation. RNAs and proteins were prepared from D2 cells after treatment with 32 nm PMA for the indicated time for RT-PCR reaction (upper panel) and Western blot analysis (lower panel), respectively.

Upregulation of TMPK2 during monocyte/ macrophage differentiation

Next, we purified the recombinant TMPK2 protein for generating antibody specifically against human TMPK2 684

Genes to Cells (2008) 13, 679– 689

to verify the existence of endogenous TMPK2 (Fig. 5A). We used this antibody to perform immunostaining of D2 cells, which were plated onto a fibronectin-coated dish to allow cell adhesion and spreading (Fig. 5B). In agreement with the results from the ecotopic expression



of TMPK2-GFP observed in HeLa cells, immunofluorescence staining of D2 cells with TMPK2 antibody detected endogenous TMPK2 in mitochondria.TMPK2 antibody which had been neutralized by recombinant TMPK2 (∆N48) protein, a deleted form at the putative mitochrondrial processing site, was unable to elicit the immunostaining signal in mitochondria, indicating the specific detection of endogenous TMPK2 by this antibody (Fig. 5B). This antibody was also used for Western blot analysis. As expected, a protein at molecular weight of 44 kDa in extracts of D2 cells was specifically detected by TMPK2 antibody (Fig. 5C). Despite sharing partial homology in sequence within the TMPK domain, GST-TMPK2 but not GST-TMPK1 protein was able to neutralize this antibody in specific detection of endogenousTMPK2. In order to establish the relationship between TMPK1 and TMPK2 expression during differentiation, we treated D2 cells with PMA to induce monocyte/macrophage differentiation for RT-PCR reaction and Western blot analysis. Expression of TMPK1 at the RNA and protein level was decreased with differentiation induction. In contrast,TMPK2 protein expression was significantly increased with differentiating time even though only a slight increase of RNA expression was seen in one day induction. These results indicated a reciprocal relationship in protein expression pattern of TMPK1 and TMPK2 during monocytic/macrophage differentiation (Fig. 5D). Taken together, our data suggest that upregulation of TMPK2 during differentiation may substitute for cytosolic TMPK1 for dTTP synthesis in mitochondria biogenesis.

Discussion In this study, we described a mitochondrial TMPK, designated TMPK2. The cDNA of human TMPK2 codes for a 49 kDa polypeptide consisting of a typical mitochondrial targeting sequence and a TMPK functional domain. The subcellular localization of TMPK2 suggests its biological function in mitochondrial dTTP biosynthesis.We also found that TMPK2 protein expression is markedly increased in erythroblastoma cells after PMA-induced monocyte/macrophage differentiation, where TMPK1 expression becomes diminished. Accordingly, we proposed that regulation of TMPK2 expression is closely associated with cellular terminal differentiation, by which dTTP is produced for DNA synthesis in mitochondrial compartment in the non-cycling cells. The importance of mitochondrial dTTP supply has been highlighted by the studies reporting that genetic diseases characterized by depletion of mitochondrial DNA are associated with abnormalities in dTTP meta-

bolism (Elpeleg et al. 2002; Elpeleg 2003). As mentioned earlier, malfunction of TK2 causes deficiency of thymidine salvage, resulting in defect in mitochondrial DNA replication (Saada et al. 2001). Genetic deficiency of thymidine phosphorylase, which catalyzes the reversible phosphorolysis of thymidine, leads to accumulation of thymidine in body fluids, resulting in mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) (Nishino et al. 1999, 2000). This is because too much dTTP is produced to perturb the balance of dNTP pools, leading to pathogenic multiple mtDNA depletion in skeletal muscle. These studies indicate that both lack and overproduction of thymidine phosphates impair replication or maintenance of mitochondrial DNA.The identification of TMPK2 adds another nuclear gene participating in mitochondrial biogenesis for future investigating genetic diseases related to mitochondrial defects. Unlike cytosolic TK1, which phosphorylates only thymidine, mitochondrial TK2 phosphorylates thymidine and deoxycytidine (Wang & Eriksson 2000). In noncycling cells, the mitochondrial dNTP synthesis is dependent on the salvage pathway by the mitochondrial dGK and TK2 that phosphorylate all four deoxyribonucleotides (Van Rompay et al. 2000). It is known that human tissues contain a cytosolic TMPK1, a uridylatecytidylate kinase (UMP-CMPK) (Van Rompay et al. 1999b), five isozymes of adenylate kinase (AK) (Yamada et al. 1989; Xu et al. 1992; Yoneda et al. 1998; Van Rompay et al. 1999a), and several guanylate kinases (GUK) (Jamil et al. 1975; Brady et al. 1996) for the step of conversion of dNMP to dNDP. Among them, only AK2, 3 and 4 are suggested be located in mitochondria for dADP formation, but the enzyme phosphorylating dTMP within the mitochondria remains to be identified. Since a mitochondrial NDPK that catalyzes dTTP formation from dTDP has been identified (Milon et al. 1997, 2000), the TMPK2 in this study might fill the missing gap for the second phosphorylation step that forms dTDP in mitochondria. However, attempt to define its substrate specificity and kinetic properties has not been successful, since we were unable to use the purified recombinant TMPK2 protein to detect appreciable level of enzyme activity in vitro. Nor did we detect its enzymatic activity using cell extracts over-expressing TMPK2. Perhaps, this enzyme requires a specific cofactor for its in vitro reaction activity assay. Nonetheless, ectopic expression of TMPK2 does increase four dNTP pools, raising a possibility that it might have broad substrate specificity as TK2. The detection of TMPK2 RNA in different human tissues and its sequence conservation in higher eukaryotic species indicate its ubiquitous function. Although we did find several EST sequences containing a complete TMPK


Genes to Cells (2008) 13, 679–689

685

Y-L Chen et al.

functional domain by blast search, only TMPK2 has an intact mitochondrial import signal sequence. Here, we do not exclude the possibility that there are several isoforms of TMPK capable of providing dTDP formation in post-mitotic cells because of the availability of mitochondrial dNDP transporter (Dolce et al. 2001). Nevertheless,TMPK2 located in mitochondria would be more directly and efficiently coupled with TK2 and NDPK in dTTP synthesis in a spatiotemporal manner. The physiological significance of TMPK2 would be quite limiting in proliferating cells that contain high level of TMPK1 but very little TMPK2. However, the function of TMPK2 might become particularly important in the terminal differentiating cells where TMPK1 expression is decreased and the dTTP supply is still needed for mitochondrial DNA synthesis. To support this notion, we found that monocytes from peripheral blood still retain TMPK2 but not TMPK1 RNA. In addition, the expression level of TMPK2 is significantly increased in PMA-induced differentiating D2 erythroblastoma cells, in which TMPK1 expression is reciprocally decreased. Indeed, gene sequence identified as a thymidylate kinase family lipopolysaccharide (LPS)-inducible member (Lee & O’Brien 1995; Kimura et al. 2006) is identical to that of TMPK2. Therefore, upregulation of TMPK2 expression with terminal differentiation might represent a mechanism for maintaining mitochondrial biogenesis in non-dividing cells.

Experimental procedures Materials Phorbol-12-myristate-13-acetate (PMA) was purchased from Sigma Chemicals (St. Louis, MO) and was dissolved in DMSO. Anti-hTMPK1 polyclonal antibody was prepared as described previously (Ke et al. 2005). Antiserum against hTMPK2 was obtained by immunizing rabbit with purified TMPK2∆N48 protein and was affinity-purified. Anti-β-tubulin and anti-βactin were purchased from Sigma Chemicals (St Louis, MO). [3H]-labeled dTMP (49.4 Ci/mmole) was purchased from Moravek Biochemicals (Brea, CA). [3H]-labeled thymidine (25 Ci/mmole) was purchased from GE Healthcare (Little Chalfont, UK).

Cell culture HeLa, 293T, and cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen Life technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum plus 100 µg/mL streptomycin and 100 U/mL penicillin (Invitrogen Life Technologies) at 37 °C under 5% CO2. K562 and D2 cells were maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum plus 100 µg/mL streptomycin

686

Genes to Cells (2008) 13, 679– 689

and 100 U/mL penicillin (Lai et al. 2001). THP1 cells were maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum plus 100 µg/mL streptomycin, 100 U/mL penicillin and 2.5 g/L glucose. SH-SY5Y cells were maintained in a 1 : 1 mixture of Eagle’s Minimum Essential Medium (EMEM) and Ham’s F12 medium supplemented with 10% fetal bovine serum.

cDNA cloning, expression and subcellular localization of human TMPK2 The GenBank EST database at the National Center for Biotechnology Information was searched with the Basic Local Alignment Search Tool (BLAST) to identify human EST cDNA sequences that encode proteins containing functional domain of TMPK. Among them, Loc129607 (accession number NM_207315) and Hxm059368 (accession number XM_059368.6) EST cDNAs were found to have mitochondrial targeting sequence by using the MitoPortII search. Complementary DNAs synthesized by reverse transcriptase using total RNA of K562 cells were subjected to PCR with two pairs of primers flanking the open reading frame of these two cDNAs for amplification. The RT-PCR products, 1350 bp for Loc129607 and 1272 bp for Hxm059368, were subsequently cloned into pGEM-T-easy cloning vector (Promega), followed by subcloning into pEGFP-N1 at the EcoRI and BamHI sites.

Monocyte isolation for RT-PCR Fresh, whole blood was drawn with informed consent from healthy donors into vacutainer tubes containing EDTA. Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll density gradient separation (Amersham Biosciences, Piscataway, NJ). CD14+ monocytes were isolated from PBMC by positive selection using a MACS system (Miltenyi Biotech, Bergisch Gladbach, Germany), according to the manufacturer’s protocol.

Recombinant protein purification and antibody generation The DNA fragment corresponding to human TMPK2 was inserted into the pGEX-2T vector to express a GST-fused TMPK2 in Escherichia coli. GST-TMPK2 expression was induced in E. coli with 0.2 mm IPTG for 14 h at 20 °C. The recombinant protein was enriched from crude bacterial extracts using glutathione-4B Sepharose (Amersham Pharmacia Biotech, Uppsala, Sweden). The gel-purified recombinant protein was used to generate antiserum against hTMPK2 by immunizing rabbit, after which polyclonal antibody was affinity-purified.

RNA isolation and RT-PCR analysis Total RNA was isolated from various cell lines, and was reverse transcribed with reverse transcriptase (Promega, Madison, WI). Complementary DNAs of 12 human tissues purchased from Clontech (Human multiple tissue cDNA Panel) and prepared


Human mitochondrial TMPK from cell lines were used for semi-quantitative PCR amplification. The semi-quantitative PCR for TMPK2 was performed under the following cycling conditions: 95 °C for 5 min, 30 cycles of 30 s at 95 °C, 30 s at 58 °C and 1 min at 72 °C. Semi-quantitative PCRs for TMPK1 and GAPDH were performed under the following cycling conditions: 95 °C for 5 min, 25 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C. The primer sequences were as follows: human TMPK2 sense primer, 5′-CAGCGCC TCTGGGAGGTGCAAGACGGCA-3′ and antisense primer, 5′-GATCTTCCTCCACTGGCCAATGCAAGAGGGTGGT GACT-3′; human TMPK1 sense primer, 5′-CGCAAGCTTCG GTTCCCGGAAGATCAACT-3′ and antisense primer, 5′CGCAAGCTTTCACACGTCTGGCTGTTACACCAGTCTAG3′ and human GAPDH sense primer, 5′-CATGGCACCGT CAAGG-3′ and antisense primer, 5′-CACCATGGGGGCAT CAGC-3′.

dNTP pools determination Cells (1 × 106) were washed twice with 10 mL of cold PBS and extracted with 1 mL ice-cold 60% methanol at −20 °C for 1 h, followed by centrifugation for 30 min at 16 000 g.The supernatant was transferred to a fresh tube and dried under vacuum. The residue was dissolved in sterile water and store at −20 °C for later analysis. Determination of the dNTP pool size in each extract was based on DNA polymerase-catalyzed incorporation of radioactive dATP or dTTP into the synthetic oligonucleotide template method described by Sherman and Fyfe (1989).

Preparation of mitochondria and transport experiments Mitochondria from HEK293T cells were prepared using Qproteome Mitochondria Isolation Kit (Qiagen, Venlo, the Netherlands). The mitochondrial pellet from 5 × 106 cells were suspended in 40 µL of mitochondrial reaction buffer (220 mm mannitol/70 mm sucrose/5 mm MOPS, pH 7.4/0.2 mm EGTA/ 0.2 mg/mL BSA/1 mm MgCl2/1 mm ATP). After adding 10 µCi of [3H]dTMP or [3H] thymidine, mitochondria were incubated at 37 °C for 10 min and then 5 µL of 1 mm cold dTDP was added to the reaction mixtures prior to centrifugation at 4 °C for 10 min at 6000 g. The intact mitochondria in the pellets were washed twice with 500 µL of mitochondrial reaction buffer, after which 500 µL of ice-cold 60% methanol was added to the mitochondrial pellets and stored at −80 °C for 1 h. The methanol extracts were collected by centrifugation at 4 °C for 30 min at 16 000 g and transferred to a fresh tube for drying under vacuum. 5 µL of nuclease-free water and 2 µL of marker mixture containing 1 µg of dTMP, dTDP, dTTP, and thymidine were added to dissolve the residue, which was then spotted onto PEI-cellulose-F TLC plate (Merck, Whitehouse Station, NJ) and developed in a solution containing 2 m acetic acid and 0.5 m LiCl. After development and drying, the spots corresponding to thymidine, dTMP, dTDP, and dTTP were detected by 254 nm using UV detector and were cut for radioactivity measurement by a liquid scintillation counter (Beckman Coulter, Fullerton, CA). The conversion ratio was

calculated by dividing cpm of (dTDP + dTTP) by that of (Thd + dTMP + dTDP + dTTP).

Immunostaining of endogenous TMPK2 D2 cells were plated on a fibronectin-coated coverslip. Before immunostaining, cells were incubated with a medium containing MitoTracker Red580 (Molecular Probe, Eugene, OR) for 15 min. Cells were washed twice with PBS and fixed with 3% paraformaldehyde/PBS for 30 min. After fixation, cells were permeablized with 0.3% Triton X-100/TBST (50 mm Tris-HCl, pH7.4, 150 mm NaCl, 0.1% Triton X-100) for 5 min and blocked with 5.5% normal goat serum in TBST for 1 h at room temperature, followed by incubation with purified anti-hTMPK2 antibody in TBST-3%BSA for 2 h at room temperature. After TBST washing, cells were incubated with FITC-conjugated goat anti-rabbit IgG antibody (Sigma) at a 1 : 200 dilution in TBST-3% BSA for 1 h at room temperature. The coverslip was then washed with TBST three times and mounted for analysis with Leica TCS SP2 confocal spectral microscope and Zeiss Axioskop2 microscope.

Transient transfection and immunoblotting 293T cells (1 × 106) were plated on a 100-mm-diameter dish and transiently transfected with a mixture of 30 µg of LipofectAMINE (Life Technologies, Inc., Gaithersburg, MD) and 5 µg of plasmid DNA. After transfection for 48 h, cells were extracted for dNTP pool size measurement and Western blot analysis. Thirty micrograms of cell lysates were resolved on SDS-PAGE [10% (w/v) gel], followed by electrophoretic transfer to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA). After blocking with 5% (w/v) powdered non-fat milk, the membrane was incubated with antiserum against GFP (1 : 2000) for 16 h, and treated for 1 h with horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Santa Cruz Biotechnology, Santa Cruz, CA). ECL detection for the horseradish peroxidase reaction was performed according to the manufacturer’s instructions.

Acknowledgements We thank Chun-Mei Hu and Yi-Chang Chang for technical assistance and Peter Reichard (Department of Biology, University of Padova, Italy) for critical reading of the manuscript. This study was supported by grants NSC96-2628-B-002-079-MY2 from National Science Council and NHRI-EX-97-9701BI from National Health Research Institute, Taiwan (R.O.C.).

References Bogenhagen, D. & Clayton, D.A. (1977) Mouse L cell mitochondrial DNA molecules are selected randomly for replication throughout the cell cycle. Cell 11, 719–727. Brady, W.A., Kokoris, M.S., Fitzgibbon, M. & Black, M.E. (1996) Cloning, characterization, and modeling of mouse and human guanylate kinases. J. Biol. Chem. 271, 16734–16740.


Genes to Cells (2008) 13, 679–689

687

Y-L Chen et al. Coppock, D.L. & Pardee, A.B. (1987) Control of thymidine kinase mRNA during the cell cycle. Mol. Cell. Biol. 7, 2925– 2932. Dolce, V., Fiermonte, G., Runswick, M.J., Palmieri, F. & Walker, J.E. (2001) The human mitochondrial deoxynucleotide carrier and its role in the toxicity of nucleoside antivirals. Proc. Natl. Acad. Sci. USA 98, 2284–2288. Elpeleg, O. (2003) Inherited mitochondrial DNA depletion. Pediatr. Res. 54, 153–159. Elpeleg, O., Mandel, H. & Saada, A. (2002) Depletion of the other genome-mitochondrial DNA depletion syndromes in humans. J. Mol. Med. 80, 389–396. Ferraro, P., Nicolosi, L., Bernardi, P., Reichard, P. & Bianchi, V. (2006) Mitochondrial deoxynucleotide pool sizes in mouse liver and evidence for a transport mechanism for thymidine monophosphate. Proc. Natl. Acad. Sci. USA 103, 18586– 18591. Ferraro, P., Pontarin, G., Crocco, L., Fabris, S., Reichard, P. & Bianchi, V. (2005) Mitochondrial deoxynucleotide pools in quiescent fibroblasts: a possible model for mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). J. Biol. Chem. 280, 24472–24480. Huang, S.H., Tang, A., Drisco, B., Zhang, S.Q., Seeger, R., Li, C. & Jong, A. (1994) Human dTMP kinase: gene expression and enzymatic activity coinciding with cell cycle progression and cell growth. DNA Cell Biol. 13, 461–471. Jamil, T., Fisher, R.A. & Harris, H. (1975) Studies on the properties and tissue distribution of the isozymes of guanylate kinase in man. Hum. hered. 25, 402–413. Johansson, M. & Karlsson, A. (1997) Cloning of the cDNA and chromosome localization of the gene for human thymidine kinase 2. J. Biol. Chem. 272, 8454–8458. Ke, P.Y. & Chang, Z.F. (2004) Mitotic degradation of human thymidine kinase 1 is dependent on the anaphase-promoting complex/cyclosome-CDH1-mediated pathway. Mol. Cell. Biol. 24, 514–526. Ke, P.Y., Kuo, Y.Y., Hu, C.M. & Chang, Z.F. (2005) Control of dTTP pool size by anaphase promoting complex/cyclosome is essential for the maintenance of genetic stability. Genes Dev. 19, 1920–1933. Kimura, K., Wakamatsu, A., Suzuki, Y., et al. (2006) Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res. 16, 55–65. Lai, J.M., Lu, C.Y., Yang-Yen, H.F. & Chang, Z.F. (2001) Lysophosphatidic acid promotes phorbol-ester-induced apoptosis in TF-1 cells by interfering with adhesion. Biochem. J. 359, 227–233. Lee, C.G. & O’Brien, W.E. (1995) A unique member of the thymidylate kinase family that is induced during macrophage activation. J. Immunol. 154, 6094–6102. Lee, L.S. & Cheng, Y. (1977) Human thymidylate kinase. Purification, characterization, and kinetic behavior of the thymidylate kinase derived from chronic myelocytic leukemia. J. Biol. Chem. 252, 5686–5691. Milon, L., Meyer, P., Chiadmi, M., Munier, A., Johansson, M.,

688

Genes to Cells (2008) 13, 679– 689

Karlsson, A., Lascu, I., Capeau, J., Janin, J. & Lacombe, M.L. (2000) The human nm23-H4 gene product is a mitochondrial nucleoside diphosphate kinase. J. Biol. Chem. 275, 14264– 14272. Milon, L., Rousseau-Merck, M.F., Munier, A., Erent, M., Lascu, I., Capeau, J. & Lacombe, M.L. (1997) nm23-H4, a new member of the family of human nm23/nucleoside diphosphate kinase genes localised on chromosome 16p13. Hum. Genet. 99, 550–557. Nishino, I., Spinazzola, A. & Hirano, M. (1999) Thymidine phosphorylase gene mutations in MNGIE, a human mitochondrial disorder. Science 283, 689–692. Nishino, I., Spinazzola, A., Papadimitriou, A., et al. (2000) Mitochondrial neurogastrointestinal encephalomyopathy: an autosomal recessive disorder due to thymidine phosphorylase mutations. Ann. Neurol. 47, 792–800. Pfanner, N. (2000) Protein sorting: recognizing mitochondrial presequences. Curr. Biol. 10, R412–R415. Pontarin, G., Gallinaro, L., Ferraro, P., Reichard, P. & Bianchi, V. (2003) Origins of mitochondrial thymidine triphosphate: dynamic relations to cytosolic pools. Proc. Natl. Acad. Sci. USA 100, 12159–12164. Rampazzo, C., Ferraro, P., Pontarin, G., Fabris, S., Reichard, P. & Bianchi, V. (2004) Mitochondrial deoxyribonucleotides, pool sizes, synthesis, and regulation. J. Biol. Chem. 279, 17019– 17026. Saada, A., Shaag, A., Mandel, H., Nevo, Y., Eriksson, S. & Elpeleg, O. (2001) Mutant mitochondrial thymidine kinase in mitochondrial DNA depletion myopathy. Nat. Genet. 29, 342–344. Schneider, G., Sjoling, S., Wallin, E., Wrede, P., Glaser, E. & von Heijne, G. (1998) Feature-extraction from endopeptidase cleavage sites in mitochondrial targeting peptides. Proteins 30, 49–60. Sherman, P.A. & Fyfe, J.A. (1989) Enzymatic assay for deoxyribonucleoside triphosphates using synthetic oligonucleotides as template primers. Anal. Biochem. 180, 222–226. Van Rompay, A.R., Johansson, M. & Karlsson, A. (1999a) Identification of a novel human adenylate kinase. cDNA cloning, expression analysis, chromosome localization and characterization of the recombinant protein. Eur. J. Biochem. 261, 509–517. Van Rompay, A.R., Johansson, M. & Karlsson, A. (1999b) Phosphorylation of deoxycytidine analog monophosphates by UMP-CMP kinase: molecular characterization of the human enzyme. Mol. Pharmacol.56, 562–569. Van Rompay, A.R., Johansson, M. & Karlsson, A. (2000) Phosphorylation of nucleosides and nucleoside analogs by mammalian nucleoside monophosphate kinases. Pharmacol. Ther. 87, 189–198. Voos, W., Martin, H., Krimmer, T. & Pfanner, N. (1999) Mechanisms of protein translocation into mitochondria. Biochim. Biophys. Acta 1422, 235–254. Wang, L. & Eriksson, S. (2000) Cloning and characterization of full-length mouse thymidine kinase 2: the N-terminal sequence directs import of the precursor protein into mitochondria. Biochem. J. 351, 469–476.


Human mitochondrial TMPK Xu, G., O’Connell, P., Stevens, J. & White, R. (1992) Characterization of human adenylate kinase 3 (AK3) cDNA and mapping of the AK3 pseudogene to an intron of the NF1 gene. Genomics 13, 537–542. Yamada, M., Shahjahan, M., Tanabe, T., Kishi, F. & Nakazawa, A. (1989) Cloning and characterization of cDNA for mitochondrial GTP:AMP phosphotransferase of bovine liver. J. Biol. Chem. 264, 19192–19199.

Yoneda, T., Sato, M., Maeda, M. & Takagi, H. (1998) Identification of a novel adenylate kinase system in the brain: cloning of the fourth adenylate kinase. Brain Res. 62, 187–195. Received: 16 October 2007 Accepted: 31 March 2008


Genes to Cells (2008) 13, 679–689

689