Identification of an insulin-responsive element in the promoter of the ...

Vol. 268, N o .23,Issue of August 15,PP. 17063-17068,1993 Printed in U.S.A.

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of an Insulin-responsive Element in the Promoter of the Human Genefor Insu~in-likeGrowth FactorBinding Protein-l* (Received for publication, February 19, 1993,and in revised form, May 5, 1993)

Adisak Suwanickul,Sheila L. Morris, and DavidR. Powell$ From the Department of Pediatrics, Baylor College of Medicine, Houston, Texas 77030

Insulin inhibits the hepatic transcription of insulin-tuate by a factor of 15-fold or more within a few hours (12, like growth factor binding protein-1 (IGFBP-1).In the 13).These fluctuations are related to the nutritional status of present studies, human HEP G2 hepatoma cells were the individual and correlate inversely with insulin levels; transiently transfected with human IGFBP- 1 gene proindeed, in viuo studies suggest that, although IGFBP-1 serum moter constructs in order toidentify cis elements and levelsmay increase in the presence of glucocorticoids and trans-acting factorsthatconfertheinsulin effect. glucagon, insulin is the dominant regulator of these levels TransfectionsofIGFBP-1promoterdeletioncon(13-18). Recent in uiuo studies using a diabetic rat model structs localized an insulin responsive element (IRE) show that insulin lowers serum IGFBP-1 levels by rapidly between -140- and -103-base pair(bp) 5’ to the decreasing the rate of hepatic IGFBP-1 gene transcription mRNA capsite. This region contains 25-bp a sequence (19). This observation is supported by in vitro studies on which is 100%conserved in the rat IGFBP-1 promoter and which hastwo AT-rich, 8-bp elementsexhibiting cultured hepatocytes, which shownot only that insulin rapidly dyad symmetry.Site-directedmutagenesis of both ele- inhibits the rateof IGFBP-1 gene transcription, but also that this inhibitory effect of insulin is conferred by a cis element ments in the same 1206-bp IGFBP-1 promoter construct abolished the inhibitory effect of insulin onpro- located between 529 and 103 bp 5’ to the mRNA capsite of the human IGFBP-1 gene (11,20-24). moter activity. Also,the native butnotthemutant The multihormonal regulation of IGFBP-1 is similar to IGFBP-1 IRE conferred the inhibitory effect of insulin to the heterologous thymidine kinase promoter. Gel that of the cytosolic form of phosphoenolpyruvate carboxymobility shift assays identified aDNA binding activity kinase (PEPCK), a key enzyme in gluconeogenesis (25). This which specifically binds the native IGFBP-1 IRE and suggests that IGFBP-1 may play a role in glucose counterregulation; hypothetically, increased IGFBP-1 levels during which is not altered by prior insulin treatment. The IGFBP-1 IRE sequence is similar to those of function- fasting serve to bind IGF peptides and prevent them from ally mapped IRES from other gene promoters, suggest- stimutating glucose uptake or from inducing other insulining that this common IRE and the protein(s) which it like metabolic effects during the period of substrate defibinds confer the insulineffect to a number of insulin- ciency. Support for this role comes from the observation that sensitive genes. acutely infusing IGFBP-1 intorats results in atransient increase in circulating glucose levels (8). The similarities of PEPCK and IGFBP-1 regulation also suggest that theinsulin effect may be conferred by a cis element similar to theinsulinInsulin-like growth factor-bin~ng protein-1 (IGFBP-1)’ is responsive element (IRE) identified in the PEPCK promoter one of a family of six secreted proteins which bind IGF (26). The studies presented in this paper employed HEP G2 peptides with high affinity (1-3). This high affinity binding human hepatoma cells asa model system to identify cis allows IGFBPs to modulate IGF action. In most studies, elements and trans-acting factors which participate in conferIGFBP-1 has inhibited IGF effects both in uitro (4-7) and in ring the insulin effect to the IGFBP-1 promoter. viuo (8),apparently by competing with IGF receptors for IGF EXPERIMENTALPROCEDURES binding. However, certain modifications of IGFBP-1 protein structure result in lower affinity for IGF ligands, allowing Plasmid Constructs-Construction of IGFBP-1 promoter plasmids IGFBP-1 to potentiate IGF action (9). p1205CAT, p357CAT, p207CAT, and pl03CAT has been described IGFBP-1 has a limited tissue distribution, with liver the (27, 28); each is named for the number of remaining bp 5’ to the primary site of expression in most individuals (10, 11). He- mRNA cap site of the human IGFBP-I gene. Construction of which contains sequence spanning from -107 to +56 patocytes secrete this protein and appear to be the major pTKCAT(An), bp relative to thethymidine kinase mRNA capsite, hasbeen described source of serum IGFBP-1. IGFBP-1 serum levels may fluc- (29); the XbaI site a t -119 to -114 bp of the TKCAT(An) construct ~~

~~

~~~

_____ was used to insert the complementary oligonucleotides ABS (5‘-

* This work was supported by National Institutes of Health Grant

R 0 1 DK-38773 (to D.R.P.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. To whom correspondence should be addressed Texas Children’s Hospital, Clinical Care Center, MC#3-2482, 6621 Fannin St., Houston, T X 77030. The abbreviations used are: IGFBP-1, insulin-likegrowth factorbinding protein-1; bp, base pair(s); PEPCK, phosphoenolpyruvate carboxykinase; IRE, insulin-responsive element; CAT, chloramphenicol acetyltransferase; IREBP, IRE-binding protein; SRF, serum response factor; CREB, CAMPresponse element-binding protein.

’

CTAGCACTAGCAAAACAAACTTATTTTGAACA-3‘) and ABas (5’-CTAGTG~CAAAATAAGTTTGTTTTGCTAGTG-3’) which encode native IGFBP-1 promoter sequence from -124 to -97bp containing the putative IRE, and toinsert the complementary oligonucleotides AMBMs (5f-CTAGCACTAGCCCCGGGAACTTAGGGGTAACA-3’) and AMBMas (5”CTAGTGTTACCCCTAAGTTCCCGGGGCTAGTG-3’) which span the same IGFBP-1 promoter region but which contain two mutations of the putative IRE. The plasmid p207CCAAT has also been described previously (27). In all thymidine kinase andIGFBP-1 promoter constructs used in the present studies, sequence and orientation have been c o n ~ r m e dusing Sequenase (U. S. Biochemicals Corp., Cleveland, OH) in the dideoxy chain termination method as described previously (30).

17063

promoter IRE

Identification of IGFBP-1 an

17064

Site-directed Mutagenesis-The IGFBP-1 promoter fragment from p1205CAT wasinserted into the M13-based cloning vector M13mp18 as described (27). Site-directed mutagenesis was performed by the Kunkel method (31, 32) using synthetic oligonucleotides and the Muta-Gene kit following the instructions of the manufacturer (BioRad). Oligonucleotide 5‘-CCTCCCACCAGCAAGCTTCGTAGGGCCT TG-3’ introduced a Hind111 site a t -146 to -141 bp of the IGFBP-1 promoter; this mutated fragment was released by digesting with BamHI, filled in with Klenow polymerase, and theninserted into the pCAT(An) vector with the filled-in XhoI site to create pl40HMCAT. The plasmid pl40HMCAT was digested with Hindi11 and then religated to create pl40CAT. Oligonucleotide 5”GGGTGCACTAGCCCCGGGAACTTATTTT GA-3’ introduced a SmaI site a t -117 to -112 bp of the IGFBP-1 promoter; this mutated fragment was manipulated as above to create pAMBCAT. The plasmid pAMBCAT was digested with SmaI and then religated to create plllCAT. Oligonucleotide 5’-AAAACAAACTTAGGGGTAACACTCAGCT (2-3’ mutated the TTTTGmotif at -105 to -101 bp to GGGGT this mutated fragment was manipulated as above to create pABMCAT. The M13 construct containing the SmaI site at -117 to -112 bp (AMB) was further mutatedwith oligonucleotide 5”CCCGGGAACTTAGGGGTAACACTCAGCTC-3’to introduce the GGGGT motif a t -105 to -101 bp: this mutated fragment was manipulated as above to create PAMB-MCAT. Oligonucleotide 5’-CCTAACAACGGGTCCTCCCACCAG-3’ deleted -190 to -160 bo of the IGFBP-1Dromoter. oligonucleotide 5’AACCGTTTACCCGGGTGCACTAGC13‘ deleted -159 to -130 bp of the IGFBP-1 promoter, and oligonucleotide 5”GCGTAGGGCCT TCACTCAGCTCCT-3’ deleted -129 to -99 bp of the IGFBP-1 promoter. These three mutants were manipulated as above to create p1205dlCAT, p1205d2CAT, and p1205d3CAT, respectively. Cell Culture and DNA Transfection-HEP G2 human hepatoma

cells were maintained, plated, and transfected as described (24, 33). Each plate of cells was transfected with 10 pg of CAT plasmid; 1 fig of pRSVL plasmid containing the Rous sarcoma virus long terminal repeat 5’ to the luciferase reporter gene (34) was cotransfected to control for transfection efficiency. Transfected cells werewashed three times in phosphate-buffered saline and thenincubated for 18 h with serum-free medium (Dulbecco’s modified Eagle’s medium supplemented with 5 mM L-glutamine, 50 units/ml penicillin, and 50 pg/ ml streptomycin)containingeither 0 or 100 nM insulin (kindly provided by Eli Lilly Co.) Chloramphenicol Acetyltransferase and Luciferase Assays-CAT assays were performed after the method of Gorman et ai. (35), and luciferase assays were performed after the method of de Wet et al. (34), exactly as described previously (27). Preparation of Nuclear Extracts-HEP G2 cells maintained and plated as described (24, 27) were harvested after a 2-h incubation in serum-free medium containing 0 or 100 nM insulin; this time period is sufficient for insulin to inhibit IGFBP-1 gene transcription inthese cells (24). Nuclear extracts were prepared from1to 3 X 10’ cells from each treatment group as described previously (27,36), except that the step using (NH&SO, precipitation to concentrate nuclear proteins was omitted. The extract was divided into 10O-pl aliquots and then stored in liquid N2. Gel Ma~ility ShiftAssays-Oligonucleotides ABS and ABas were annealed and filled in using Klenow polymerase and [a-32P]dCTP to create the labeled DNA fragment AB; this encodes the native IGFBP1 promoter sequence from -124 to -96 bp containing the putative IRE. OligonucleotidesAMBMs and AMBMas were handled similarly to create the labeled fragment AMBM; this spans the same promoter region but contains two mutations of the putative IRE. One fmol of AB or AMBM probe was incubated a t room temperature with 2 ~1 of nuclear extract and 1 pg of poly(dG-dC) in 4 mM Tris-HC1, 12.5 mM HEPES, pH 7.9, 1 mM EDTA, 1 mM dithiothreitol, 12.5% glycerol, and 198 mM KCI; total volume was 15 pl. After a 15-min incubation, PRCMOTER ACTIVITY (4 CONllWL)

0

x’01sp-lPRLYOTLR CONSTRUCTS

- 1 2 0 5 1

FIG. 1. Effect of insulin on constructs containing deletions of the IGFBP-1 promoter. HEP G2 cells were transiently transfected with CAT constructs containing progressive 5’ deletions of the IGFBP-1 promoter (p1205CAT, p357CAT, p207CAT, pl40CAT, plllCAT,and pl03CAT), and also with p1205CAT constructs that have internal deletions from -190 to -160 hp ~p1205dlCAT),from -159 to -130 bp (p1205d2CAT),and from -129 to -99 hp (pl205d3CAT). Cells were incubated with either 0 or 100 nM insulin for 16 h, after which IGFBP-1 promoter activity was measured as described under “Experimental Procedures.” The effect of insulin is presented as percent control value, with control value emphasized as the black line at 100%. IGFBP-1 promoter activity represents the mean S.D. of N independent experiments.

-753-

0-= 1 0 2-

*

-1205 d3“-i/

*

25

50

15

1

125 150

17065

Identification of an IGFBP-1 promoter IRE A.

IGFBP-1 P r o m o t e r Sequences

B

A Human Rat

FIG. 2. Effect

of

insulin

-140 C G t a g g G c c t t G g G t g C A C t A G w C - h a c

-96

-129

-85

CGgtttGtgcgGaGctCACaAGv2-ACAc

on

IGFBP- 1 promoter constructs containing mutations oftheputative IRE, A , human IGFBP-1 promoter sequence in the region of the putative IRE (-140 to -96 bp), and homologous sequence from the rat IGFBP-1 promoter (-129 to -85 bp). Upper case letters represent base pairs conserved between the two promoters. Underlined sequences represent two conserved elements, A and B, which demonstrate dyad symmetry. B, IRE sequence of the IGFBP-1 promoter construct p1205CAT after sitedirected mutation of the A element ( A M B ) , B element ( A B M ) , and both elements ( A M B M ) ; the A and B elements are underlined. C, HEP G2 cells were transiently transfected with native p1205CAT, with a p1205CAT construct mutated to containaHindIIIsite at -146 to -141 bp (pl4OHMCAT) or with p1205CAT constructscontaining the AMB,ABM, and AMBM mutations. Cells were incubated with 0 or 100 nM insulin for 16 h and then assayed for IGFBP-1 promoter activity as described under “Experimental Procedures.” The effect of insulin is presented as percent control value, with control value emphasized as the black line a t 100%. IGFBP1 promoter activity represents the mean k S.D. of N independent experiments.

B.

M u t a t i o n s of IGFBP-1 P r o m o t e r A and B E l e m e n t s A

B -96

An

B

A

au

-120 A C U C A

-96

An

Bu

-120

-96

c.

-120

A

~

A C A C A

T r a n s f e c t i o n Studies

PROMOTER ACTIVITY (% CONTROL) 0

-200 -1205-/

the mixture was separated on a 6% non-denaturing polyacrylamide gel using either high ionic strength Tris-glycine (37) or low ionic strengthTris-borate (38) gel buffer systems. Electrophoresis was carried out for 1 h at 225 V, after which the gels were dried and autoradiographed.

I

~

25 75

50

100

125

150

-100 ’

I

mediate responsiveness to insulin. A Specific Site-directed Mutationof the IGFBP-I Promoter

Prevents Insulin-mediated Inhibition of Promoter ActivityThe preceding data suggest that the IRE of the IGFBP-1 promoter is located between -140 and -103 bp 5’ to the mRNA capsite. The sequence of the human IGFBP-1 proRESULTS moter in this region is presented in Fig. 2 A , as is homologous Deletion Mutations Localize an IGFBP-1 Promoter IREsequence from the rat IGFBP-1 promoter (39). Comparison As shown in Fig. 1, insulin inhibited activity of IGFBP-1 of the two sequences reveals a 25-bp region spanning from promoter constructs containing either 1205, 357, 207, or 140 -120 to -96 bp of the human XGFBP-1 promoter which is bp of 5”flanking sequence to 60% of control values. However, 100% conserved in the ratpromoter and which exhibits dyad additional deletion of IGFBP-promoter sequence to -111 bp symmetry. The sequences responsible for dyad symmetry are blunted the promoter response to insulin, and furtherdeletion underlined and designated A element (5’-CAAAACAA-3‘) to -103 bp created a construct which responded to insulin andB element (5”TTATTTTG-3’). Conservation of this with an 18%increase in promoter activity. Additional IGFBP-1 promoter constructswere prepared by region during evolution suggests that itmay well be involved internally deleting 30- or 31-bp fragments from pl205CAT. in conferring the insulin effect to the IGFBP-1 promoter. To As shown in Fig. 1, deletion of the -190- to -160-bp IGFBP- test this, theA and Belements of p1205CAT werefirst altered 1 promoter fragment (p1205dlCAT) did not prevent insulin by site-directed mutagenesis; the specific mutations created from inhibiting promoter activity by 42%, similar to native are presented in Fig. 2B. These mutated IGFBP-1 promoter constructs were then transfected into HEP G2 cells along p1205CAT. In contrast, deletion of the -129- to -99-bp , in fragment (p1205d3CAT) resulted in a constructwhich exhib- with native p1205CAT and also p l 4 O ~ ~ C A aT construct ited only an 11%decrease in promoter activity in the presence which p1205CAT was mutated to contain a HindIII site at of insulin. The plasmid p1205d2CAT, whichlacked the -159-146 to -141 bp of the IGFBP-1promoter. As shown in Fig. to -130-bp fragment of the IGFBP-1promoter, had an inter- 2C, insulin caused the usual decrease in p1205CAT activity

Identification of an IGFBP-1 promoter IRE

17066 A.

AM and A” SequencesInserted A

5 ‘ t o t h e TK Promoter

B

AB

5 ’ - CTAGCILCTA-C-UC -3’ 3 ’ - G T G A T C E U X Z G Z T T G T T G T W T C -5

AllBr

5 ’ - CTAGCACTA-C”UC 3a

NSBP

-3’

- GTGATCG!XGXCTTGTTGTGGATC

-5’

IREBP

B.

Transfection Studies

-

-

PROMOTER ACTIVITY (%

CONlnOLl

N. Extract:

0 -In +In 0 -In +In

uu Oligo Probe: Native Mutant

FIG. 3. Effect of insulinonconstructscontaining the IGFBP-1 IRE 5’ to thethymidine kinase promoter. A , sequences of oligonucleotides used to insert native ( A B ) or mutant ( A M B M ) IGFBP-1 IREs 5’ to thethymidine kinase promoter; native and mutant A and B elements are underlined. B, HEP G2 cells were transfected with pTKCAT(An), which contains sequence from -107 to +56 bp relative to the thymidine kinase mRNA capsite, and with constructs containing native or mutant IGFBP-1 IREs inserted a t the BamHI site 5’ to the thymidine kinase promoter. The A and B elements of the native IGFBP-1 IRE, and theAM and BM elements of the mutant IGFBP-1 IRE, areboxed. An overlying arrow pointing right signifies that the IRE is in correct orientation, while an overlying arrow pointing left signifies that the IRE is in reverse orientation. Sal1 ( S ) ,XbaI The restriction sites HindIII ( H ) ,SphI ( S p ) ,PstI (P), (X), and BamHI ( B ) are 5’ to the thymidine kinase promoter in pTKCAT(An). Cells were incubated with either 0 or 100 nM insulin for 16 h and thenassayed for IGFBP-1 promoter activityas described under “Experimental Procedures.” The effect of insulin is presented as percent control value, with control value emphasized as the black line at 100%. IGFBP-1 promoter activity represents the mean & S.D. of N independent experiments.

(AB) (AhtBho FIG. 4. The IGFBP-1 IRE recognizes a specific DNA-binding protein in HEP G2 nuclear extract by gel mobility shift assay. The oligonucleotides shown in Fig. 3A were annealed and labeled with [a-”PIdCTP to create either native ( A B ) or mutant ( A M B M ) IGFBP-1 IRE probes. One fmol of each probe was then incubated with 1 pg of poly(dG-dC) and 2 p1 of nuclear extract made from HEP G2 cells after the cells had been incubated either without (-In) or with (+In) 100 nM insulin for 2 h. These mixtures were separated in individual lanes of a 6% nondenaturing polyacrylamide gel using high ionic strength Tris-glycine buffer; two lanes contained Extract). Electrophoresis was probe with no (0) nuclear extract (N. carried out for 1 h at 225 V, after which the gels were dried and autoradiographed. The two bands identified represent interaction of labeled probe with a nonspecific DNA-binding protein (NSBP) or with a DNA-binding protein which specifically binds the IGFBP-1 IRE (ZREBP).

contrast, activities of constructscontainingthe native IGFBP-1IRE 5’ tothethymidine kinasepromoter were inhibited 40-45% by insulin; this inhibition occurred regardless of whether the native IRE was inserted in the correct or reverse orientation, andtwo copies of the IRE did not appear to confer an additional inhibitory effect by insulin. Unlike the native IRE, the mutantAMBM IRE was unable to confer the inhibitory effect of insulin to the thymidine kinase promoter; in fact, the activity of the construct containing the AMBM IRE was stimulated 18% above control values by insulin, a response similar to that noted for the construct containing thethymidine kinase promoter alone. A HEP G2 Nuclear Protein Retards Migration of Native But Not Mutant IRE duringGel Mobility Shift Assays-The oligonucleotides used toinsertthe native(AB) andmutant to 48% of control values, and introducing the HindIII site at (AMBM) IGFBP-1 IREs upstream to the thymidine kinase incubated -146 to -141 bp did not interfere with the ability of insulin promoter (Fig. 3 A ) were labeled with [cP~’P]~CTP, to inhibit promoter activity. Although individual mutations with HEP G2 nuclear extract,andthen analyzed by gel identify nuclear proteins of the A and B elements led to some decrease in theability of mobility shift assay in an attempt to extracts insulin to inhibit activity of the IGFBP-1promoter, combin- that specifically interact with the native IRE. Nuclear ing both mutations in the same promoter construct were prepared from HEP G2 cells incubated for 2 h in serum(pAMBMCAT) resulted in the complete inability of insulin free medium containing 0 or 100 nM insulin. As shown in Fig. to inhibit IGFBP-1 promoter activity. In fact,insulin actually 4, both nuclear extracts produce a unique gel-shifted band increased the activity of pAMBMCAT by 36% relative to (IREBP) when incubated with the native, but not with the control values. These data suggest that theA and B elements AMBM mutant, IRE. In contrast, a slower migrating band (NSBP) present in all lanes containing nuclear extract is make up the IREof the IGFBP-1promoter. The PutativeIRE Can Confer Insulin Responsiveness to the probably caused by a protein which binds DNA nonspecifiThymidine Kinase Promoter-Past studies have shown that cally. Identical results were obtained regardless of whether insulin slightly increases activity of the pTKCAT(An) con- the gel buffer system was high ionic strength (Tris-glycine, presented). struct which contains the first 107 bp of the thymidine kinase Fig. 4) or low ionic strength (Tris-borate, data not promoter upstream to the CAT reporter gene (24). To test DISCUSSION whether the IGFBP-1 IREcan confer insulin responsiveness to a heterologous promoter, both native (AB) and mutated Much evidence suggests that the A and B elements confer (AMBM) IREs were placed 5’ to the thymidine kinase prothe inhibitory effect of insulin to the IGFBP-1 promoter: (i) moter in pTKCAT(An) using the synthetic oligonucleotides deletion mutations of the IGFBP-1promoter localize the IRE presented in Fig. 3A. As shown in Fig. 3B, the construct to the area of the A and Belements; (ii) combining sitecontaining only the thymidine kinase promoter exhibited a directed mutations of the A and Belements in the same typical 27% increase in activity in the presence of insulin. In construct completely blocks the ability of insulin to inhibit

17067

Identification of an IGFBP-1promoter IRE A.

FIG. 5. Sequence similarities of well characterized IREs. A , similarity of PEPCK,a-amylase, and glucagon IRE sequences to the A and B elements of the hIGFBP-1 IRE. For each IRE, sequence which was mutated to abolish the insulin effect is underlined. A consensus sequence is presented below. B, comparison of IGFBP-1, c-fos, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) IREs. The A and B elements of the IGFBP-1 IRE are underlined, as is the serum response element of the cfos IRE. IRE-A of the glyceraldehyde-3phosphate dehydrogenase promoter has 5' and 3' regions underlined; the 3' element contains the5'-Py-CTTTG(A/T)3' motif which participates in binding IRE-ABP.

Secruence

1 :

GUAe

3L

RSL

-123

-

-96

-

hIGFBP-1 "A"

-109

GTT-GCTAGT

hIGFBP-1 "B"

-110

ACTT-CAC

PEPCK

TGGTGTTTTULCAAC -416

-402

26

a-Amylase

-134

-148

43

Glucagon

AGTAGTTTTT-270

-256

46

T-TWC

TTNTTTT GA

Consensus:

B. Enne

ZRSL

-IL

hIGE'BP-1

-118

c-fos

-320

GAeDH

-471

GGATGT-CXTCT AACTTT-TGCCTTTGAAAG

-101

-

-299

47

-444

49

f IRE-A)

promoter activity; and (iii) native, but not mutant, A and B elements confer insulin responsiveness to the heterologous thymidine kinase promoter. Also, partial loss of insulin effect when the IGFBP-1 promoter is deleted to -111 bp (loss of the A element only), and when the A and B elements are individually altered by site-directed mutagenesis (AMB and ABM), suggests that the A and B elements must both be present for maximal responsiveness to insulin. In addition to IGFBP-1, many other genes respond to insulin with a rapid change intranscriptionrate. Insulin stimulhtes transcription of c-fos, glyceraldehyde-3-phosphate dehydrogenase, and a-amylase and inhibits transcription of PEPCK and glucagon (25, 40-44); for each of these genes, a cis element conferring the insulin effect t o the gene promoter has been characterized (26, 40,43,45,46). Comparison of these IRE sequences reveals some similarities. As shown in Fig. 5A, the A and B elements of the IGFBP-1 IRE share sequence similarity with the PEPCK, a-amylase, and glucagon IREs (26, 43, 46). In particular, each of theseIREs contains an AT-rich region with 4 consecutive thymidine residues. Similarity appears strongest between the IGFBP-1 and PEPCK IREs, and it should be noted that a mutation of the glucagon IRE which eliminated the insulin effect did not involve this AT-rich sequence (46). Fig. 5B compares the IGFBP-1 IREwith those from the cfos and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoters. The serum response element of the c-fos promoter is similar to the IGFBP-1 IRE in that it has a central ATrich region and dyad symmetry (45, 47). Two regions of the glyceraldehyde-3-phosphate dehydrogenase IRE-A which may participate in conferring the insulin effect (40, 48, 49) are underlined. The 5' underlined region is not similar to the IGFBP-1 IRE, but the 5'-Py-CTTTG(A/T)-3' motif found in the 3' underlined region exhibits some similarity to the IGFBP-1 A and B elements. Gel mobility shift assayssuggest that a single DNA-binding protein may confer the insulin effect to the IGFBP-1 promoter; considering the dyad symmetry of the IGFBP-1 IRE, this IRE-binding protein (IREBP) may bind the A and B elementsasa homodimer. Serum response factor(SRF), which binds the c-fos serum rr?sponseelement as a homodimer,

bears some similarity to IREBPsince both proteins bindATrich elements even in the presence of high salt concentration (37, 47). DNA binding specificities of SRF and the recently described SRF-related proteins (47, 50, 51) suggest that IREBP, while perhaps a member of the SRF family, is unlikely to be any of the characterized SRF proteins; studiesare currently in progress to address this issue. In comparison to the IGFBP-1 IRE, the a-amylase IRE also forms one band, and the PEPCK and glucagon IREs form at least two bands, during gel mobility shift assay; none of the proteins responsible for these bands has been characterized (26,43, 46). It is possible that IREBP can confer the insulin effect to each of these IREs. IRE-A of the glyceraldehyde-3-phosphate dehydrogenase promoter binds the high mobility group box protein IRE-ABP at the 5'-PyCTTTG(A/T)-3' motif, but the role of IRE-ABP in conferring the insulin effect to the glyceraldehyde-3-phosphate dehydrogenase promoter is unclear (48, 49). It is also currently unclear whether IRE-ABP and the IREBP described in this paper are identical or related proteins, and which, if any, other proteins can confer the effect of insulin to insulinresponsive genes. The mechanism by which insulin changes the level or activity of a transcriptionfactor to alter the transcription rate of any gene is unknown. In gel mobility shift assays of the IGFBP-1 IRE, nuclear extracts from HEP G2 cells treated with or without insulin produced comparable shifted bands; in particular,the IREBPband was of equal intensity for each extract. Past studies of PEPCK,a-amylase,and glucagon IREs in comparable gel mobility shift assays gave similar results (26, 43, 46). Assuming that the proteins identified by gel mobility shift assay confer the insulin effect and are not modified during nuclear extract preparation, the above data suggest that insulin does not alter expression of these proteins, but rather modifies them in a way that changes their effect on transcription rate withoutchanging their IRE binding affinity. This scheme is reminiscent of an interaction between cAMP and CAMPresponse element-binding protein (CREB); cAMP can stimulatephosphorylation of the CREB transactivation domain which results inan increase in CREBmediated transcription without a change in either CREB

17068

Identification of an It2FBiP-1 promoter IRE

expression or the binding affinity of CREB for its' CAMP response element (52). In contrast to the insulin effects on theprotein-IRE interactions described above, insulin increases the amountof protein which binds the glyceraldehyde3-phosphate dehydrogenase IRE, apparently by a phosphorylation event which increases protein affinity for this IRE (40, 53). Thus, insulin may regulate transcription of different genes through different mechanisms. Nevertheless, it is quite possible that phosphorylation/dephosphorylation interconversions are common to all mechanisms. Further study of these mechanisms requires detailed characterization of the specific DNA-binding proteins which confer the insulin effect to specific gene promoter IRES. Acknowledgments-We thank Dm. Ralph Feigin and L. Leighton Hili and the Department of Pediatrics, Baylor College of Medicine for their continued support. REFERENCES 1. Lee,

Y. L., Hintz, R.L., James, P. M., Lee, P. D. K., Shively, J. E., and

Powell, D. R. (1988) Mol. E n d ~ ~ ~ i n2,404-411 ol. 2. Baxter, R. C., and Martin, J. L. (1989) Prog. Growth Factor Res. 1,49-68 3. Kiefer, M. C., Ioh, R. S., Bauer, D. M., and Zapf, J. (1991) Biochem. Biophys. Res. Commun. 176,219-225 4. Ritvos, O., Ranta, T., Jalkanen, J.,Suikkari, A.-M., Voutilainen, R., Bohn, H., and Rutanen,E.". (1988) Endocrinology 122,2150-2157 5. Frauman, A. G., Tsuzaki, S., and Moses, A. C. (1989) Endocrinology 1 2 4 , 22RS-2296 " . ~ 6. Burch, W: M., Correa, J., Shively, J. E., and Powell, D. R. (1990) J. Clin. Endoertnol. Metab. 70, 173-180 7. Conover. C. A.. Ronk. M.. Lombana., F... and Powell. D.R. 11990) , , Endocrinobg$I27,'2795-2803 8. Lewitt, M. S., Denyer, G. S., Cooney,G.J., and Baxter, R.C. (1991) Endocrinology 1 2 9 , 2254-2256 9. Jones, J. I., DErcole, J. D., Camacho-Hubner, C., and Clemmons, D. R. (1991) Proc. Natl. Acad. Sei. U. S. A. 88,7481-7485 10. Brinkman, A., Groffen, C., Kortleve, D. J., &urts van Kessel, A., and Drop, S. L. S. (1988) EMBOJ. 7,2417-2423 11. Mohn, K. L., Melby, A. E., Tewari, D. S., Laz, T. M., and Taub, R. (1991) Mol. Cell. Biol. 11,1393-1401 12. Drop, S. L. S.,,Kortleve, D. J., Guyda, H. J., and Posner, B. I. (1984) J. Clin. Endocrtnol. Metab. 69,908-915 13. Conover, C: A., Butler, P. C., Wang, M., Rizza, R. A., and Lee, P. D. K. (1990) Drobetes 39,1251-1256 14. Suikkari, A,"., Koivisto, V. A,, Rutanen, E."., Yki-Jarvinen, H., Karonen, S. L., and Seppala, M.(1988) J . Cfin. Endocrinol. Metab. 6 6 , 266272 15. Brismar, K., Gutniak, M., Povoa, G., Werner, S., and Hall, K. (1988) J. Endocnnol. inuest. 1 1 , 599-602 16. Yeoh, S. I., and Baxter, R. C. (1988) Acta Endocrinol. 1 2 5 , 140-143 17. Conover, C. A., Divertie, G. D., and Lee, P. D. K. (1993) Acto EndocrinoL, " "

In press

18. Brismar, K., and Hall, K. (1993) Growth Reg. 3 , 98-100 19. Ooi, G.T:, Tseng, L. Y.-H., Tran, M. Q., and Rechler, M. M. (1992) Mol. Endocnnol. 6,2219-2228

20. Lewitt, M. S., and Baxter, R. C. (1989) J. Clin. Endocrinol. Metab. 6 9 , 246-252 21. Conover, C. A., and Lee, P. D. K. (1990) J. Ciin. Endocrinoi Metab. 70,

*"".

I ~" G?-I~G~ "

22. Unterman, T. G., Oehler, D. T., Murphy, L. J., and Lacson, R. G. (1991) Endoermalogy 128,2693-2701 23. Orlowski, C. C., Ooi, G. T., and Rechler, M. M. (1990) Mol. Endocrinol. 4 , 1509-1 *"""

ma

? " . " , .

24. Powell, D. R., Suwanichkul, A., Cubbage M. L., DePaolis, L. A., Snuggs, M. B., and Lee, P. D. K. (1991) J. Biol.'Chem. 266,18868-18876 25. Sasaki, K., Cripe, T. P., Koch, S. R., Andreone, T. L., Petersen, D.D., Beale, E. G., and Granner,D. K. (1984) J. Biol. Chem. 269,15242-15251 26. OBrien, R. M., Lucas, P. C., Forest, C. D., Magnuson, M. A., and Granner, D. K. (1990) Science 249,533-537 27. Suwanichkul, A., Cubbage, M. L., and Powell, D. R. (1990) J. Bioi. Chem. 266,21185-21193 28. Powell, D. R., Suwanichkul, A., and Cubba e, M. L. (1989) in insulin-like Growth Factor Btnding Proteins (Drop, L. S., and Hintz, R. L., eds) pp. 3-8, Elsevier Science Publishers B.V., Amsterdam 29. Jacoby, D. B., Zilz, N. D., and Towle, H. C. (1989) J. Biol. Chem. 2 6 4 , 17623-17626 30. Cubbage, M. L., Suwanichkul, A,, and Powell, D. R. (1989) Mol. Endocrinol. 3,846-851 31. Kunkef, T. A. (1985) Proc. Natl. Acad. Sei U. S. A. 82,488-492 32. Kunkel, T. A., Roberts, J. D., and Zabour, R. A. (1987) Methods Enzymol. 154,367-382 33. Suwanichkul, A., DePaolis, L, A., Lee, P. D. K., and Powell, D. R.(1993) J. Biol. Chem. 268,9730-9736 34. deWet, J. R., Wood, K. V., de Luca, M., Helinski, D. R., and Subramani, S. (1987) Mol. Cell. Biol. 7, 725-737 35. Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol Cell. Biol. 2 , 1044-1051 36. Shapifz, D. J., Sharp, P. A., Wahli, W. W., and Keller, M. J. (1988) DNA

8.

37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53.