Identification of genomic DNA sequences bound by mutant p53 ...

ã

Oncogene (2000) 19, 4178 ± 4183 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc

SHORT REPORT

Identi®cation of genomic DNA sequences bound by mutant p53 protein (Gly245?Ser) in vivo Hisashi Koga1 and Wolfgang Deppert*,1 1 Heinrich-Pette-Institut fuÈr Experimentelle Virologie und Immunologie an der UniversitaÈt Hamburg, Martinistrasse 52, D-20251 Hamburg, Germany

Mutant p53 proteins were shown to exert complex DNAinteractions in vitro, like binding to MAR-DNA, but so far it is unknown whether such interactions also occur in vivo. Therefore we analysed the binding of mutant (mut) p53 (Gly245?Ser) in Onda 11 glioma cells to cellular DNA in vivo, using p53-speci®c chromatin immunoprecipitation (CHIP) after in vivo cross-linking of mut p53 to genomic DNA with cisplatin. We identi®ed genomic DNA fragments to which mut p53 (Gly245?Ser) could be cross-linked in vivo. Puri®ed recombinant mut p53 (Gly245?Ser) was able to bind speci®cally to such elements in PCR-EMSA in vitro, supporting the idea that this mut p53 protein interacts with genomic DNA in vivo. The genomic DNA fragments identi®ed are vastly dierent in sequence, but display as a common feature a high likelihood to adopt a non B-DNA conformation. Therefore we propose that structural determinants within these DNA elements are important for their interaction with mut p53 (Gly245?Ser) in vivo. Oncogene (2000) 19, 4178 ± 4183. Keywords: mutant p53; CHIP; PCR-EMSA; microinjection; repetitive DNA elements Accumulating evidence supports the concept that at least certain point mutations within the p53 gene do not simply serve to inactivate the tumor suppressor functions of p53, but in addition lead to a `gain of function' phenotype for the resulting mutant p53 (mut p53) protein (Deppert, 1996; Levine et al., 1995; Roemer, 1999). Despite intensive eorts, the molecular basis for the oncogenic properties of mut p53 is still unknown. We recently suggested that mut p53 speci®cally interacts with higher order regulatory DNA elements involved in maintaining genomic organization, and in controlling transcription and replication within chromatin domains. These elements, termed MAR (nuclear matrix attachment region) or SAR (nuclear scaold attachment region) DNA elements are characterized by a high content of repetitive DNA elements and their ability to adopt a non-B DNA conformation under superhelical stress. So far, the interaction of mut p53 with MAR DNA elements (MARs) has only been deduced from the ability of mut p53 to bind to a variety of such elements in vitro (Muller et al., 1996; Will et al., 1998a).

*Correspondence: W Deppert Received 17 January 2000; revised 17 April 2000; accepted 15 June 2000

Although the MAR elements so far analysed for in vitro binding by mut p53 are characterized by a high AT-content, AT-richness as such is not sucient for mut p53 binding (Weissker et al., 1992; Will et al., 1998a). Furthermore, recent evidence suggested that the ability of sequence elements within MARs promoting the formation of a non-B DNA conformation is a critical feature for the recognition of MARs by mut p53 (Will et al., 1998b). MARs so far are only operationally de®ned. They are composed of rather heterogeneous sequence elements, and form a variety of dierent classes with seemingly very little sequence homologies, but similar functional properties (Bode et al., 1995, 1996; Boulikas, 1995; Hart and Laemmli, 1998). To ®nd out, whether mut p53 binds to cellular DNA in vivo, and whether it preferentially interacts with any of the known classes of MARs, we identi®ed genomic DNA sequences bound by mut p53 in vivo after cross-linking mut p53 to genomic DNA within living cells. An outline of the strategy applied is shown in Figure 1a. To ensure that only DNA directly in contact with p53 would be cross-linked to mut p53, we used cisplatin as a cross-linker, as cisplatin is known to form DNADNA, and DNA-protein cross-links, but no proteinprotein cross-links (Lemaire et al., 1991). After crosslinking, the cells were lysed with detergent and treated with 2 M NaCl to remove chromatin proteins not cross-linked to DNA. The residual cellular structures were harvested, and the DNA fragmented to appropriate size (*400 bp) by sonication. Genomic DNA fragments cross-linked to mut p53 were selected by p53-speci®c immunoprecipitation, using monoclonal antibody PAb421. Then the DNA was digested with Sau3A and the cross-link was reversed (Samuel et al., 1998). After linker ligation and ampli®cation by linker-speci®c PCR, the DNA fragments were cloned into plasmid pCRII, and then screened for mut p53 speci®c binding by PCR-EMSA (for details see legend to Figure 1). As cell line for in vivo cross-linking of mut p53 we chose the human tumor-derived glioma cell line Onda 11 (Koga et al., 1996; Zhang et al., 1996), which expresses a nuclear mut p53 with the amino acid exchange Gly245?Ser. Gly245 is located within the L3 loop of the p53 DNA binding domain, which provides major and minor groove contacts with the p53 consensus-DNA element (Cho et al., 1994). Mutations in Gly245 therefore abolish the sequencespeci®c DNA binding properties of wild-type p53. Gly245 also is one of the mutational hotspot residues (6% of all p53 mutations; Friend, 1994; Beroud and Soussi, 1998).

Genomic DNA sequences bound by mutant p53 in vivo H Koga and W Deppert

4179

Figure 1 (a) Outline of the chromatin immunoprecipitation (CHIP) assay; (b) co-localization of cross-linked mut p53 (Ser245) to genomic DNA; (c) purity of baculovirus produced mut p53 (Ser245) protein. (a) Onda 11 cells (for a detailed description of this cell line see (Koga et al., 1996; Zhang et al., 1996)) were cultured in DMEM plus 10% FCS to 80% con¯uence. Then the medium was replaced with fresh medium containing 1 mM cisplatin and cultured for further 2 h. Cisplatin-treated cells were washed with KM buer (pH 6.8; 10 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 5 mM dithiothreitol, 10% glycerol, 10 mM morpholinepropanesulfonic acid [MOPS]) and lysed for 30 min on ice in KM buer containing 1% NonidetP-40 (NP-40) and proteinase inhibitors (5 mg/ml leupeptin, 1 mg/ml pepstatin, 2 mM PMSF, 1% Trasylol). Nuclear structures still attached to the substratum were incubated with KM buer adjusted to 2 M NaCl for 60 min on ice. Finally, the residual cell structures were harvested, then resuspended in 1 ml of re-suspension buer (pH 8.0; 10 mM Tris-HCl, 1 mM EDTA) containing the proteinase inhibitors described above. To obtain the appropriate size range of chromatin fragments (*400 bp), the samples were sonicated twice for 15 s with 1 min interval in an iceethanol bath. Debris were eliminated by centrifugation for 10 min at 40 000 r.p.m. at 48C. The supernatant was adjusted to RIPA buer (pH 8.0; 10 mM Tris-HCl 150 mM NaCl, 1.0% NP-40, 0.1% sodium deoxycholate, 0.1% SDS, and the proteinase inhibitors described above), and incubated for 1 h at 48C with 50% (v/v) protein A-Sepharose as a preclearing step. After centrifugation at 10 000 r.p.m. for 1 min, mouse monoclonal antibody PAb421 (®nal concentration 1 mg/ml) was added, followed by incubation on a rocking platform for 30 min at 48C. Immune-complexes were recovered by adding 50% (v/v) protein A-Sepharose and further incubation with rocking for 3 h at 48C. Immune-complexes were pelleted by centrifugation and the pellets were washed ®ve times with RIPA buer. The pellets were resuspended in 100 ml buer containing the restriction endonuclease SAU3AI (12 U), and incubated for 30 min at 378C. After SAU3AI-digestion, the pellets were washed three times with RIPA buer. 1/10 of the sample was analysed by Western blotting for immunoprecipitated p53 to con®rm p53-speci®city of the CHIP analysis, the remainder was treated with thiourea to reverse the cross-link (Samuel et al., 1998). Then the DNA was extracted with phenol-chloroform and precipitated with ethanol. The PCR-linker was prepared as described in Orlando and Paro (Orlando et al., 1997), and ligated to the immunoprecipitated DNA. The ligated DNA fragments were used as template in PCR using Taq DNA polymerase (QIAGEN). The primer used for PCR was a 20-mer of the sequence 5'-AGAAGCTTGAATTCGAGCAG-3' and ampli®cation was carried out for 35 cycles (948C for 30 s, 558C for 30 s, and 728C for 90 s). After exclusion of the primer and concentration of the samples by Microcon 100 centrifugation, the PCR products were directly cloned using the TA cloning system (Invitrogen) according to the supplied protocol. (b) Cisplatin cross-linked Onda 11 cells were lysed and treated with 2 M NaCl as described above, and then ®xed and stained with the p53 antibody PAb421 (green ¯uorescence) and DAPI (blue ¯uorescence). Note that p53 was only observed on chromatin ®bers. For clarity, only a single nuclear structure is shown, but co-localization of mut p53 (Ser245) was observed in virtually 100% of the prepared structures. (c) Sf9 cells were infected with mut p53 (Ser245) expressing recombinant baculovirus AcNPV-S245. Seventy-two hours after infection, cells were collected and mut p53 (Ser245) protein was extracted and puri®ed as described in Kim et al. (1997). The purity of the protein was more than 80% as con®rmed by SDS-polyacrylamide gel

Figure 1b shows the co-localization of a fraction of mut p53 (Ser245) with genomic DNA in Onda 11 cells after in vivo cross-linking with cisplatin and extraction of the non cross-linked chromatin proteins. CHIP analysis for the p53 subfraction, performed as outlined above, yielded mut p53 (Ser245) bound to genomic DNA fragments. The fragments were cloned as described above, and more than 70 DNA clones were selected for further analysis of their ability to act as binding substrates for mut p53 (Ser245) in EMSA. Mutant p53 protein (Ser245) was puri®ed from recombinant baculovirus infected cells. The purity of this protein is shown in Figure 1c. To analyse DNA binding of a large number of DNA samples, we produced isotope-labeled DNA fragments by PCR. We examined a total of 71 clones by PCREMSA, of which 39 clones showed strong binding to mutant p53, and 15 clones a weak, but de®nitive

binding. The results of this analysis are summarized in Table 1, and typical gel shifts are shown in Figure 2a. Binding of at least 50% of the labeled DNA added to the EMSA reaction was judged as positive (+); lesser, but signi®cant binding was recorded as (+/7) (Table 1). To con®rm the speci®city of this binding, speci®c and non-speci®c competitors were used in competitive EMSA. Binding was termed speci®c, when a 30-fold excess of speci®c competitor DNA was required to compete out the labeled substrate, and when even a 90fold excess of non-speci®c competitor was unable to compete. Such speci®c competition was observed in 43 binding-positive clones, including 36 (+) and 7(+/7) clones. Figure 2b demonstrates typical results of our competitive EMSA. To con®rm the speci®c binding of mut p53 to those DNA fragments by a dierent experimental approach and to mimic the in vivo interaction between the mut Oncogene


4180

Table 1

Homology, sequence character

Accession No. E Value

col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col col

(+) (7) (+) (+) (+) (7) (7)

repeat family; MTA

AE000664

EV 5e-64

repeat family; repeat family; repeat family; (CA)n repeat,

AC005228 AF 146793.1 M28031

EV 3e-48 EV 7e-90 EV e-120

U26252

EV 4e-64

AL008634 S76029

EV 4e-05 EV 6e-78

1±2 1±3 1±6 1±8 1±9 1 ± 11 1 ± 12 1 ± 13 1 ± 16 1 ± 20 1 ± 22 1 ± 23 1 ± 24 1 ± 26 1 ± 28 1 ± 29 6±1 6±4 6±8 6±9 2±1 2±2 2±3 2±4 2±6 2±8 2±9 2 ± 10 2 ± 11 2 ± 12 2 ± 14 2 ± 16 2 ± 17 2 ± 18 6 ± 12 6 ± 13 6 ± 14 6 ± 16 6 ± 17 6 ± 19 3±1 3±3 3 ± 10 3 ± 13 3 ± 17 3 ± 23 3 ± 27 3 ± 28 3 ± 30 4±2 4±3 4±6 4±8 4 ± 11 4 ± 12 4 ± 15 4 ± 18 4 ± 30 5±4 5 ± 10 5 ± 11 5 ± 17 1 ± 31 1 ± 32 1 ± 33 1 ± 34 1 ± 35 1 ± 36 1 ± 45 1 ± 48 1 ± 49

(+) (+) (+) (+) (+/7) (+) (+) (7) (7) (7) (7) (7) (+) (+) (+/7) (7) (7) (+/7) (7) (7) (+) (+) (+) (+) (+) (7) (7) (+/7) (+/7) (+) (7) (7) (+) (7) (+/7) (+) (+) (+/7) (+/7) (+) (+) (+) (+) (+/7) (+) (+/7) (+) (+) (+) (+/7) (+/7) (7) (+) (7) (+/7) (+) (+) (7) (+) (+) (+/7) (+) (+) (+) (+) (+) (+) (+/7) (+) (+) (+)

(+) (+) (+) (+) (+) (+) (+)

X30 X30 X30 X30 X30 X30 X30

222 bp 475 bp 363 bp 168 bp 252 bp 196 bp 95 bp

Alu IAP a satellite n=28

ND (+) X30

178 bp (7) 198 bp (+) repeat family; g satellite

(+) (+) (+) (+) (+)

118 161 156 223 244

X30 X30 X30 X30 X30

bp bp bp bp bp

(7) (+) ctctctctctgtctctctccctctct (+) repeat family; g satellite (7) (AAAG)n repeat, A; 1 ± 7 (7)

p53CON (%) TGCCT %AT 90 (7) (7) 75 (7) 70 80

(7) (7) (7) (7) (7) (7) (7)

44.9 62.7 47.5 53.4 61.0 47.5 41.1

(7) 65

(7) (7)

50.0 65.3

(7) (7) 65 (7) 70

(7) X1 (7) (7) (7)

57.4 45.8 64.4 56.8 50.0

(+) X30

196 bp (+) BAC B6L 1C6 misc. feature

AC002315

EV 7e-32

70

(7)

43.0

(+) X30

145 bp (+) repeat family; Alu-Sc

U14571

EV 4e-51

(7)

(7)

48.3

(+) (+) (+) (+)

X30 X30 X30 X30

156 306 162 141

bp bp bp bp

(7) (+) repeat family; g satellite (7) (CA)n repeat, n=12 (+) repeat family; g satellite

U26251

EV 3e-75

M17407

EV 4e-57

(7) 65 (7) (7)

(7) (7) (7) (7)

45.8 62.7 55.1 55.1

(+) (+) (+) (+) (+) (+)

X30 X30 X30 X30 X60 X30

257 143 246 243 120 130

bp bp bp bp bp bp

(+) repeat family; MMB 1 (7) (7) (7) (+) repeat family; Alu (7)

AF100956

EV 1e-58

U63721

EV 2e-61

75 (7) 80 75 (7) (7)

X2 (7) (7) (7) (7) (7)

75.4 47.5 47.5 50.0 45.8 65.3

U52111 AC005228

EV e-118 EV 3e-48

(7) (7) 60

X2 (7) (7)

34.7 47.5 49.2

EV e-120

70

(7)

56.0

80

(7)

50.8

(7) (7) (7)

(7) (7) (7)

45.8 51.1 72.0

(7) (7) X1 X2 X2 (7) X1 (7) (7)

50.0 61.0 35.0 45.8 45.8 68.6 46.6 56.8 54.2

(7) (7) X1

72.0 68.6 62.0

(+) X30 (+) X30 (+) X30

233 bp (+) ALD gene intron 2, repeat (7) 363 bp (+) repeat family; Alu 153 bp (7)

(+) X30

219 bp (+) human PAC 111J24, repeat (7) Z83836

ND

241 bp (7)

(+) X30 (+) X30 ND

120 bp (+) repeat family; Alu 92 bp (7) (CA)n repeat, n=17 155 bp (7)

(+) (+) (+) (+) (+) (+) (+) (+) (+)

126 bp 157 bp 40 bp 163 bp 160 bp 262 bp 178 bp 168 bp 302 bp

X30 X30 X30 X30 X30 X30 X30 X30 X30

(+) X30 (+) X30 (+) X30

ALD; adrenoleukodystrophy

Oncogene

Summary of the sequence data and homology search results

Clone no. Screening Competition Size

(7) (+) (+) (7) (7) (+) (7) (+) (+)

U63721

EV 2e-61

(AG)n repeat, A; 1 ± 6, G; 1 ± 3 repeat family; g satellite CD4 gene intron 1, repeat (7) (CA)n repeat, n=15 (CA)n repeat, n=14 repeat family; AluSx

U26252 L30100

EV 3e-27 EV 3e-14

AC000003

EV 2e-44

repeat family; IAP repeat family; MER1B

AF146793.1 Z82205

EV 7e-90 EV 6e-18

60 (7) (7) 75 75 75 (7) 75 (7)

AF027390 AC000003 U31656

EV 6e-13 EV 2e-44 EV 4e-04

(7) 75 (7)

137 bp (+) 7q telomere misc. feature 262 bp (+) repeat family; AluSx 361 bp (+) repeat family; satellite 3


4181

Figure 2 PCR-EMSA of cloned genomic DNA fragments. (a) DNA binding activities of each clone were analysed by PCR-EMSA. + and 7 indicate the presence or absence of puri®ed mut p53 (Ser245) in the EMSA, respectively. Faster migrating bands indicate free DNA fragments, slower migrating bands indicate mut p53-DNA complexes. (b) Competitive PCR-EMSA using speci®c and non-speci®c competitors. x30, x60, x90 indicate 30-, 60-, and 90-fold molar excess of each competitor. Cloned CHIP-DNA was used as template for a PCR to produce substrates for PCR-EMSA. Ampli®cation was carried out for 30 cycles (948C for 30 s, 558C for 30 s, at 728C 30 s), using EMSA1 (5'-CAGGAAACAGCTATGAC-3') and EMSA2 (5'-GTTTTCCCAGTCACGA-3') primers. Both primers were designed from the vector sequence adjacent to the inserted CHIP-DNA fragments. For isotope labeling, 10 mM g-32PATP was added to each reaction. Binding reaction mixtures with or without p53 protein were pre-incubated for 20 min with 2 mg of poly dI:dC (Pharmacia Biotech) in 10 mM HEPES (pH 7.8) with 50 mM KCl, 1 mM EDTA, 5 mM MgCl2 and 10% glycerol at room temperature (RT). Unlabeled competitor DNAs (speci®c and non-speci®c (273 bp derived from the vector sequence) DNA sequences) were also added to the pre-incubation mix and binding was allowed for another 20 min at RT. Reaction products were analysed by electrophoresis in 4% native polyacrylamide gels using 40 mM EDTA, 37 mM sodium acetate (pH 7.8), as

p53 protein and cloned CHIP-DNA fragments in Onda 11 cells, we microinjected plasmid DNA containing six dierent binding positive CHIP-DNA fragments into the cytoplasm of Onda 11 cells. The microinjected cells then were examined by ¯uorescence microscopy 3 and 7 h after injection. Seven hours after injection, a cytoplasmic p53 staining was observed that could not be detected at 3 h after staining (Figure 3). Concomitantly with the appearance of the cytoplasmic p53 staining, a reduction of nuclear p53 staining was observed. Injection of control plasmid DNA into these cells did not lead to a redistribution of the mut p53. These data suggest that, by binding to the microinjected cloned CHIP-DNA fragments in the cytoplasm, newly synthesized mut p53 was trapped and therefore was unable to enter the nucleus. Co-injection of BSA to identify microinjected cells caused a perinuclear aggregation. However, this aggregation was also observed in cells injected with control DNA, and in cells injected with BSA alone, and therefore was not caused by the presence of cloned CHIP-DNA (data not shown). We next asked whether binding of the cloned CHIPDNA fragment is speci®c for mut p53 (Ser245), or also observed with other mut p53 proteins, and tested binding to the hot spot mutant p53 Arg273?His. This mut p53 was selected, because it still exhibits a `wildtype' conformation, has retained some properties of wild-type p53 (DudenhoÈer et al., 1999), and because its expression in tumors does not correlate with bad

prognosis (Hernandez-Boussard et al., 1999). Interestingly, we were neither able to detect binding of puri®ed mut p53 (His273) to CHIP-DNA fragments isolated from Onda II cells in PCR-EMSA, nor were we able to block nuclear accumulation of endogenous mut p53 (His273) by microinjecting plasmids containing these fragments into U251 glioblastoma cells expressing mut p53 (His273) (data not shown). The ®ndings suggest that dierent mut p53 proteins exert dierent biological and biochemical properties. However, a detailed study is required to substantiate this suggestion. A total of 46 clones consisting of 39 (+) and 7 (+/ 7) clones were sequenced and their homology to known sequences analysed by using the BLAST (basic local alignment search tool) network service at NCBI. We ®rst checked for the presence of sequences related to the p53 consensus binding site, consisting of two copies of the sequence 5'-PuPuPuC(A/T)(A/T)GpyPyPy-3', separated by 0 ± 13 bp (el-Deiry et al., 1992). Four clones contained sequences with a conservation of this site of more than 80%, four clones had two copies of a TGCCT repeat (Kern et al., 1991). However, all other clones did not show any homology to the p53 consensus (Table 1). A tblastn search of the non-redundant nucleotide database revealed that some clones displayed a high similarity to known sequences; the accession numbers and smallest sum probabilities (E Values) are shown in Table 1. Most of the sequences had a high similarity to noncoding repetitive DNA elements. Seven clones had Oncogene


4182

Figure 3 Cytoplasmic retention of endogenous mutant p53 by cytoplasmic microinjection of cloned CHIP-DNA fragments. For cytoplasmic injection, Onda 11 cells were plated onto Cellocate support (Eppendorf) 48 h prior to injection. Plasmid DNA was adjusted to 0.01 mg/ml in phosphate-buered saline (PBS) and then microinjected, along with a marker (FITC-conjugated BSA; ®nal concentration 1 mg/ml, green ¯uorescence), into the cytoplasm of the cells using the Eppendorf Micromanipulator 5170. Then the cells were incubated for 3 or 7 h at 378C. After two washes with PBS, the injected cells were ®xed with 100% methanol for 30 min at RT. To minimize unspeci®c binding, the samples were saturated with 1% normal goat serum (DAKO) prior to antibody incubation. Mouse monoclonal p53 antibody PAb421 and goat anti-mouse IgG conjugated with Texas-Red (red ¯uorescence) were used as ®rst and second antibodies, respectively. After staining with the second antibody, cells were incubated with 4',6-diamidino-2-phenylindole (DAPI; blue ¯uorescence) for nuclear staining. Incubation with antibodies was for 60 min (®rst antibody) and 40 min (second antibody), followed by three washes with PBS for 5 min. Per experiment, approximately 100 cells were microinjected and processed. For clarity, only a single microinjected cell is shown in each panel, but all microinjected cells showed the same results. Photographs were taken with a Leica DMRA ¯uorescence microscope (Leica) equipped with a CCD camera SPOT (DIAGNOSTIC instruments inc.). Note that the cytoplasmic staining of the p53 protein and the reduction of nuclear p53 staining are observed only in cells which had been injected with plasmids containing cloned CHIPDNA fragments, but not in cells which had been injected with control plasmid

similarity to satellite sequences (gamma: 5, alphoid: 1, satellite III sequence: 1), and seven additional clones similarity to Alu sequences. Other repetitive sequences found by the homology search were MTP, IAP, MMB, and 1MER1B. Five clones contained 12 to 28 CA dinucleotide repeats, although we could not establish a homology to known (CA)n repeats. In summary, the Oncogene

CHIP-DNA fragments identi®ed as possible in vivo targets for mutant p53 in Onda 11 cells did not show any common sequence homology, rendering it extremely unlikely that their speci®c binding by mut p53 (Ser245) is mediated by a common sequence element. In line with our previous analyses of the binding of mut p53 to MARs (Weissker et al., 1992; Muller et al., 1996; Will et al., 1998b), we therefore propose that structural determinants, speci®cally the ability of these DNAs to adopt a certain non-B-DNA conformation(s) determines their binding to mut p53. Among the sequences identi®ed, seven clones showed similarities to three types of satellite DNA sequences (a satellite, g satellite, satellite III). Satellite sequences frequently cluster at centromeres and play an important role in the correct assembly of kinetochores, required for an accurate segregation of chromosomes during mitosis (Murphy and Karpen, 1998). In this respect, it is of interest that a `gain of function' for mut p53 has been suggested by contributing to the loss of spindle checkpoint controls (Gualberto et al., 1998). Our ®nding that mut p53 in Onda 11 cells in vivo binds to satellite sequences may relate to this observation, as it suggests that mut p53 interacts with centromere DNA. We also found that seven clones had similarity to Alu sequences. Alu family repeats are widely dispersed throughout the human genome, and it has been reported that wt p53 represses transcription of Alu genes by RNA polymerase III both in vitro and in transfected cells (Cairns and White, 1998; Chesnokov et al., 1996). Whether our ®nding that mut p53 in Onda 11 cells interacts with Alu sequences relates to this observation remains to be established. We obtained ®ve independent clones containing (CA)n repeats. This dinucleotide repeat is widespread throughout the genome and conserved in many loci, and is used as a microsatellite polymorphic marker. The biological role of (CA)n repeats is not yet understood in detail, although some functional aspects have emerged. An important feature of (CA)n repeats is their eect on DNA conformation. (CA)n repeats have the potential to induce a structural transition from a right-handed B-DNA conformation to a lefthanded Z-DNA structure (Tripathi and Brahmachari, 1991). Such a transition is thought to be involved in gene regulation (Floros et al., 1995; Shimajiri et al., 1999). In line with this assumption, Shimajiri et al. (1999) reported that the promoter activity of the matrix metalloproteinase 9 (MMP-9) gene is dependent on the number of (CA)n repeats located in the promoter region. Floros et al. (1995) described that the number of (CA)n repeats located in intron 4 of the surfactant protein B (SP-B) gene is related to the incidence of the respiratory distress syndrome (RDS) in a large number of clinical samples. The reports thus suggest that (CA)n repeats may be important determinants in modulating the expression of the corresponding genes. Therefore, the interaction of mut p53 with CHIP-DNA fragments containing (CA)n repeats might relate to the ®ndings that mut p53 acts as a transactivator of various cancer-associated genes in tumor progression (reviewed in Deppert, 1996). The presumed interaction of mut p53 with (CA)n repeats also corresponds to our previous ®ndings suggesting that mut p53 interacts with MAR elements via DNA


elements promoting the formation of non-B-DNA structures (Will et al., 1998b). However, as we so far did not ®nd any known promoter sequence adjacent to (CA)n repeats in our CHIP-DNA fragments, the functional relevance of the interaction of mut p53 with (CA)n repeats in Onda 11 cells awaits further clari®cation. The DNA sequence information obtained from the analysis of a limited number of genomic DNA fragments serving as target sequences for mut p53 (Ser245) in Onda 11 cells suggests that the interaction of mut p53 with non-coding repetitive DNA sequences present within some chromatin-structures (centromeres, telomeres), and around coding regions could play an important role in several genetic processes such as the control of chromatin organization and gene expression. Although it is tempting to speculate that such interactions form the molecular basis for the `gain of function' phenotype of at least some mut p53 proteins, neither the exact role and mechanism by which these sequences function, nor the eects of the interaction of mut p53 with these sequences is understood. Nevertheless, the identi®cation of genomic DNA fragments

targeted by mut p53 in vivo provides a basis for further functional analyses.

4183

Acknowledgments We thank Dr J Davie (University of Manitoba) for providing his protocol for cisplatin cross linking; Dr T Kumanishi (Brain Research Institute, Niigata University) and Dr K Onda (Dept. of Neurosurgery, Niigata University) for providing glioma cell line Onda 11; Dr E Kim for helpful discussion; Dr M Kulesz-Martin (Mol. Pharmacology & Cancer Therapeutics, Roswell Park Cancer Institute) for providing plasmid pFASTBAC containing the cDNA for the mut p53 (Ser245), Ms G Warnecke and Ms M Kurth for their technical assistance, and Ms M Hintz-Malchow for secretarial help. This study was supported by grant De 212/19-3 from the Deutsche Forschungsgemeinschaft, EU contract No. QLG1-199900273, Merck KgaA, Darmstadt, Germany, and the Fonds der Chemischen Industrie. H Koga was supported by a fellowship from the Alexander von Humboldt Foundation. The Heinrich-Pette-Institut is ®nancially supported by the Bundesministerium fuÈ r Gesundheit and the Freie und Hansestadt Hamburg.

References Beroud C and Soussi T. (1998). Nucl. Acids Res., 16, 200 ± 204. Bode J, Schlake T, RõÂ os-RamõÂ rez M, Mielke C, Stengert M, Kay V and Klehr-Wirth D. (1995). Int. Rev. Cytol., 162A, 389 ± 454. Bode J, Stengert-Iber M, Kay V, Schlake T and DietzPfeilstetter A. (1996). Crit. Rev. Euk. Gene Express., 6, 115 ± 138. Boulikas T. (1995). Int. Rev. Cytol., 162A, 279 ± 388. Cairns CA and White RJ. (1998). EMBO J., 17, 3112 ± 3123. Chesnokov I, Chu WM, Botchan MR and Schmid CW. (1996). Mol. Cell. Biol., 16, 7084 ± 7088. Cho Y, Gorina S, Jerey PD and Pavletich NP. (1994). Science, 265, 346 ± 355. Deppert W. (1996). J. Cell. Biochem., 62, 172 ± 180. DudenhoÈer C, Kurth M, Janus F, Deppert W and WiesmuÈller L. (1999). Oncogene, 18, 5773 ± 5784. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW and Vogelstein B. (1992). Nat. Genet., 1, 45 ± 49. Floros J, Veletza SV, Kotikalapudi P, Krizkova L, Karinch AM, Friedman C, Buchter S and Marks K. (1995). Biochem. J., 305, 583 ± 590. Friend S. (1994). Science, 265, 334 ± 335. Gualberto A, Aldape K, Kozakiewicz K and Tlsty TD. (1998). Proc. Natl. Acad. Sci. USA, 95, 5166 ± 5171. Hart CM and Laemmli UK. (1998). Curr. Opin. Genet. Dev., 8, 519 ± 525. Hernandez-Boussard T, Montesano R and Hainaut P. (1999). IARC Sci. Publ., 146, 43 ± 53. Kern SE, Kinzler KW, Bruskin A, Jarosz D, Friedman P, Prives C and Vogelstein B. (1991). Science, 252, 1708 ± 1711.

Kim E, Albrechtsen N and Deppert W. (1997). Oncogene, 15, 857 ± 869. Koga H, Zhang S, Washiyama K, Ichikawa T, Onda K and Kumanishi T. (1996). Noshuyo Byori, 13, 1 ± 10. Lemaire MA, Schwartz A, Rahmouni AR and Leng M. (1991). Proc. Natl. Acad. Sci. USA, 88, 1982 ± 1985. Levine AJ, Wu MC, Chang A, Silver A, Attiyeh EF, Lin J and Epstein CB. (1995). Ann. NY Acad. Sci., 768, 111 ± 128. Muller BF, Paulsen D and Deppert W. (1996). Oncogene, 12, 1941 ± 1952. Murphy TD and Karpen GH. (1998). Cell, 93, 317 ± 320. Orlando V, Strutt H and Paro R. (1997). Methods, 11, 205 ± 214. Roemer K. (1999). Biol. Chem., 380, 879 ± 887. Samuel SK, Spencer VA, Bajno L, Sun JM, Holth LT, Oesterreich S and Davie JR. (1998). Cancer Res., 58, 3004 ± 3008. Shimajiri S, Arima N, Tanimoto A, Murata Y, Hamada T, Wang KY and Sasaguri Y. (1999). FEBS Lett., 455, 70 ± 74. Tripathi J and Brahmachari SK. (1991). J. Biomol. Struct. Dyn., 9, 387 ± 397. Weissker SN, Muller BF, Homfeld A and Deppert W. (1992). Oncogene, 7, 1921 ± 1932. Will K, Warnecke G, Albrechtsen N, Boulikas T and Deppert W. (1998a). J. Cell. Biochem., 69, 260 ± 270. Will K, Warnecke G, Wiesmuller L and Deppert W. (1998b). Proc. Natl. Acad. Sci. USA, 95, 13681 ± 13686. Zhang S, Endo S, Koga H, Ichikawa T, Feng X, Onda K, Washiyama K and Kumanishi T. (1996). Jpn. J. Cancer Res., 87, 900 ± 907.

Oncogene