Identification of candidate genes for psychosis in rat models, and ...

Molecular Psychiatry (2003) 8, 156–166 & 2003 Nature Publishing Group All rights reserved 1359-4184/03 $25.00 www.nature.com/mp

IMMEDIATE COMMUNICATION

Identification of candidate genes for psychosis in rat models, and possible association between schizophrenia and the 14-3-3g gene AHC Wong1,2,4, F Macciardi1,2, T Klempan1,4, W Kawczynski1, CL Barr2, S Lakatoo1, M Wong1, C Buckle1, J Trakalo1, E Boffa1,2, J Oak1, M-H Azevedo5, A Dourado5, I Coelho5, A Macedo5, A Vicente5, J Valente5, CP Ferreira6, MT Pato6, CN Pato6, JL Kennedy1,2,4 and HHM Van Tol1,2,3,4 1 Centre for Addiction and Mental Health, Faculty of Medicine, University of Toronto, Toronto, ON, Canada; 2Department of Psychiatry, Faculty of Medicine, University of Toronto, Toronto, ON, Canada; 3Department of Pharmacology, Faculty of Medicine, University of Toronto, Toronto, ON, Canada; 4Institute of Medical Science, Faculty of Medicine, University of Toronto, Toronto, ON, Canada; 5Department of Psychiatry, University of Coimbra, Portugal; 6State University of New York, Buffalo, NY, USA

Although the genetic contribution to schizophrenia is substantial, positive findings in wholegenome linkage scans have not been consistently replicated. We analyzed gene expression in various rat conditions to identify novel candidate genes for schizophrenia. Suppression subtraction hybridization (SSH), with polyA mRNA from temporal and frontal cortex of rats, was used to identify differentially expressed genes. Expression of mRNA was compared between adult Lewis and Fischer 344 (F344) rats, adult and postnatal day 6 (d6) F344, and adult F344 treated with haloperidol or control vehicle. These groups were chosen because each highlights a particular aspect of schizophrenia: differences in strain vulnerability to behavioral analogs of psychosis; factors that may relate to disease onset in relation to CNS development; and improvement of symptoms by haloperidol. The 14-3-3 gene family, as represented by 14-33c and 14-3-3f isoforms in the SSH study, and SNAP-25 were among the candidate genes. Genetic association between schizophrenia and the 14-3-3g gene, positioned close to a genomic locus implicated in schizophrenia, and SNAP-25 genes was analyzed in 168 schizophrenia probands and their families. These findings address three different genes in the 14-3-3 family. We find a significant association with schizophrenia for two polymorphisms in the 14-3-3g gene: a 7 bp variable number of tandem repeats in the 50 noncoding region (P ¼ 0.036, 1 df), and a 30 untranslated region SNP (753G/A) that is an RFLP visualized with Ava II (P ¼ 0.028). There was no significant genetic association with SNAP-25. The candidate genes identified may be of functional importance in the etiology, pathophysiology or treatment response of schizophrenia or psychotic symptoms. This is to our knowledge the first report of a significant association between the 14-3-3g-chain gene and schizophrenia in a family-based sample, strengthening prior association reports in case–control studies and microarray gene expression studies. Molecular Psychiatry (2003) 8, 156–166. doi:10.1038/sj.mp.4001237 Keywords: schizophrenia; genetics; rat models; 14-3-3; SNAP-25; linkage; animal models; antipsychotics

1. Introduction Schizophrenia is a major mental illness that affects people worldwide, with a lifetime prevalence of approximately 0.5–1%.1 Although the genetic contribution to the risk of developing schizophrenia is substantial, the underlying etiology and pathophysiology remain unknown. Antipsychotics are an effective treatment for the positive symptoms of schizophrenia, but the illness continues to produce Correspondence: HHM van Tol or JL Kennedy, Centre for Addiction and Mental Health, 250 College Street, Toronto, ON, Canada, M5T 1R8. E-mails: [email protected], [email protected]

considerable disability.2 While continuing research into optimizing existing drugs and psychosocial treatments is vital to improve quality of life, categorically improved treatment depends on knowledge of the underlying causes and mechanisms of schizophrenia. To date, the search for causative genes in this complex neurodevelopmental disorder has been unsuccessful, but linkage studies have identified potential loci of interest on chromosomes 1,3 2, 4, 5, 6, 7, 8, 9, 10, 13, 15, 18, 22, and X, as reviewed by Riley and Mc GuGuffin.4 However, linkage results either require replication, have contradicting reports, or do not meet the statistical criteria for significant linkage.5 The problems of phenocopy, population stratification,

14-3-3 and schizophrenia AHC Wong et al

incomplete penetrance, an unknown mode of inheritance, assortative mating, genetic heterogeneity, and the possibility of many interacting genes, each of which may confer only a moderate or small relative risk for schizophrenia, create a formidable challenge.5–7 In another approach to identifying candidate genes for schizophrenia, we examined differential gene expression in a variety of rat preparations based on the neonatal ventral-hippocampal (VH) lesion model.8 The VH lesion produces abnormalities similar to those in other animal models used to test antipsychotic drugs, and in schizophrenia. These rats show a delayed emergence of hyperactivity that is blocked by haloperidol. In addition, these animals have impaired prepulse inhibition,9 decreased haloperidol-induced catalepsy, decreased apomorphine-induced stereotypy,10,11 increased startle amplitude, and persisting deficits in spatial learning and working memory.12 The lesioned rats also have attenuated extracellular DA levels in the striatum after stress and amphetamine exposure.13 Of relevance to the genetic factors contributing to schizophrenia is the fact that the locomotor abnormalities induced by VH lesions are strain dependent. Fischer 344 (F334) rats display changes in locomotion at postoperative day 35, and effects at day 56 were exaggerated in comparison with Sprague–Dawley rats, which are normal at day 35. Lewis rats, in contrast, appear to be resistant to the motor effects of VH lesions.14 Any animal model of psychiatric illness is problematic since the core symptoms reflect abnormal internal states, which may exist while a patient appears outwardly normal. However, these VH-lesioned rats exhibit some of the more important biological and behavioral correlates of schizophrenia: cortical migration defects, dopaminergic system abnormalities, cognitive impairment, hippocampal changes, and hyper-responsiveness to amphetamine and stress.15 Also, they exhibit a delayed onset of signs roughly parallel to the onset of schizophrenia in humans. Based on the VH lesion model, we made comparisons of differentially expressed genes in three sets of animals to focus on strain differences, age of phenotype onset, and antipsychotic treatment. These comparisons were performed on F344 vs Lewis rats, adult vs postnatal day 6 (d6) F344 rats, and antipsychotictreated vs control-treated F344 rats. These groups were chosen because each highlights the potential genetic factors that may contribute to the cause or physiology of schizophrenia: genetic differences in vulnerability to psychosis; factors that may relate to disease onset in relation to CNS development; and improvement of positive symptoms by haloperidol. The suppression PCR procedure was applied to polyA mRNA from frontal and temporal cortex. These tissues were chosen because cytoarchitectural abnormalities have been localized in these areas in postmortem schizophrenic brains.16 Abnormalities in motivation, cognition, and perception have also been attributed to these brain areas in schizophrenia.17

157

Materials and methods Animal models All animal procedures were carried out in accordance with our institutional animal care committee, which oversees and approves all animal experimentation. Animals in our facility were obtained from Charles River Laboratories Inc. (Wilmington, MD, USA), and were housed in our animal colony with 12-h light– dark cycles and food ad libitum. There were five groups of six rats each: adult F344, adult Lewis, d6 F344, haloperidol- and vehicle-treated adult F344 rats. Adult postnatal day 50 (d50) F344 and adult (d50) Lewis rats were housed for 2 weeks until being killed at B day 70. Pregnant F344 rats gave birth shortly before or after arrival, and neonatal (d5–7) rats were killed. The medication-treated adult F344 animals received daily treatment with either 0.15 mg/kg i.p. haloperidol (Research Biochemicals International) dissolved in 1.5% tartaric acid (Fisher Scientific Company, Fair Lawn, NJ, USA), or vehicle alone, for 14 days, and were killed the day after, at approximately the same age as the untreated rats (postnatal day 70). Identification of differentially expressed genes We used suppression subtraction hybridization (SSH)18 to identify differentially expressed genes. We used the Clontech PCR-Selectt cDNA Subtraction Kit (Catalog #K1804-1, Clontech Laboratories Inc., Palo Alto, CA, USA) and confirmed differential expression with the Clontech PCR-Select Differential Screening Kit. This was applied to three animal paradigms: F344 treated with haloperidol or vehicle, adult F344 vs Lewis, and adult vs d6 F344 rats. The SSH procedure was applied to a total of 12 samples (three animal comparisons, with both frontal and temporal cortical tissue, with each RNA sample being used alternately as ‘tester’ and ‘driver’). Poly A and total RNA isolation was done with the Rneasys Mini Kit and the Oligotex mRNA mini Kit (both from Qiagen Inc., Valencia, CA, USA), respectively. We pooled the ‘forward’ and ‘reverse’ SSH products since each reaction identifies increased expression in the ‘tester’ tissue. Pooled samples, therefore, contain genes that are both up- and downregulated in each animal comparison. Temporal and frontal cortex samples were kept separate to allow for later localization of differential genes. Six cDNA libraries were constructed, consisting of comparisons between each of the three animal comparisons for both temporal and frontal cortical tissue. Each cDNA library was created by cloning the PCR product into the pT-Adv Vector (Clontech) and transfecting Epicurian Colis XL10-Goldt Ultracompetent Cells (Stratagene, La Jolla, CA, USA) using the manufacturer’s protocol. cDNA libraries were plated onto X-galactosidase/IPTG (100 mm) agarose plates. Approximately 50% of colonies were positive in the blue/white screening. After determining the titer, libraries were plated onto 10 160 mm2 LB-ampicil-

Molecular Psychiatry


158 5′ noncoding region SNP (-408T/G) Significant association in a casecontrol study (22).

Exon 2: 3′ untranslated region SNP (753G/A) Ava II RFLP significant association in our family-based study (p=0.028).

8kb (Intron)

5′ Exon 1 (243bp)

3′ Exon 2 (1464bp)

Exon 1: untranslated region 7bp VNTR (-134 GCCTGCA) significant association in casecontrol study (31), and our family-based study (p=0.036).

Figure 1

Polymorphisms in the 14-3-3Z gene that have a genetic association with schizophrenia (not to scale).

lin plates, yielding an average of B5000 colonies per plate. Therefore, a total of 50 000 colonies were screened for each library to ensure a representative sample. Colonies were lifted with Colony/Plaque Screent hybridization transfer membranes (NENs Research Products/Dupont, Boston, MA, USA), washed twice in 0.5 N NaOH, and twice in 1.0 M Tris-HCl, pH 7.5, and baked at 1001C for 1 min. Probes from each SSH product (pooled in the same way as the cDNA libraries) were created using tertiary PCR of the SSH reaction according to the manufacturer’s procedure (Clontech). a-32P (Easytidest a-32P dCTP, 6000 Ci/ mmol, NEN, Boston, MA, USA) labeling was done with the Random Primed DNA Labeling Kit (Boeringer-Mannheim GmbH, Germany). The membranes from the haloperidol vs vehicle comparison were probed first with adult F344 vs d6 F344 probe, and second with Lewis vs F344 probe. The membranes from Lewis vs F344 comparisons were probed first with haloperidol vs vehicle probe and then with haloperidol vs vehicle probes . The hybridization solution was 1% SDS, 2 SSC, 10% dextran sulfate in 50% deionized formamide. Blocking solution(100 ml) (10 mg/ml fish sperm DNA, 25 mg each of the nested PCR primers used in the original reactions and 75 mg of pT-Adv plasmid was added to each 10 ml of hybridization solution to decrease non-specific hybridization. Membranes were pre-hybridized for 4 h at 421C with gentle agitation. Probes were denatured at 95% for 10 min, and cooled on ice for 15 min before being added to the hybridization bath. Overnight hybridization at 421C was followed by washes in 2 SSC, 0.1% SDS for 15 min at 651C, and 0.2% SSC, 0.1% SDS for 15 min at 651C. The membranes were then wrapped in plastic and exposed to X-ray film. From these films a random Molecular Psychiatry

selection of 80 colonies was made. The original colonies were picked from the plates, grown in LBA, and DNA extracted using standard procedures. Each clone was sequenced by the dideoxy chain termination method, and scanned for homology in the NCBI Genbank database. These positive clones represent genes that were altered in expression levels by strain difference, age, or haloperidol treatment, and have a putative relationship with the expression of the abnormal rat behaviors. There were several criteria for selecting candidate genes from these clones. The chromosomal location of the gene or functionally related genes or isoforms was an important criterion, since the second set of experiments was to test genetic association of these candidate genes with schizophrenia. Thus, candidate genes or their close relatives that are located in chromosomal regions previously associated with schizophrenia have high priority. For the same reason, genes that have previously been demonstrated to be associated with schizophrenia were also given high priority as candidates. Northern blots PolyA RNA from a separate set of animals (distinct from the rats from which the RNA for SSH was obtained) was glyoxylated by combining 2.6 ml RNA (1 mg) with 1.5 ml 0.1 M sodium phosphate pH 6.8, 8 ml DMSO, and 2.6 ml deionized glyoxal, and incubating at 511C for 1 h. After adding 2 ml RNA loading buffer, the samples were run in a 1% agarose gel in 15 mM Sodium phosphate buffer at 60 V for 2–3 h. RNA was transferred to Hybondt N þ positively charged nylon membrane Version 2.0 (Amersham Life Science, Amersham, UK) with overnight capillary transfer in 25 mM sodium phosphate buffer, and then baked at 80oC for 2 h. Radiolabeled probes from the


selected positive clones were prepared as above and hybridized according to the membrane manufacturer’s protocol. The Northern blots were exposed on a phosphor-imaging screen and scanned (Molecular Dynamics Storm 860, Sunnyvale, CA, USA). The Northern blots were analyzed and quantitated with ImageQuant software (Molecular Dynamics, Sunnyvale, CA, USA). Three sets of Northern blots were performed to confirm differential expression. The expression levels of each gene in each blot and animal type were quantitated as a ratio of optical intensity vs the intensity of cyclophilin expression. The values for each gene between blots were then normalized to the F344 frontal sample (assigned a value of 1). Statistical comparisons included one-way ANOVA on the samples for each gene, and Student’s t-test on each pair of relevant comparisons (for temporal and frontal tissue separately): adult F344 vs d6 F344, F344 vs Lewis, and haloperidol-treated vs vehicle-treated F344. Real-time quantitative PCR with SNAP-25 All quantitative PCR reactions were performed using the Bio-Rad i-cycler thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA) and SYBR I green fluorescent dye (Perkin-Elmer/Applied Biosystems, Foster City, CA, USA). PCR primers were selected from the rat SNAP-25 cDNA sequence on the National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov/) as submitted by Cho et al (accession number AF245227). The forward primer sequence was: 50 -tccatgacagtagcatactg and the reverse primer was 50 -gacagaagaaggtgacacag, yielding an amplicon 139 bp in length. The cycling conditions were denaturing cycle at 951C for 4.5 min followed by 50 cycles of 951C 20 s, 561C 15 s and 721C 15 s. PCR products were visualized on a 2.5% agarose gel in TAE after being run for 45 min at 100 V, to check the quality of the amplification. Fluorescence readings were taken at 1-s intervals throughout the extension step and plotted using the proprietary software to yield an amplification threshold value for each sample. Three PCR reactions were performed for each cDNA sample, in two successive runs, for a total of six PCR reactions per cDNA type. One cDNA sample was serially diluted in four, 10-fold increments, and triplicate quantitative PCR reactions were performed. This dilution experiment established the relationship between relative concentration and threshold value for SNAP-25 using these PCR reaction conditions. Patient recruitment and sample collection Subjects for this study were recruited with fully informed written consent, and in accordance with University of Toronto and Medical Research Council of Canada guidelines for the ethical treatment of human subjects. A total of 168 trios and nuclear families consisting of probands with schizophrenia, their parents, and siblings if available, were collected from both mainland Portugal (Coimbra) and the Azores islands (87 trios), and from hospitals in

Toronto, Ontario (81 trios). The collection of patient samples from Portugal was within the framework of a NIMH-sponsored grant to one of the authors (CP). All patients had a diagnosis of schizophrenia according to DSMIIIR/DSM-IV.19 In patients from continental Portugal and the Azores, the diagnosis was confirmed with the Diagnostic Interview for Genetic Studies (DIGS).20 A Structured Clinical Interview for Diagnosis (SCID) was administered by trained research assistants to each proband from the Toronto region to confirm a DSM-IIIR diagnosis of schizophrenia. Patients had already received an independent clinical diagnosis of schizophrenia from their referring psychiatrist. In both samples, a consensus-based procedure provided the ultimate decision for the diagnostic classification of the patients. The ethnic origin of patients from Toronto reflected the diverse population of the surrounding city, but the samples provided in collaboration with Dr Carlos Pato were primarily of Portuguese descent, with a high degree of population homogeneity in the Azores sample. Venous blood was obtained from subjects using standard venipuncture techniques. DNA was extracted using a nonenzymatic high-salt procedure.21

159

14-3-3Z genotyping The 7-nucleotide (GCCTGCA) repeat in the 14-3-3Z gene, 50 -noncoding region was amplified as part of a 180 bp fragment (referred to hereafter as the variable number of tandem repeats (VNTR) polymorphism). The specific primers used were 50 -gtc tcc tcc ctc ggc gtt (forward) and 50 -cac acc gct ggc tcg cta (reverse), combined in a mix at 0.2 mM (Research Genetics Inc., Hunstville, AL, USA). The forward primer was tagged with a dye molecule that enabled later detection by the automated sequencer. The reaction mixture consisted of 3 ml of 50 ng/ml genomic DNA from our human subjects, 2.5 ml of 10 PCR buffer, 2.5 ml of 25 mM MgCl2, 0.5 ml of 0.2 mM primer mix, 0.5 ml of deaza-dNTP mix (0.2 mM dATP, dCTP, dTTP, 0.15 mM dGTP, and 0.05mM 7-deaza-dGTP), 2ml 8% DMSO, 0.125ml Taq polymerase, and 14 ml of deionized H2O. After denaturing at 951C for 5 min, 35 cycles of PCR in a Perkin-Elmer GeneAmp PCR system 9700 were performed under the following conditions: 941C 30 s, 591C 30 s, 721C 45 s. Extension of the reaction was at 721C for 7 min. The VNTR PCR product was precipitated with 65.25 mM solution of glycogen (0.25 ml, from Hoffman LaRoche), sodium acetate (2.5 ml, from Sigma-Aldrich Canada), and 95% ethanol (62.5 ml). The mixture was centrifuged at 41C at maximal speed (12–15 000 rpm) for 15 min. A second wash with 200 ml of cold 70% ethanol was centrifuged the same way. The pellet was then dried under vacuum and low-speed centrifugation, and resuspended in 40 ml of deionized formamide and stored at 201C. The VNTR was visualized with an automated Beckman-Coulter CEQ 2000XL fragment analyzer, used according to the manufacturer’s instructions. The formamide solution was serially diluted to 1:100, and 35.5 ml was added to Molecular Psychiatry


160

0.5 ml of 400 bp DNA size standard (Beckman-Coulter, Fullerton CA, USA) before loading into the machine. A single-nucleotide polymorphism (SNP) in the 30 untranslated region of the 14-3-3Z gene (753G/A) can be visualized as a restriction fragment length polymorphism with the enzyme Ava II.22 A 303 bp amplicon was amplified using the primers (forward) 50 -ctt agc caa aca agc ctt cg and (reverse) 50 -ttc cca aga gac agg agt gc. After denaturing at 951C for 5 min, 35 cycles of PCR in a Perkin-Elmer GeneAmp PCR system 9700 were performed under the following conditions: 941C 30 s, 581C 45 s, 721C 45 s. Extension of the reaction was at 721C for 7 min. Overnight digestion with Ava II was followed by agarosegel electrophoresis, revealing an uncut product of 303 bp, and cut products of 168 and 135 bp.

Mnl I digestion was done by adding 2.5 ml 10 buffer #2, 0.5 ml Mnl I (5 U/ml), 0.25 ml of 100 BSA (all three components from New England Biotech, Beverly, MA, USA), and 1.75 ml H2O to each PCR reaction. After digestion at 371C for 4 h, the sample was run on a 2.5% agarose gel at 100 V for 60–80 min. The uncut allele appeared as a 256 bp band, while the cut allele had bands corresponding to 210 and 46 bp. Dde I digestion was done by adding: 2.5 ml 10 buffer #3, 0.25 ml Dde I (10 U/ml), (both from New England Biotech, Beverly, MA, USA), and 2.25 ml H2O to each PCR reaction. After digestion at 371C for 4 h, the sample was run on a 2.5% agarose gel at 100 V for 80– 90 min. The uncut allele appeared as a 261 bp band, while the cut allele had bands corresponding to 228 and 33 bp.

SNAP-25 genotyping Three restriction fragment length polymorphisms (RFLPs) in the SNAP-25 gene were typed with the enzymes Mnl I, Dde I,23 and Tai I (NCBI Assay ID: 460462) from the NCBI website (http://www.ncbi. nlm.nih.gov/SNP/snp_ref.cgi?locusId ¼ 6616). The Mnl I and Dde RFLPs are closely opposed, and are visualized by digesting the same PCR amplicon. The PCR reaction for the Tai I digest used the following mixture: 2.5 ml genomic DNA (50 ng/ml), 2.5 ml 10 PCR buffer (Perkin-Elmer, Branchburg, NJ, USA), 1.5 ml of 25 mM MgCl2 (Perkin-Elmer), 0.5 ml of 10 mM dNTP mix (Amersham Pharmacia Biotech, Piscataway, NJ, USA), 2 ml each of 20 ng/ml primers, 0.2 ml Taq (5U/ml) polymerase (Perkin-Elmer), and 13.8 ml deionized H2O. Primer sequences were (50 ) tggctgaaattatgtcaaatgg and (50 ) aacaaaccacaggggaaatg (ACGT Corporation, Toronto, ON, Canada). After denaturing at 951C for 5 min, 35 cycles of PCR in a Perkin-Elmer GeneAmp PCR system 9700 were performed with the following conditions: 941C 30 s, 531C 30 s, 721C 30 s. extension of the reaction was at 721C for 10 min. The PCR product was digested by adding 2.6 ml Buffer R þ with BSA (MBI Fermentas, Amherst, NY, USA), 0.25 ml Tai I (5U/ml, MBI Fermentas), and 2.9 ml deionized H2O to each PCR reaction, and incubated at 651C overnight (16 h). The polymorphism was visualized on a 2.5% agarose gel at 100 V for 45–60 min, yielding an B150 bp uncut band and B90bp/60 bp cut bands. The Mnl I/Dde I primer sequences were (50 ) ttctcctccaaatgctgtcg and (50 ) ccaccgaggagagaaaatg (ACGT corporation) as described by Barr et al.23 The PCR reaction consisted of 2.5 ml genomic DNA (50 ng/ ml), 2.5 ml 10 PCR buffer (Perkin-Elmer, Branchburg, NJ, USA), 1.5 ml of 25 mM MgCl2 (Perkin-Elmer), 0.4 ml of 10 mM dNTP mix (Amersham Pharmacia Biotech, Piscataway, NJ, USA), 2 ml each of 20 ng/ml primer, 0.2 ml Taq (5 U/ml) polymerase (Perkin-Elmer), and 13.9 ml deionized H2O. After denaturing at 951C for 5 min, 35 cycles of PCR in a Perkin-Elmer GeneAmp PCR system 9700 were performed with the following conditions: 941C 30 s, 601C 40 s, 721C 30 s. Extension of the reaction was at 721C for 7 min.

Genetic statistical analysis We evaluated demographic and specific population genetic differences with traditional statistical techniques, using w2 and t-test procedures for categorical and continuous variables, respectively, where applicable (Stata 6.0, Stata Corporation, 1996). The analysis of the association/linkage disequilibrium between schizophrenia and the two 14-3-3Z polymorphisms, and the three SNAP-25 RFLP polymorphisms was performed using the TDT-STDT Program 1.124 that controls whether alleles transmitted from parents to their affected offspring deviate from the expected 50 : 50 Mendelian ratio. Moreover, we also controlled for the possibility of a parent-of-origin effect by applying the TDT test only to maternal or paternal meioses. The polymorphisms were also analyzed with FBAT (family-based association test).25


Results Approximately 10–20% of plated colonies in each of the six libraries were positive in the first cross-library hybridization. Of these colonies, 30–60% were again positive in the second round of cross-library probing. Therefore, each plate had B300 positive colonies, for a total of B3000 positive colonies in each library (represented by B50 000 colonies). From these positive clones, 80 (out of a total of B18 000 clones) were randomly selected. These positive clones represented genes that were differentially expressed in all of the three SSH comparisons: strain (F344 vs Lewis), age (d6 vs d70), and haloperidol vs control treatment. These 80 positive clones were each sequenced and analyzed to yield a limited number of candidate genes: mitochondrial cytochrome oxidase (complex IV) subunits including COX1 and 2; mitochondrial tRNA; g and z isoforms of 14-3-3, a protein kinase regulatory protein; adenosine monophosphate deaminase 3 (Ampd3), and SNAP-25 (25 kD a synaptosomal associated protein). Mitochondrial cytochrome oxidase (COX) c subunits were identified in 43 clones. In these positives, 27 different parts of the COX gene (some overlapping) were present owing to the way in which the SSH selectively amplifies parts of differ-


Table 1 Northern blot results showing relative expression levels of Ampd3, Cox I and 14-3-3 Ampd3

COX I

14-3-3

Frontal F344 Lewis D6

1.00 0.79 0.44*

1.00 0.70 0.69*

1.00 0.74 1.36

Vehicle Haloperidol

1.00 1.13

1.00 1.20

1.00 0.85

Temporal F344 Lewis D6

1.00 0.70 0.35*

1.00 0.66* 0.42*

1.00 0.59* 1.55

Vehicle Haloperidol

1.00 0.90

1.00 0.78

1.00 1.07

Numbers represent the ratio of hybridization intensity of each gene vs that of cyclophilin. Each value is the mean of three separate Northern blots. Values are normalized to the value for F344 rats or vehicle-treated rats within each tissue type. t-Test comparisons showed significant differences (*) between (P-values in parentheses) Ampd3, F344 vs d6 frontal (0.012), F344 vs d6 temporal (0.013); COX I, F344 vs d6 frontal (0.02), F344 vs d6 temporal (0.0001), F344 vs Lewis temporal (0.001); 14-3-3z, F344 vs Lewis temporal (0.044), with the first of each pair showing greater expression levels.

entially expressed genes. Different parts of mitochondrial 12s and 16s rRNA were found in two clones, and four clones were of three nonidentical parts of mitochondrial COX b subunits. Five clones matched two different parts of the rat mitochondrial genome, and one clone matched mRNA for the Mss4 protein. Two different and nonoverlapping parts of SNAP-25 were identified in two separate clones. The 14-3-3 g isoform gene was positive in one clone, and the z isoform in two identical clones. One sequence from AMPD3 was found in two clones. The remaining positives were plasmid-related inserts,10 ESTs,6 or unknown sequences2 that did not have significant homology to any sequences in Genbank. We have confirmed the differential expression of 14-3-3z, Ampd3, and COX 1 with Northern blots of polyA mRNA isolated from the same three animal treatments (Table 1). One-way ANOVA on each gene yielded P-values o0.0006. t-test comparisons showed significant differences between (P-values in parentheses): Ampd, F344 vs d6 frontal (0.012), F344 vs d6 temporal (0.013); COX I, F344 vs d6 frontal (0.02), F344 vs d6 temporal (0.0001), F344 vs Lewis temporal (0.001) 14-3-3z, F344 vs Lewis temporal (0.044), with the first of each pair showing greater expression levels. Quantitative PCR results SNAP-25 Quantitative PCR was used to confirm the differential expression of SNAP-25 because of a lack in sensitivity

of the Northern blot technique to reliably quantitate SNAP-25 mRNA. A log-linear regression analysis of the serial dilution results was performed. Threshold cycle values for these samples of known relative dilution were plotted against the log of their relative dilution to yield the standard curve. The regression statistic was based on four dilutions, and showed a multiple r-value of 0.993 (s.e. 1.334), which indicates good agreement with the theoretical regression curve. The regression generated a standard curve that allowed the conversion of experimental sample threshold values into a relative dilution number. The relative dilution number was then used to compare the relative amounts of SNAP-25 cDNA in each experimental sample, and had a standard percentage error of 4.61%. The results were grouped and normalized to the F344 or control animal in each group. ANOVA results showed significant differences between groups: temporal F ¼ 16.28, df ¼ 8, P ¼ 1.713E08 and frontal F ¼ 31.96, df ¼ 8, P ¼ 4.240E16. t-Tests were also significant for differences related to rat strain, age, and haloperidol treatment. The results indicate that haloperidol appears to significantly decrease SNAP-25 expression levels, especially in the temporal cortex. The most dramatic differences were a three-fold increase in SNAP-25 expression during development from d6 until d70, and 25–50% greater expression levels in F344 vs Lewis rats. Both of these differences appear more pronounced in the temporal tissue rather than the frontal cortex (see Table 2).

161

Genetic association results We chose to examine genetic association between schizophrenia and both 14-3-3 and SNAP-25 for several reasons. Both genes were identified as being differentially expressed in the various rat preparations described above. SNAP-25 was also selected Table 2 Quantitative PCR results for SNAP-25 showing relative expression levels normalized to F344 or vehicletreated animals in each group Frontal

Temporal

F344 Lewis Day 6

1 0.88* 0.46*

1 0.72* 0.36*

Vehicle Haloperidol

1 0.85*

1 0.73*

Numbers shown are the mean of six individual q-PCR reactions. Mean standard percentage error is 4.61%. Negative control samples showed a value of 0.00. All relevant comparisons are significant (*), with P-values as follows: frontal tissueFF344 vs Lewis (P = 0.027), F344 vs d6 (P = 1.1 106), Haloperidol vs vehicle treatment (P = 0.026); temporal tissueFF344 vs Lewis (P = 0.00015), F344 vs d6 (P = 9.5 106), Haloperidol vs vehicle treatment (P=0.0078). Molecular Psychiatry


162

Table 3 Transmission disequilibrium test with the VNTR two-repeat allele of 14-3-3Z for all sample populations Sample population

Transmitted

Untransmitted

w2

P-value

Portuguese Toronto Combined

44 13 57

25 11 36

5.232 0.167 4.348

0.022 NS 0.036

because the hyperlocomotion seen in the coloboma (Cm/ þ ) mutant mouse, which has SNAP-25 deleted, resembles the hyperlocomotion seen in the VH lesion rat.26 The expression of SNAP-25 and other synaptic proteins and mRNA have been found to be abnormal in schizophrenia (see Discussion).27 14-3-3Z is located near a chromosomal region previously linked to schizophrenia in genome scans,28 and associated with velo-cardio-facial syndrome (VCFS), which predisposes patients to schizophrenia.29 Although the 14-33g and 14-3-3z isoform genes were identified in our differential expression screen, we chose to examine genetic association between schizophrenia and the 14-3-3Z isoform gene, because the Z isoform is the one located on 22q12.1–q13.1, near the previously described susceptibility region for schizophrenia, and reported in a similar prefrontal microarray study of schizophrenia.30 This isoform has also been reported to be associated with schizophrenia in two previous case–control studies by other groups.22,31 The mean age of the Toronto and Portuguese subjects was 34.3 and 33.6 years, respectively, and the mean age of onset (when available) was 19.6 and 22.1 years, respectively. For the combined sample, the mean age was 33.9 years and the mean age of onset was 21.1 years. In the Toronto sample, the male : female ratio was 69.9 : 30.1, and in the Portuguese sample it was 63.6 : 36.3. In the combined sample, the male : female ratio was 66 : 34. None of these differences is statistically significant. Allele frequencies were not significantly different between the samples despite their diverse origins, as might be expected in a highly conserved gene. This was assessed with a simple analysis of allelic frequencies across the two populations (Portuguese and Toronto/ North American) by a w2 test (w2 2.06, 1 df, P ¼ 0.15). Therefore, the samples were combined in the overall analysis.

We have found a statistically significant association between the 14-3-3Z VNTR polymorphism and schizophrenia; see Table 3. The transmission disequilibrium test showed a w2 value of 4.35 (P ¼ 0.036, 1 df); the two-repeat allele was transmitted more frequently with schizophrenia (n ¼ 57) than nontransmitted (n ¼ 36). There is a difference in the degree of heterozygosity in the two samples, with the Portuguese showing a larger number of heterozygous individuals than the Canadian sample. As a consequence, the Portuguese contribution to the significant association is higher than for the Canadian samples, and in fact the Portuguese sample alone shows a more significant result (P ¼ 0.022, 1 df). In our sample, we did not find a significant parent-of-origin effect. The allele frequencies were 0.386 and 0.614 for the one and two-repeat alleles, respectively. The results of the combined TDT–sTDT were not significant, with z0 scores of 1.861 and 1.909 for alleles 1 and 2, respectively, with the threshold for significance at 1.96. FBAT analysis did not show a significant association between the 14-3-3 VNTR and schizophrenia. The additive biallelic, dominant biallelic, and dominant multiallelic models were tested. The discrepancy between the FBAT and TDT results arises from the different mathematical formulae used to compute the respective statistics, and that in some families the FBAT uses additional relatives that the TDT does not (some of our sample families had DNA from only one parent available, and the number of sibs was quite variable). Their disagreement underscores the controversy surrounding the best method of determining genetic linkage.32 A significant association was also demonstrated between schizophrenia and the Ava II polymorphism using the combined TDT–sTDT test (z0 ¼ 2.203, P ¼ 0.028) in the combined Toronto and Portuguese population, as shown in Table 4. In the Portuguese population alone the TDT–sTDT is also significant (z0 ¼ 2.053, P ¼ 0.02), but not in the Toronto sample alone (z0 ¼ 1.627, P ¼ 0.052). The allele frequencies for the cut and uncut alleles were 0.322 and 0.678, respectively. FBAT analysis also showed a significant association between the 14-3-3 Ava II polymorphism and schizophrenia (P ¼ 0.008) using an additive, biallelic model, and with a dominant biallelic model (P ¼ 0.019). Schizophrenia is not a monogenic disorder and any possible gene must be viewed in the larger context of a ‘multigenic’ model. Under this

Table 4 Transmission disequilibrium test (including sTDT) with the Ava II polymorphism of 14-3-3Z demonstrating a significant association (*) with schizophrenia TDT Allele

b

c

1 2

37 53

53 37


sTDT

Combined Scores

w2

Y

Mean (A)

Var (V)

z0

2.844 2.844

14 62

18.155 54.31

5.494 11.087

1.559 2.159

W 51 115

Mean (A)

Var (V)

z0

63.155 99.31

27.994 33.587

2.203* 2.621*


scenario, a given gene can be significant in a codominant/dominant way, probably depending on the specific (but unobserved) interaction with other genes. Overall, the analysis of the polymorphisms in SNAP-25 did not show a significant association with schizophrenia. A significant result was observed with the TDT on the Toronto sample alone, with the Tai I polymorphism. The cut allele (n ¼ 20) was transmitted more frequently with schizophrenia than the uncut allele (n ¼ 9), with a w2 value of 4.172 (P ¼ 0.041, 1 df). However, in the combined TDT– sTDT with the Toronto population, and the combined Toronto and Portuguese population with both the TDT alone and the combined TDT–sTDT, the results are nonsignificant. The other polymorphisms (Mnl I and Dde I) showed no significant association in any of the tests or populations.

Discussion The genes we have identified were differentially expressed in rats as a result of differences in strain type, age, and treatment with haloperidol. This is a novel approach to the identification of candidate genes in schizophrenia. Instead of pursuing genes that are theoretically related to psychosis or its treatment, we have chosen to compare gene expression in animals that have different vulnerabilities or responses to the effects of the neonatal VH lesion. While imperfect, this lesion model simulates some of the behavioral phenotypes seen in other animal models used to test antipsychotics, and also seen in humans with psychosis. Therefore, the candidate genes we are reporting may be important in the pathophysiology of psychotic symptoms. Two of the different gene groups we identified (SNAP-25 and 14-3-3) were used for human genetic analysis because of existing experimental data that strengthen the case for the involvement of these genes in schizophrenia. The finding that the majority of genes identified (51/80, 64%) relate to the oxidative respiratory chain or are mitochondrial genes raises interesting possibilities for further investigation. Post-mortem studies of COX in schizophrenics show altered activity.33 This gene was also differentially expressed in a microarray analysis of schizophrenic brain tissue.30 The caudate and putamen of schizophrenics in another postmortem study were found to contain significantly fewer mitochondria than controls, and patients off medication had less mitochondria than those patients on antipsychotics.34 The expression of COX subunit II and mitochondrial rRNA are reduced in post-mortem tissue of schizophrenics.35 Levels of mitochondrial enzymes are also altered in the cortex of schizophrenic patients and are reduced by flupenthixol treatment in rats.36 PCP or methamphetamine treatment of rats decreases COX activity, and this activity is normalized by antipsychotic treatment.37

The finding of Ampd3 as a candidate gene in our animal models may be relevant to antipsychotic response, or related to the production of psychotic symptoms. In animal models the adenosine A2A agonist CGS 21680 has an antipsychotic profile with a low propensity for inducing extrapyramidal sideeffects,38 and others have proposed adenosine agonists as potential treatments for schizophrenia.39 Deckert et al40 have mapped the human adenosine A2A receptor gene to a region on chromosome 22q that includes the susceptibility region around 22q13.1 reported by many groups to be linked to schizophrenia.41 SNAP-25 is a nerve terminal protein that is involved in the assembly of the synaptic vehicle docking complex, the docking of synaptic vesicles and membrane fusion. It acts in concert with vesicleassociated membrane protein (VAMP)/synaptobrevin and syntaxin 1a/1b to effect neurotransmitter release at synapses.42 The coloboma (Cm/ þ ) mutant mouse has SNAP-25 and several other genes deleted, and exhibits spontaneous locomotor activity, similar to the hyperactivity seen with the VH-lesioned F344 rats. The Cm/ þ mouse hyperactivity was corrected when a SNAP-25 transgene was bred into the strain, showing that the hyperactivity was a result of the SNAP-25 deletion.26 A recent study of hippocampal connectivity assayed SNAP-25 and synaptophysin immunoreactivity in post-mortem brains of schizophrenics and controls.27 There were reduced levels of SNAP-25, especially in the terminal fields of the entorhinal cortex, where others have also found deficits in cortical connectivity in patients with schizophrenia.43 Using quantitative Western blotting, others have also found decreased levels of SNAP-25 in the inferior temporal cortex and the prefrontal association cortex,44 brain areas that are smaller in schizophrenic patients.16 The SNAP-25 gene has been provisionally mapped to 20p12-20p11.2,45 and one group has found weak evidence of linkage at 20p11.23 for schizoaffective disorder.46 The genetic tests with the three SNAP-25 polymorphisms produced a nonsignificant result. This is not unexpected in the context of the strategy used to identify the candidate genes. The animal models we have analyzed in the SSH experiments are not models for schizophrenia, but were chosen to exploit conditions that either made the animals vulnerable to the effects of the VH lesion, or treatment with haloperidol. Therefore, some of the candidate genes identified might be related to the phenotype of the rats compared, but not to the genetic etiology of schizophrenia. The nonsignificant result reinforces the need for empirical strategies to identify candidate genes, since genes that may be intuitively compelling as candidates may not be important in the illness. It is possible that the reduction in SNAP-25 levels with haloperidol treatment shown in our q-PCR data indicates that this gene may be more important in antipsychotic drug response than in the etiology of schizophrenia. Other studies of antipsychotic effects

163



164

on gene expression have found that apolipoprotein D expression is altered in response to chronic treatment with clozapine.47 That study differed from ours in several important respects: (i) different animals were examined (mice vs rats); (ii) clozapine rather than haloperidol was used; and (iii) their study selected genes that had altered levels of mRNA expression as a result of drug exposure alone. In our study, genes were selected only if mRNA levels were altered by animal strain and age-related differences as well as haloperidol treatment. The regulatory and adaptor 14-3-3 proteins are highly conserved and are present in evolutionarily distinct organisms, such as Drosophila and humans. It is abundantly expressed in the brain, and forms a dimeric protein complex. To date, seven distinct mammalian isoforms (b, e, g, Z, s, t, z) have been recognized that appear to be functionally redundant.48 These proteins have been shown to play a role in neuronal development, signal transduction, exocytosis, and cell-cycle regulation.49 The 14-3-3 protein can interact with tyrosine kinases, tyrosine hydroxylase, a2-adrenergic receptors, protein kinase C (PKC), and Raf.48 Supportive evidence for the 14-3-3 protein family as being candidates for susceptibility genes for schizophrenia is provided by Toyooka et al,31 who reported an association between the 14-3-3Z-chain protein gene and schizophrenia in a case–control study of 118 schizophrenia subjects and 118 controls. They genotyped the 50 -non-coding region polymorphism, a 7 bp VNTR, 134 bases upstream from the translation initiation site. The two-repeat allele was associated with schizophrenia, particularly the earlyonset cases. The 14-3-3Z gene is located in the chromosomal region 22q12.1–q13.1,50 which is within one of the susceptibility regions linked to schizophrenia. The first evidence for a susceptibility gene for schizophrenia located on 22q12 was presented by Pulver et al,51 and Coon et al.52 Gill et al and the Schizophrenia Collaborative Linkage Group53 provided additional support for the same area, and since then the 22q12–13 area has been confirmed as a promising region for the location of a possible gene related to schizophrenia by several groups.41 Other investigations, however, did not succeed in confirming evidence for a schizophrenia-related gene.54–57 Recently, Bell et al systematically screened the 14-33Z gene for polymorphic variants. Among several polymorphisms detected and investigated, they found an association between schizophrenia and an exon 1 SNP, in a case–control study of 220 subjects.22 A diagram of these polymorphisms in the 14-3-3Z gene is shown in Figure 1. It is possible that the association we report is in fact with another gene in the same region, whose role in the disease is unrelated to 14-3-3Z itself. VCFS is associated with psychotic symptoms and schizophrenia,29 and is thought to result from deletions in the 22q11.2 region.58 Typing of other genetic markers close to the polymorphism we studied may help to


determine if other markers in the VCFS or 14-3-3 regions are more or less closely linked with schizophrenia, and is currently underway. The gene 14-3-3Z has many regulatory functions and it interacts with a large number of other molecules in the brain and other tissues. However, because of the diverse impact of the gene, changes in expression levels could conceivably result in some of the morphological abnormalities seen in the cortex of schizophrenia patients. We have not examined the promoter region of 14-3-3Z, and it is possible that the VNTR we typed is in linkage disequilibrium with a variant in the promoter that affects expression. Bell et al22 reported an SNP (408T/G) in the putative promoter region of 14-3-3Z, 50 to the coding sequence, that had a marginal association with schizophrenia in their case–control study. Our findings show a significant association between the 14-3-3Z gene and schizophrenia in our sample of families, and confirms the earlier case– control association studies and microarray expression study. Our study used differential expression in rat models to select the candidate genes for genetic analysis. We plan to continue the analysis of candidate genes using microarray technology in other rat models of schizophrenia, both lesion and pharmacological models. The integration of our new data with the findings reported here may allow the identification of gene expression changes more specific to the phenotype of these animals, and possibly more proximal to the etiology of schizophrenia.

Acknowledgements We acknowledge the support of the Canadian Institutes for Health Research, the National Institute for Mental Health, NARSAD, the Ontario Mental Health Foundation, the Canadian Psychiatric Research Foundation, and the Ontario Ministry of Health in funding this research. Dr Van Tol is supported by the Canadian Research Chair Program. Thanks are due to Drs Barbara K Lipska and Daniel R Weinberger at NIMH for their helpful advice during this project. We also thank Tascha Cate, Jane Dalton, Greg Wong, Lisa Lee, Helena Madeiros, Celia Carvalho, Tersesa Shandrel, Camille Della Torre, Maria Soares, and Amy Bauer for their help in recruiting and interviewing clinical subjects.

References 1 Jablensky A. Epidemiology of schizophrenia: the global burden of disease and disability. Eur Arch Psychiatry Clin Neurosci 2000; 250: 274–285. 2 Sartorius N, Jablensky A, Korten A. Early manifestations and first contact incidence of schizophrenia in different cultures: a preliminary report on the inital evaluation phase of the WHO collaborative study on determinants of outcome of severe mental disorders. Psychol Med 1986; 16: 909–928.


165 3 Brzustowicz LM, Hodgkinson KA, Chow EW, Honer WG, Bassett AS. Location of a major susceptibility locus for familial schizophrenia on chromosome 1q21–q22. Science 2000; 288: 678–682. 4 Riley BP, McGuffin P. Linkage and associated studies of schizophrenia. Am J Med Genet 2000; 97: 23–44. 5 Lander E, Kruglyak L. Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 1995; 11: 241–247. 6 Risch N. Linkage strategies for genetically complex traits. II. The power of affected relative pairs. Am J Hum Genet 1990; 46: 229– 241. 7 Risch N. Linkage strategies for genetically complex traits. I. Multilocus models. Am J Hum Genet 1990; 46: 222–228. 8 Lipska BK, Jaskiw GE, Weinberger DR. Postpubertal emergence of hyperresponsiveness to stress and to amphetamine after neonatal excitotoxic damage: a potential animal model of schizophrenia. Neuropsychopharmacology 1993; 9: 67–75. 9 Lipska BK, Swerdlow NR, Geyer MA, Jaskiw GE, Braff DL, Weinberger DR. Neonatal excitotoxic hippocampal damage in rats causes post-pubertal changes in prepulse inhibition of startle and its disruption by apomorphine. Psychopharmacology 1995; 122: 35–43. 10 Lipska BK, Jaskiw GE, Braun AR, Weinberger DR. Profrontal cortical and hippocampal modulation of haloperidol-induced catalepsy and apomorphine-induced stereotypic behaviours in the rat. Biol Psychiatry 1995; 38: 255–262. 11 Swerdlow NR, Lipska BK, Weinberger DR, Braff DL, Jaskiw GE, Geyer MA. Increased sensitivity to the sensorimotor gatingdisruptive effects of apomorphine after lesions of medial prefrontal cortex or ventral hippocampus in rats. Psychopharmacology 1995; 122: 27–34. 12 Chambers RA, Moore J, McEvoy JP, Levin ED. Cognitive effects of neonatal hippocampal lesions in a rat model of schizophrenia. Neuropsychopharmacology 1996; 15: 587–594. 13 Lillrank SM, Lipska BK, Kolachana BS, Weinberger DR. Attenuated extracellular dopamine levels after stress and amphetamine in the nucleus accumbens of rats with neonatal ventral hippocampal damage. J Neural Transm 1999; 106: 183–196. 14 Lipska BK, Weinberger DR. Genetic variation in vulnerability to the behavioural effects of neonatal hippocampal damage in rats. Proc Natl Acad Sci 1995; 92: 8906–8910. 15 Lipska BK, Weinberger DR. To model a psychiatric disorder in animals: schizophrenia as a reality test. Neuropsychopharmacology 2000; 23: 223–239. 16 Harrison PJ. The neuropathology of schizophrenia. A critical review of the data and their interpretation. Brain 1999; 122(Part 4): 593–624. 17 Weinberger D. Neurodevelopmental perspectives on schizophrenia. In: Bloom F, Kupfer D (eds). Psychopharmacology: The Fourth Generation of Progress. Raven Press Ltd: New York, 1995, pp 1171–1183. 18 Diatchenko L et al. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes or libraries. Proc Natl Acad Sci 1996; 93: 6025–6030. 19 DSM-IV TFo. Diagnostic and Statistical Manual of Mental Disorders, 4th edn. American Psychiatric Association: Washington, DC, 1994. 20 Nurnberger Jr JI, Blehar MC, Kaufmann CA, York-Cooler C, Simpson SG, Harkavy-Friedman J et al. Diagnostic interview for genetic studies. Rationale, unique features, and training. NIMH Genetics Initiative. Arch Gen Psychiatry 1994; 51: 849–859; discussion 863-4. 21 Lahiri DK, Nurnberger Jr JI. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res 1991; 19: 5444. 22 Bell R, Munro J, Russ C, Powell JF, Bruinvels A, Kerwin RW et al. Systematic screening of the 14-3-3 eta (eta) chain gene for polymorphic variants and case-control analysis in schizophrenia. Am J Med Genet 2000; 96: 736–743. 23 Barr CL, Feng Y, Wigg K, Bloom S, Roberts W, Malone M et al. Identification of DNA variants in the SNAP-25 gene and linkage study of these polymorphisms and attention-deficit hyperactivity disorder. Mol Psychiatry 2000; 5: 405–409.

24 Spielman RS, Ewens WJ. A sibship test for linkage in the presence of association: the sib transmission/disequilibrium test. Am J Hum Genet 1998; 62: 450–458. 25 Laird NM, Horvath S, Xu X. Implementing a unified approach to family-based tests of association. Genet Epidemiol 2000; 19(Suppl 1): S36–S42. 26 Hess EJ, Collins KA, Wilson MC. Mouse model of hyperkinesis implicates SNAP-25 in behavioral regulation. J Neurosci 1996; 16: 3104–3111. 27 Young CE, Arima K, Xie J, Hu L, Beach TG, Falkai P et al. SNAP-25 deficit and hippocampal connectivity in schizophrenia. Cereb Cortex 1998; 8: 261–268. 28 Pulver AE, Karayiorgou M, Lasseter VK, Wolyniec P, Kasch L, Antonarakis S et al. Follow-up of a report of a potential linkage for schizophrenia on chromosome 22q12-q13.1: Part 2. Am J Med Genet 1994; 54: 44–50. 29 Murphy KC, Jones LA, Owen MJ. High rates of schizophrenia in adults with velo-cardio-facial syndrome. Arch Gen Psychiatry 1999; 56: 940–945. 30 Vawter MP, Barrett T, Cheadle C, Sokolov BP, Wood 3rd WH, Donovan DM et al. Application of cDNA microarrays to examine gene expression differences in schizophrenia. Brain Res Bull 2001; 55: 641–650. 31 Toyooka K, Muratake T, Tanaka T, Igarashi S, Watanabe H, Takeuchi H et al. 14-3-3 protein eta chain gene (YWHAH) polymorphism and its genetic association with schizophrenia. Am J Med Genet 1999; 88: 164–167. 32 Risch N. Searching for genes in complex diseases: lessons from systemic lupus erythematosus. J Clin Invest 2000; 105: 1503–1506. 33 Cavelier L, Jazin EE, Eriksson I, Prince J, Bave U, Oreland L et al. Decreased cytochrome-c oxidase activity and lack of age-related accumulation of mitochondrial DNA deletions in the brains of schizophrenics. Genomics 1995; 29: 217–224. 34 Kung L, Roberts RC. Mitochondrial pathology in human schizophrenic striatum: a postmortem ultrastructural study. Synapse 1999; 31: 67–75. 35 Whatley SA, Curti D, Marchbanks RM. Mitochondrial involvement in schizophrenia and other functional psychoses. Neurochem Res 1996; 21: 995–1004. 36 Whatley SA, Curti D, Das Gupta F, Ferrier IN, Jones S, Taylor C et al. Superoxide, neuroleptics and the ubiquinone and cytochrome b5 reductases in brain and lymphocytes from normals and schizophrenic patients. Mol Psychiatry 1998; 3: 227–237. 37 Prince JA, Yassin MS, Oreland L. Normalization of cytochrome-c oxidase activity in the rat brain by neuroleptics after chronic treatment with PCP or methamphetamine. Neuropharmacology 1997; 36: 1665–1678. 38 Ferre S. Adenosine-dopamine interactions in the ventral striatum Implications for the treatment of schizophrenia. Psychopharmacology (Berl) 1997; 133: 107–120. 39 Dixon DA, Fenix LA, Kim DM, Raffa RB. Indirect modulation of dopamine D2 receptors as potential pharmacotherapy for schizophrenia: I. Adenosine agonists. Ann Pharmacother 1999; 33: 480– 488. 40 Deckert J, Nothen MM, Bryant SP, Schuffenhauer S, Schofield PR, Spurr NK et al. Mapping of the human adenosine A2a receptor gene: relationship to potential schizophrenia loci on chromosome 22q and exclusion from the CATCH 22 region. Hum Genet 1997; 99: 326–328. 41 Schwab SG, Wildenauer DB. Chromosome 22 workshop report. Am J Med Genet 1999; 88: 276–278. 42 Wilson MC, Mehta PP, Hess EJ. SNAP-25, enSNAREd in neurotransmission and regulation of behaviour. Biochem Soc Trans 1996; 24: 670–676. 43 Jakob H, Beckmann H. Gross and histological criteria for developmental disorders in brains of schizophrenics. J R Soc Med 1989; 82: 466–469. 44 Thompson PM, Sower AC, Perrone-Bizzozero NI. Altered levels of the synaptosomal associated protein SNAP-25 in schizophrenia. Biol Psychiatry 1998; 43: 239–243. 45 Maglott DR, Feldblyum TV, Durkin AS, Nierman WC. Radiation hybrid mapping of SNAP, PCSK2, and THBD (human chromosome 20p). Mamm Genome 1996; 7: 400–401.



166 46 Gejman PV. Chromosomes 19 and 20 report. Am J Med Genet 1999; 88: 271. 47 Thomas EA, Danielson PE, Nelson PA, Pribyl TM, Hilbush BS, Hasel KW et al. Clozapine increases apolipoprotein D expression in rodent brain: towards a mechanism for neuroleptic pharmacotherapy. J Neurochem 2001; 76: 789–796. 48 Fu H, Subramanian RR, Masters SC. 14-3-3 proteins: structure function and regulation. Annu Rev Pharmacol Toxicol 2000; 40: 617–647. 49 van Hemert MJ, Steensma HY, van Heusden GP. 14-3-3 proteins: key regulators of cell division, signalling and apoptosis. Bioessays 2001; 23: 936–946. 50 Muratake T, Hayashi S, Ichikawa T, Kumanishi T, Ichimura Y, Kuwano R et al. Structural organization and chromosomal assignment of the human 14-3-3 eta chain gene (YWHAH). Genomics 1996; 36: 63–69. 51 Pulver AE, Karayiorgou M, Wolyniec PS, Lasseter VK, Kasch L, Nestadt G et al. Sequential strategy to identify a susceptibility gene for schizophrenia: report of potential linkage on chromosome 22q12-q13.1: Part 1. Am J Med Genet 1994; 54: 36–43. 52 Coon H, Jensen S, Holik J, Hoff M, Hoff M, Myles-Worsley M et al. Genomic scan for genes predisposing to schizophrenia. Am J Med Genet 1994; 54: 59–71. 53 Gill M, Vallada H, Collier D, Sham P, Holmans P, Murray R et al. A combined analysis of D22S278 marker alleles in affected sib-pairs:


54

55

56

57

58

support for a susceptibility locus for schizophrenia at chromosome 22q12. Schizophrenia Collaborative Linkage Group (Chromosome 22). Am J Med Genet 1996; 67: 40–45. Hovatta I, Lichtermann D, Juvonen H, Suvisaari J, Terwilliger JD, Arajarvi R et al. Linkage analysis of putative schizophrenia gene candidate regions on chromosomes 3p, 5q, 6p, 8p, 20p and 22q in a population-based sampled Finnish family set. Mol Psychiatry 1998; 3: 452–457. Kalsi G, Brynjolfsson J, Butler R, Sherrington R, Curtis D, Sigmundsson T et al. Linkage analysis of chromosome 22q12–13 in a United Kingdom/Icelandic sample of 23 multiplex schizophrenia families. Am J Med Genet 1995; 60: 298–301. Parsian A, Suarez BK, Isenberg K, Hampe CL, Fisher L, Chakraverty S et al. No evidence for a schizophrenia susceptibility gene in the vicinity of IL2RB on chromosome 22. Am J Med Genet 1997; 74: 361–364. Riley B, Mogudi-Carter M, Jenkins T, Williamson R. No evidence for linkage of chromosome 22 markers to schizophrenia in southern African Bantu-speaking families. Am J Med Genet 1996; 67: 515–522. Amati F, Conti E, Novelli A, Bengala M, Diglio MC, Marino B et al. Atypical deletions suggest five 22q11.2 critical regions related to the DiGeorge/velo-cardio-facial syndrome. Eur J Hum Genet 1999; 7: 903–909.