Identification of Motifs That Are Conserved in 12 ... - Semantic Scholar

Copyright Ó 2008 by the Genetics Society of America DOI: 10.1534/genetics.107.080440

Identification of Motifs That Are Conserved in 12 Drosophila Species and Regulate Midline Glia vs. Neuron Expression Patricia Estes,1 Eric Fulkerson and Yi Zhang Department of Genetics, North Carolina State University, Raleigh, North Carolina 27695-7614 Manuscript received August 16, 2007 Accepted for publication December 15, 2007 ABSTRACT Functional complexity of the central nervous system (CNS) is reflected by the large number and diversity of genes expressed in its many different cell types. Understanding the control of gene expression within cells of the CNS will help reveal how various neurons and glia develop and function. Midline cells of Drosophila differentiate into glial cells and several types of neurons and also serve as a signaling center for surrounding tissues. Here, we examine regulation of the midline gene, wrapper, required for both neuron–glia interactions and viability of midline glia. We identify a region upstream of wrapper required for midline expression that is highly conserved (87%) between 12 Drosophila species. Site-directed mutagenesis identifies four motifs necessary for midline glial expression: (1) a Single-minded/Tango binding site, (2) a motif resembling a pointed binding site, (3) a motif resembling a Sox binding site, and (4) a novel motif. An additional highly conserved 27 bp are required to restrict expression to midline glia and exclude it from midline neurons. These results suggest short, highly conserved genomic sequences flanking Drosophila midline genes are indicative of functional regulatory regions and that small changes within these sequences can alter the expression pattern of a gene.

I

N metazoan organisms, the central nervous system (CNS) is a complicated communication system characterized by diverse cells that make many intricate connections with a variety of cell types. To generate cellular diversity within the CNS, genes that control the specification, development, and function of cells must be tightly regulated in both space and time. Understanding the ‘‘regulatory code,’’ or how regulatory sequences flanking genes appropriately direct their expression, remains a major challenge to biologists within many fields, including molecular, cellular, developmental, evolutionary, and systems biology, as well as bioinformatics. Regulatory regions of genes contain binding sites for transcription factors that activate or repress transcription. Such binding sites consist of DNA sequence motifs of between 4 and 20 bp, and oftentimes a particular motif is repeated several times within the regulatory regions of genes. New targets for certain transcription factors have been identified by searching the genome for shared motifs, particularly repeated motifs, in close proximity to one another (Rajewsky et al. 2002; Freeman et al. 2003) and to other binding sites for transcription factors in the same developmental pathway (Schroeder et al. 2004). Many false positives are identified in these studies, meaning that any putative regulatory region

1 Corresponding author: Department of Genetics, Box 7614, Gardner Hall, 100 Derieux Pl., North Carolina State University, Raleigh, NC 276957614. E-mail: [email protected]

Genetics 178: 787–799 (February 2008)

identified in silico must be confirmed in vivo. However, the success rate can be improved by including evolutionary comparisons of putative regulatory regions between species (Berman et al. 2004; Sinha et al. 2004; Wenick and Hobert 2004; Rebeiz et al. 2005; Pennacchio et al. 2006). Here, we combine the power of evolutionary comparisons of the currently available Drosophila genomes with fly transgenesis to identify regulatory sequences and motifs required for gene expression within the CNS. To study CNS gene regulation, we focus on midline cells that play a central role in the formation of the CNS in both vertebrate and invertebrate species. In Drosophila, these cells provide signaling information to axons during their growth and develop into both neurons and glia themselves (Thomas et al. 1988; Nambu et al. 1990; Nambu et al. 1991; Bossing and Technau 1994; Jacobs 2000; Dickson 2002; Garbe and Bashaw 2004). Over 300 genes have been identified that are expressed in the various midline cell types sometime during fly embryogenesis, making the midline a useful model for understanding transcriptional control of gene regulation within a CNS cell type (Nambu et al. 1991; Jacobs 2000; Kearny et al. 2004; Wheeler et al. 2006). Genetic experiments indicate that activation of the master control gene, single-minded (sim), leads to CNS midline cell development. Such experiments show that mutations in sim eliminate midline cells (Thomas et al. 1988; Nambu et al. 1990), and ectopic activation of sim in cells of the neuroectoderm can transform cells destined

788

P. Estes, E. Fulkerson and Y. Zhang

to other cell fates into midline cells (Nambu et al. 1991). To regulate transcription, the basic helix-loop-helix (bHLH)-PAS transcription factor, Sim, must first form heterodimers with its partner, Tango (Tgo), another bHLH-PAS protein, before binding DNA sequences, called CNS midline elements (CMEs) (ACGTG) to activate transcription (Ohshiro and Saigo 1997; Sonnenfeld et al. 1997). Tgo is ubiquitously expressed in Drosophila embryos, but only located in the nucleus of cells that also express one of its partners, such as sim in midline cells (Ward et al. 1998). The bHLH-PAS proteins, Sim and Tgo, are critical for the expression of many midline genes, but the presence of these two proteins alone is insufficient to account for the dynamic expression pattern of most genes in the midline. Moreover, Tgo interacts with another bHLHPAS protein, Trachealess (Trh), to activate a set of genes within the developing respiratory system of the fly, the trachea (Ohshiro and Saigo 1997; Sonnenfeld et al. 1997). The binding site for Trh/Tgo heterodimers appears to be the same as that of Sim/Tgo heterodimers and many genes expressed in midline cells are also expressed in trachea. Additional evidence for shared regulatory properties of midline and tracheal genes comes from multimerizing the CME and fusing it to a reporter gene. Such a reporter is expressed in both midline and tracheal cells of transgenic flies (Ohshiro and Saigo 1997; Sonnenfeld et al. 1997) indicating the importance of this single binding site. However, gene sets exist that are unique to either the midline or trachea and even within midline cells, different gene sets are activated and inactivated at various stages of development. We would like to determine the molecular basis of the unique and shared regulation of various gene sets in midline cells and different midline lineages. In addition to sim and tgo, the transcription factors Dichaete (D), a Sox HMG protein, and Dfr, a POU domain protein, regulate genes expressed in midline glia (Ma et al. 2000; Bergmann et al. 2002). The D protein directly interacts with the PAS domain of Sim and the POU domain of Dfr and all three genes activate expression of slit in midline glia (Ma et al. 2000). Most genes expressed in the midline, including sim, are expressed in additional tissues within the developing fly embryo. In contrast, wrapper is restricted largely to midline glia, with a relatively low level of expression in some chordotonal cells of the embryo (Noordermeer et al. 1998). To understand how wrapper is restricted to midline glia during Drosophila embryogenesis, we are studying its regulation, both the transcription factors that activate it and the regulatory sequences controlling its expression. Because wrapper is largely restricted to midline glia, the sequences controlling its expression are predicted to contain motifs for genes that regulate midline gene expression, unencumbered with motifs for factors expressed in other tissues. Moreover, the regions most likely to contain regulatory control ele-

ments (motifs) are tractable; the size of the genomic regions flanking the wrapper transcription unit, and the first intron, are relatively small. The availability of sequenced genomes for 12 Drosophila species provides a unique opportunity for fly geneticists to study the evolution of genes (FlyBase Blast at http://flybase.net/blast/; Stark et al. 2007). While coding regions of genes are conserved and can be compared between quite divergent species, regulatory regions of genes tend to change more rapidly. Genomic sequence comparisons between these 12 Drosophila species should greatly facilitate the identification of particularly important conserved regulatory motifs. Once identified, these regions can be compared in detail between various species to determine if a gene is regulated differently in different species. Using this approach, we identify conserved sequences upstream of wrapper sufficient to provide midline specific expression of reporter genes in embryos of Drosophila melanogaster. Such wrapper reporter constructs respond to mutations in known regulators of midline cells. The presence of invariant sequences shared by all 12 Drosophila species examined, suggests that any changes within this conserved region might reduce midline expression. To test this, we mutated select nucleotides and demonstrated the importance of four motifs within the conserved region. In contrast to these changes, four other sets of 2- to 3-nucleotide changes within the highly conserved wrapper regulatory region had no deleterious affect on midline expression. In addition to motifs needed for positive regulation in midline glia, we identified a region required to restrict expression to midline glia and prevent expression in a group of midline neurons, including the progeny of the median neuroblast. Taken together with previous studies on transcriptional regulation within midline glia, these results suggest that at least one Sim/Tgo binding site (CME) appears to be critical for expression in midline glia, and at least four additional sites work together with the CME to both positively and negatively regulate expression in midline cells.

MATERIALS AND METHODS Fly lines: The line yw67 was used for wild-type embryos. To facilitate identification of the homozygous mutant embryos, the D ( fsh)87 null allele (Nambu and Nambu 1996) and the dfr vvlM638 allele (Salzberg et al. 1994) were placed over the TM3Ultrabithoraz-lacZ third chromosome balancer and the spi1 allele (Tearle and Nusslein-Volhard 1987) was balanced over the Cyowingless-lacZ second chromosome. Rat a-sim antibody staining (Ward et al. 1998) was used to identify homozygous simH9 mutant embryos. The following fly lines were used for ectopic expression studies: UAS-sim-GFP (Estes et al. 2001), UAS-sspi4a (Schweitzer et al. 1995), and da-GAL4 (Giebel et al. 1997). Germline transformation: P element-mediated germ-line transformation was carried out as previously described (Rubin and Spradling 1982).

Gene Regulation in Midline Glia TABLE 1 Primers used to amplify wrapper upstream sequences WA WB K1 K2 K3 K4 K5 K7 X1 X2 X3 X4 X5 X6

GGC ACT AGT GAG GAG AAG AAC CGC TTC CGG GGC GGT ACC CTT GAG CTG AAG CCA CAG TTG AAA GGT ACC AGA GGG AAA AAC GTT TTT CAA AAA GGT ACC GTG AAT GTG ACT GAT CCG AAA GGT ACC ATG ATG ACG ACT GGG ATG AAA GGT ACC CAA AGC CAC TTA CAC ACA AAA GGT ACC GTA CCC ATG TGG GAG AAT AAA GGT ACC ATA TGC AAC AGC AGC ACG AAA CTC GAG TTG AGC TGA AGC CAC AGT AAA CTC GAG ATT CTC CCA CAT GGG TAC AAA CTC GAG TGT GTG TAA GTG GCT TTG CCC CTC GAG TGC AAG AAC ATT TGC ATG G AAA CTC GAG CGG ATC AGT CAC ATT CAC AAA CTC GAG AAT CGA GAT TCC GTC GCT

Engineered KpnI and XhoI sites used to insert the fragments into pHstinger are indicated in italics.

Immunohistochemistry: Antibody staining of embryos was carried out essentially as described (Patel 1994). The primary antibodies used in this study were mouse monoclonals a-wrapper (1:5), a-engrailed (undiluted) obtained from the Developmental Studies Hybridoma Bank in Iowa, rat a-sim antibody (Ward et al. 1998), rabbit a-b-galactosidase (1:1000 or 1:3000; Cappel), and rabbit a-GFP (1:500; Invitrogen, Carlsbad, CA). All secondary antibodies (a-mouse-488, a-rabbit-Texas red, a-rabbit-488, and a-mouse 568) were used at 1:200. Confocal images were obtained on a Zeiss 410 microscope at the University of North Carolina in Chapel Hill and a Zeiss Pascal microscope at North Carolina State University. Generation and injection of wrapper reporter constructs: Various fragments from the region 59 of the wrapper transcription unit (Figure 2B) were amplified using the polymerase chain reaction with the primers listed below and genomic DNA from yw67 flies. After amplification, the fragments were first inserted into the pSTBlue vector (Novagen, San Diego) and subsequently cassetted into pHstinger (Barolo et al. 2000) using KpnI–XhoI digestion. To generate the wrapper:W con-

789

struct, a 884-bp BglII–KpnI fragment was inserted into BglII– KpnI digested pHstinger. The reporter constructs were then injected into yw67 embryos using P element-mediated transformation. For each construct, at least three fly lines were examined. Primers used to amplify wrapper upstream sequences: The following wrapper genomic fragments (Figure 2B) were amplified using the primers indicated in parentheses and listed in Table 1: W (59WA 39W B), A (59K1 39X5), C (59K4 39X2), D (59K5 39X1), E (59K1 39X3), F (59K4 39X1), G (59K3 39X4), K (59K3 39X6), and L (59K7 39X4). Site-directed mutagenesis: To test the function of sequence motifs within the wrapper regulatory sequences, two or three nucleotides were changed within the wrapper G fragment in the pSTBlue vector, using the QuickChange Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA) and the primers listed in Table 2. Selection of mutagenized sequences was facilitated by the generation of the following restriction enzyme recognition sites after mutagenesis: G1:, NarI; G5, XhoII; G6, PstI; G2, EcoRI; G3, AccI; G7, EcoRI; G8, SmaI; and G4, NheI. Each mutant was subsequently sequenced and then cassetted into the pHstinger vector using KpnI/XhoI digestion for injection into flies.

RESULTS

To facilitate the identification of sequences responsible for wrapper expression in the midline glia of Drosophila, we first examined the genomic region flanking the wrapper transcription unit using Fly BLAST to determine the degree of conservation between the 12 available Drosophila species. The regions most likely to contain regulatory control elements (motifs) of wrapper are tractable; the genomic regions flanking the transcription unit and the first intron are relatively small. The results of this analysis highlighted a region between 492 and 326 upstream of the transcription start site of wrapper that is highly conserved in all Drosophila species examined (melanogaster, simulans, sechelia, yakuba, erecta, ananassae, pseudoobscura, persimilis, willistoni,

TABLE 2 Mutagenesis primers used to generate 2- to 3-nucleotide changes within the wrapper G fragment (Figure 6) G1 G1R G2 G2R G3 G3R G4 G4R G5 G5R G6 G6R G7 G7R G8 G8R

GGATGGGGGCATCATTGTGGCGCCATGACATTTTATCTCGG CCGAGATAAAATGTCATGGCGCCACAATGATGCCCCCATCC CTCGGAATATGCAACAGCAGCGAATTCTCTGAAGCGGAGAGTG CACTCTCCGCTTCAGAGAATTCGCTGCTGTTGCATATTCCGAG CTCTGAAGCGGAGAGTGTAGACGATCAGCGACGGAATCTCG CGAGATTCCGTCGCTGATCGTCTACACTCTCCGCTTCAGAG CCGATGCGTGGCCCATGCTAGCGTTCTTGCACTCGAGG CCTCGAGTGCAAGAACGCTAGCATGGGCCACGCATCGG CATCATTGTGGCACAATGACATTGGATCTCGGAATATGCAACAGC GCTGTTGCATATTCCGAGATCCAATGTCATTGTGCCACAATGATG GACATTTTATCTCGGAATATGCTGCAGCAGCACGTTCTCTGAAG CTTCAGAGAACGTGCTGCTGCAGCATATTCCGAGATAAAATGTC GCAACAGCAGCACGTTCTCTGAATTCGAGAGTGTAATAGATCAGCG CGCTGATCTATTACACTCTCGAATTCAGAGAACGTGCTGCTGTTGC CGATTCTGAATCCGAAAACTACCCGGGCGTGGCCCATGCAAATG CATTTGCATGGGCCACGCCCGGGTAGTTTTCGGATTCAGAATCG

The specific nucleotides changed are underlined. Both the forward and the reverse (R) primers are shown.

790


Figure 1.—A 70-bp genomic region upstream of wrapper is highly conserved among 12 Drosophila species. The genomic regions located between the wrapper transcription unit and the next upstream (CG10955) and downstream (CG13506) genes, as well as the sequences within the first intron of wrapper (see Figure 2A) were compared to available insect sequences using FlyBase Blast (http://flybase.net/blast/). After identifying a conserved region in 12 Drosophila species, the corresponding sequences were aligned using the ClustalW program (http://www.ebi.ac.uk/clustalw/). A region consisting of 70 bp was highly conserved (A) (at least 61/ 70 bp) in all Drosophila species examined, although this region could not be found in other Dipteran or insect species. In D. melanogaster, sechellia, simulans, yakuba, and erecta, the entire 70-bp region is identical. Compared to melanogaster sequences, ananassae had one mismatch, pseudoobscura and persimilis had two base pair differences, willistoni and grimshawi differed by 5 bp, virilis differed by 6, while mojavenis had nine differences. Another conserved 27-bp region (B), located 18 bp downstream from the conserved 70-bp region is identical in D. melanogaster, sechellia, simulans, yakuba, erecta, ananassae, pseudoobscura, and persimilis, while D. virilis has one mismatch, mojavenis and grimshawi differ by 3 bp, and willistoni has 5 bp differences. Invariant nucleotides are indicated with a star. The position of these highly conserved sequences upstream of the D. melanogaster wrapper gene are indicated with the gray line in Figure 2B.

mojavensis, virilis, and grimshawi; http://flybase.net/ blast/), particularly a 70-bp region (Figures 1 and 2). To test if these sequences are responsible for the wrapper expression pattern in embryos, we first amplified this genomic region within a 884-bp fragment (W; Figure 2B), and then fused it to the green fluorescent protein (GFP) reporter gene within the pHstinger vector, which contains a minimal Hsp70 promoter (Barolo et al. 2000). This DNA construct (wrapper W:GFP) was injected into D. melanogaster embryos using P element-mediated transformation (Rubin and Spradling 1982) to generate stable fly lines. Embryos containing this construct express GFP in midline glia (Figure 3, A–I) beginning at stage 12 of embryogenesis and throughout larval stages (not shown). We confirmed that GFP was expressed in midline glia by staining embryos simultaneously with either (1) wrapper and GFP (Figure 3, A–C) or (2) sim and GFP (Figure 3, D–I). Because wrapper protein is found at the surface of midline glial cells, but the GFP produced by pHstinger localizes to the nucleus, wrapper protein encircles the GFP in these cells (Figure 3A). The wrapper W:GFP reporter construct also drives expression

in a few additional cells within the lateral CNS (Figure 3E) and muscles (data not shown), a pattern that differs from the endogenous wrapper expression pattern. This suggests that the W fragment, although sufficient to drive high levels of expression in midline glia, lacks certain sequences that exclude expression in lateral CNS cells. To confirm the midline expression pattern generated by the reporters, all subsequent experiments were performed by staining embryos with both sim and GFP at stage 16 of embryogenesis. These experiments revealed that GFP generated by the wrapper W:GFP reporter gene was indeed expressed in the midline glia, but not in the cells that develop into midline neurons (Figure 3, G–I). Next, to determine the minimal sequences required to provide expression in midline glia, we divided this 884-bp region into several subregions, fused them to GFP within the pHstinger vector and tested their ability to drive midline expression in transgenic embryos. Region E (Figure 3, J–L), extending from sequences 756 to 286, is sufficient to drive high levels of GFP expression in midline glia (Figure 3K). Moreover, a smaller 166-bp

Gene Regulation in Midline Glia

791 Figure 2.—Wrapper genomic region and fragments that provide midline glial expression. (A) The genomic region 2R:18,267,017– 18,270,700 of D. melanogaster is shown schematically and wrapper exons are indicated with boxes and introns with lines. The region indicated with the dotted lines is expanded and shown in B. (B) The fragments tested for the ability to drive expression in midline glia are shown. Fragments W, E, G, and K drove midline expression, while fragments A, C, D, F, and L did not. The positions of the highly conserved sequences shown in Figure 1 are indicated with the gray line upstream of wrapper. The scale is at the bottom and represents base pairs. Whether or not each construct was expressed in midline glia and midline neurons is indicated.

( 492 to 327) G fragment (Figure 3, P–R), and an even smaller 119-bp ( 492 to 374) internal K fragment (Figure 3, S–X), that both include the highly conserved region, are also sufficient to drive GFP expression in midline glia, but the level of expression is reduced compared to that of the E fragment and the intact 884-bp W fragment. None of the other reporter constructs drove GFP expression in the midline (wrapper A, C, D, F, or L; Figure 2B). The K fragment is also expressed in a subset of midline neurons (Figure 3, V–X), including progeny of the median neuroblast (Wheeler et al. 2006), suggesting that the larger W, E, and G fragments contain a silencer, which is absent from the K fragment and normally represses expression in these midline neurons. virilis sequences can drive midline expression of a GFP reporter gene in melanogaster: Next, to determine if the observed conservation at the sequence level between Drosophila species reflects conservation in function, we tested if the corresponding E region from D. virilis could drive GFP reporter expression in the midline glia of D. melanogaster. The E region is also located upstream of wrapper in D. virilis and is 476 bp in length, while it is 462 bp in melanogaster. The entire E region is 58.4% identical in the two species, and the 70-bp highly conserved section differs by only six nucleotides (Figure 1). The midline expression pattern provided by the D. virilis wrapper E:GFP construct (Figure 3, M–O) in D. melanogaster flies is indistinguishable from that of the corresponding D. melanogaster E region (Figure 3, J–L). These results suggest that the location and function of the regulatory sequences of wrapper have been conserved between D. melanogaster and D. virilis. The wrapper reporter genes are sensitive to reductions in midline transcriptional activators: To determine if previously identified midline transcription

factors affect wrapper through these regulatory sequences, we tested the wrapper W:GFP reporter gene in a number of mutant backgrounds. First, we tested the effect of sim mutations on the reporter gene by placing the 884-bp wrapper W:GFP transgene into a simH9 mutant background (Figure 4, D–F), a mutation that eliminates Sim protein expression (Nambu et al. 1990). In this background, GFP expression was abolished in most cells, suggesting that sim expression is required for wrapper transcriptional activation in the midline. A few remaining cells did express GFP and these are likely lateral CNS cells also observed in wild-type embryos containing the wrapper W:GFP reporter (see Figure 3E). Next, we tested the reporter gene in a spitz (spi) mutant background (Figure 4, G–I). Spi is a signaling molecule that plays multiple roles during Drosophila development (for a review, see Shilo 2005). Wrapper protein is normally found on the surface of midline glia where it mediates direct contact with the lateral CNS axons that cross the midline and promotes survival of midline glia (Noordermeer et al. 1998). In wrapper mutant embryos, this intimate interaction cannot occur and additional midline glia die. The amount of spi signaling provided by lateral CNS axons determines how many midline glia survive in each segment (Bergmann et al. 2002). The spi mutation severely disrupted CNS development so that the sim positive cells remained on the ventral surface of the embryo (Figure 4, G–I). Only a few of the sim positive cells also express GFP driven by wrapper regulatory sequences, suggesting these are the remaining midline glia. The cells expressing sim, but not GFP, are likely midline neurons (see Figure 4A), while cells expressing GFP and not sim are lateral glia, because they also express reversed polarity (repo; data not shown), a marker of lateral CNS glia (Campbell et al. 1994; Xiong

792


Figure 3.—Sequences upstream of wrapper from both D. melanogaster and D. virilis drive midline glial expression of a reporter gene in D. melanogaster. The wrapper W:GFP fusion construct, containing a 884-bp genomic fragment consisting of the sequences upstream of wrapper (735 bp) and within the first exon (149 bp), drives expression of GFP in midline glia. (A–F) Transgenic embryos containing the wrapper W:GFP reporter gene were stained with a-GFP (green, B and E) and a-wrapper (red, C) or a-sim antibody (red, F) during stage 13 of embryogenesis. The overlap in expression between the reporter gene and wrapper (A) or the reporter gene and sim (D) is shown. Embryos containing the wrapper W:GFP construct had GFP expression in midline glia as well as cells of the lateral CNS cells (arrows). (G–X) The wrapper reporter genes drive GFP expression in midline glia during stage 16 of embryogenesis. Transgenic embryos containing the wrapper W:GFP (G–I), wrapper E:GFP ( J–L), wrapper E:GFP from D. virilis (M–O), wrapper G:GFP (P–R), wrapper K:GFP (S–X) reporter genes were stained with a-GFP (green; H, K, N, Q, T, and W) and a-sim antibody (red; I, L, O, R, and U) or a-engrailed antibody (red, X) and analyzed by confocal microscopy. The overlap in expression between the reporter gene and sim (G, J, M, P, and S) or between the reporter gene and engrailed (V) is shown. Embryos containing the wrapper K:GFP construct had GFP expression in midline glia as well as midline neurons (arrowheads, S–X). The expression pattern driven by wrapper K:GFP in midline neurons partially overlaps with engrailed expression in midline neurons, suggesting it is in the progeny of the median neuroblast (Wheeler et al. 2006). Ventrolateral views of embryos are shown: anterior is to the left.

et al. 1994; Halter et al. 1995). These results indicate spi mutations reduce the number of midline glia in the embryo and also reduce expression of the wrapper W:GFP reporter gene. In addition to sim and tgo, the transcription factors Dichaete (D), a Sox HMG protein (Ma et al. 2000), and Dfr, a POU domain protein, regulate genes expressed in midline glia (Bergmann et al. 2002). The D protein directly interacts with the PAS domain of Sim and the POU domain of Dfr and all three genes activate expression of slit in midline glial (Ma et al. 2000). We tested the wrapper W:GFP construct in both a D (Figure 4, J–L) and dfr (Figure 4, M–O) mutant background. In both cases, the number and behavior of midline cells was altered and they did not migrate to the dorsal region of the ventral nerve cord, as they normally do. While development of midline cells was disrupted in these mutant backgrounds as has been previously reported

(Certel et al. 1996; Nambu and Nambu 1996; Ma et al. 2000) and fewer midline glia were present, robust GFP expression was still observed from the reporter construct in the midline cells that remained, suggesting that (1) D and Dfr do not directly activate wrapper via these regulatory sequences, (2) additional, redundant factors exist that can substitute for them, or (3) they can substitute for one another, as suggested by previous studies (Ma et al. 2000). In summary, midline cell development was disrupted in sim, spi, D, and dfr mutant backgrounds. The simH9 mutation eliminated midline glia and neurons, while a mutation in spi eliminated most midline glia. As predicted, both sim and spi mutations severely reduced the number of cells expressing GFP driven by the wrapper W:GFP reporter gene. In the D and dfr mutants, the number of midline glia was reduced and the remaining midline glia expressed high levels of GFP.


793

Figure 4.—The wrapper reporter genes are sensitive to mutations in midline transcription factors and the spi signaling molecule. The wrapper W:GFP reporter construct was placed into several mutant backgrounds to determine the effect of these genes on wrapper transcriptional control. Midline glial expression provided by the wrapper W:GFP construct was high in wild-type embryos (A–C), abolished in simH9 (D–F) mutant embryos and severely reduced in spi (G–I) mutant embryos. In addition, wrapper W:GFP reporter gene expression was disrupted in D (J–L) and dfr (M–O) mutant embryos. Transgenic embryos containing the wrapper W:GFP reporter genes were stained with a-GFP (green; B, E, H, K, and N) and a-sim antibody (red; C, F, I, L, and O) during stage 16 of embryogenesis in the various mutant backgrounds and analyzed by confocal microscopy. The overlap in expression between the reporter gene and sim (A, D, G, J, and M) is shown. Lateral views are shown; anterior is to the left.

Ectopic expression of sim expands the wrapper expression domain: Ectopic sim expression converts neuroectodermal cells into midline cells and activates downstream, midline genes (Nambu et al. 1991; Kearney et al. 2004). To test the effect of ectopic sim on wrapper expression, we overexpressed sim using the UAS/GAL4 system (Brand and Perrimon 1993) and found that wrapper was expressed in neuroectodermal cells outside of the midline (Figure 5D), but not in all cells that overexpress sim (data not shown). In the UAS-sim/da-GAL4 embryos, wrapper is activated in cells that correspond to the lateral edges of the CNS and the cells in the anterior of each segment, with gaps in the expression pattern. Next, we tested if overexpression of the secreted form of spi (Schweitzer et al. 1995) could expand wrapper to cells

outside the midline. Ectopic expression of secreted spi with the da-GAL4 driver also expanded wrapper expression (Figure 5G). To determine if it is possible to expand the expression domain of wrapper further, we overexpressed sim together with spi. This caused additional expansion of the wrapper domain into broad stripes within ectodermal cells (Figure 5J). In addition, overexpression of either sim or spi causes severe disruption in embryonic development. Next, we tested the ability of sim and spi, either alone or together, to expand expression of the wrapper reporter genes. Expression from both the full-length reporter construct, wrapper W:GFP (Figure 5E), and the smaller wrapper G:GFP construct (Figure 5F) expanded in the UAS-sim/da-GAL4 embryos to a greater

794


Figure 5.—Overexpression of sim and spi expands the expression domain of the wrapper reporter genes. Sim and spi, either separately or together, were ectopically expressed throughout embryos using the da-GAL4 driver line and the expression of wrapper or GFP monitored. Whole-mount wild-type (A–C), UAS-sim/da-GAL4 (D–F), UAS-spi/da-GAL4 (G–I), and UAS-sim; UAS-spi/da-GAL4 ( J–L) embryos were stained with a-wrapper (A, D, G, and J) or a-GFP (B, C, E, F, H, I, K, and L) and analyzed by confocal microscopy. Ventral and ventrolateral views of embryos after germ band retraction are shown; anterior is to the left. Development is disrupted in embryos overexpressing sim and/or spi, complicating the determination of the developmental stage of these embryos.

extent than the endogenous wrapper gene. The expression pattern provided by the reporter constructs differs from the endogenous wrapper expression pattern, suggesting that either (1) some of the sequences that normally repress wrapper in tissues outside the midline glia may be missing in these wrapper W and G constructs, or (2) ectodermal cells overexpressing sim may undergo cell death and the GFP marker may be more stable in these dying cells compared to wrapper. Overexpression of spi alone also expanded reporter gene expression driven by both the wrapper W:GFP and wrapper G:GFP constructs (Figure 5, H and I). The GFP expression domain was expanded to a greater extent in embryos overexpressing sim together with spi (Figure 5, K and L) compared to those overexpressing either gene alone (Figure 5, E, F, H, and I). Taken together, the results indicate that (1) limiting the wrapper regulatory sequences and (2) increasing the cells that express sim and spi converts the highly specific expression pattern of wrapper from a single strip of CNS cells to a more general pattern throughout the ectoderm of the embryo. In addition, these results suggest that both the sim transcription factor and spi signaling molecule can activate transcription through these sequences derived from the regulatory region of wrapper.

Identification of sequence motifs required for wrapper expression: To both (1) identify functionally important motifs needed for wrapper expression and (2) determine if all the invariant nucleotides within the conserved 70-bp region of wrapper are essential for the observed midline glial expression pattern, we tested effects of select mutations within the wrapper G region. Previous studies have demonstrated the importance of sim/tgo, D, dfr, and spi for the expression of midline glial genes and, therefore, we first searched for possible binding sites for these factors. To examine both predicted binding sites, as well as other conserved sequences that may contain binding sites for novel factors, we divided the region into eight motifs that were tested for their effect on midline glia expression (Table 3 and Figure 6). Each of these conserved motifs was tested by changing 2–3 nucleotides in the context of the D. melanogaster G fragment (Figure 6). The altered G fragments were then inserted independently into the pHstinger vector and injected into fly embryos to test their ability to drive midline expression. Despite the high degree of conservation within this region, only four of the eight mutations that we tested (G1, G2, G5, and G7) caused a noticeable reduction in


795

TABLE 3 Eight motifs within the 70-bp conserved region located upstream of wrapper tested for their importance in midline glia expression Motif G1 G2 G3 G4 G5 G6 G7 G8

Sequence

Possible transcription factor

Midline glia expression

Midline neuron expression

CACAATa CACGT TGTAAT ATGCAAATa ATTTTATC ATGCAACA CGGAGAG ATGCGTGGa

Sox Sim/Tgo Sox POU homeodomain POU pointed POU

1/ — 1 1 — 1 — 1

— — — 1 — 1 — 1

See Figure 6 for mutations created to test the importance of each site. Certain positions within these three motifs vary in certain Drosophila species (see Figure 1), although the sequences tested are conserved in all species. The results obtained from mutagenesis of each motif in the wrapper G fragment are indicated. a

reporter expression. Two of the mutation sets destroyed midline expression of the G reporter construct. The putative Sim/Tgo binding site (G2: CACGT) was needed for midline expression, because changing this sequence to GAAGTeliminated midline glial expression (Figure 7, D–F). In addition, another sequence, ATTT TATC (G5), located upstream of the G2, was required for expression of the reporter gene in wild-type embryos and changing this sequence to ATTGGATC eliminated midline glial expression (Figure 7, M–O). Two additional sites within the G fragment of wrapper are needed for midline expression: CGGAGAG (G7; Figure 7, S–U) and CACAAT (G1; Figure 7, A–C). If either of these motifs is altered, midline glial expression is greatly reduced, but not completely eliminated. In contrast, the other four sets of mutations had no detectable negative effect on midline glial expression of the reporter gene, even though these sequences are conserved in all 12 Drosophila species. Mutation sets G4 (Figure 7, J–L), G6 (Figure 7, P–R), and G8 (Figure 7, V–X) did cause a low level of reporter gene activation in some midline neurons, suggesting that repressor proteins present in midline neurons may interact with these regions of the wrapper regulatory region. Finally, mutation G3 had no detectable positive or negative effect on expression of the reporter gene (Figure 7, G–I), despite being conserved in all 12 Drosophila species. In summary, the various mutations had three different effects on expression driven by the wrapper regulatory sequences: (1) some reduced midline glial expression, (2) some caused the inappropriate activation of the wrapper reporter in midline neurons, and (3) one was conserved, but apparently had no effect on wrapper regulation, in the context of the experiments presented here.

DISCUSSION

Through the comparison of genomic sequences flanking the wrapper gene in 12 Drosophila species, we

identified a 119-nucleotide sequence that can drive high levels of transcription in midline glia. This region contains a sector in which 61/70 (87%) nucleotides are conserved within all Drosophila species examined, relatively high for noncoding genomic sequences. Prior genomic comparisons between two species, D. melanogaster and pseudoobscura, demonstrated the presence of short, yet highly conserved regulatory regions of genes, including giant, forkhead, m7, snail, even-skipped, and sloppy-paired (Papatsenko et al. 2006). Because consensus binding sites of most transcription factors generally can vary at several positions, it is surprising to see such a high level of conservation in regulatory sequences among all 12 fly species studied here. This may be a consequence of interactions between various factors that bind and regulate transcription in these regions that dictate a particular spatial requirement and order (Zinzen et al. 2006). Previous studies have identified a regulatory network consisting of sim and tgo,

Figure 6.—Site-directed mutagenesis of eight motifs within the wrapper genomic sequences conserved in 12 Drosophila species. The 70-bp conserved region is shown with the various mutations (G1–8) tested indicated at the top of the sequences. Sequences invariant within all 12 Drosophila species are shaded and the CME is underlined.

796


Figure 7.—Identification of four motifs required for midline glial expression within the wrapper genomic sequences conserved in 12 Drosophila species. (A–X) Eight different sets of mutations were made within the context of the 166-bp G fragment located upstream of the D. melanogaster wrapper gene that contains a 70-bp region highly conserved with 11 other Drosophila species. Transgenic embryos containing the wrapper G1:GFP (A–C), wrapper G2:GFP (D–F), wrapper G3:GFP (G–I), wrapper G4:GFP ( J–L), wrapper G5:GFP (M–O), wrapper G6:GFP (P–R), wrapper G7:GFP (S–U), and wrapper G8:GFP (V–X) reporter genes were stained with a-GFP (green; B, E, H, K, N, Q, T, and W) and a-sim antibody (red; C, F, I, L, O, R, U, and X) during stage 16 of embryogenesis and analyzed by confocal microscopy. The overlap in expression between the reporter gene and sim (A, D, G, J, M, P, S, and V) is shown. Ventrolateral views of embryos are shown; anterior is to the left. Mutation wrapper G7:GFP causes expression of GFP in the gut (T; arrow) and mutations wrapper G4:GFP, wrapper G6:GFP, and wrapper G8:GFP cause a low level of expression in some midline neurons (K, Q, and W; arrowheads).

D, dfr, and spi signaling that impacts midline glial development and gene expression (Certel et al. 1996; Nambu and Nambu 1996; Ohshiro and Saigo 1997; Sonnenfeld et al. 1997; Ma et al. 2000; Bergmann et al. 2002) and the wrapper conserved element includes potential binding sites for these transcriptional regulators (Table 3). Regulation by sim: Several experiments described here suggest that Sim/Tgo heterodimers may directly regulate wrapper gene expression. First, activity of the wrapper W:GFP reporter gene is severely reduced in a sim mutant background, suggesting sim is necessary for expression of this transgene and that sim regulates wrapper by activating transcription through these sequences. Second, midline activity of the wrapper reporter gene is abolished by eliminating the single CME (CACGT) present within this region. Third, wrapper reporter gene expression is expanded in sim overexpression embryos. Future biochemical studies will determine if Sim/Tgo heterodimers directly interact with the wrapper regulatory motif identified here. Spi signaling in midline glia: The studies described here demonstrate that the wrapper reporter genes are sensitive to levels of spi signaling. Mutations in spi re-

duce wrapper reporter gene expression and overexpression of the secreted form of spi, together with sim expands, not only the expression domain of the endogenous wrapper gene, but the wrapper reporter genes as well. Spi binds the Epidermal Growth Factor Receptor in midline glia, leading to MAPK activation (Gabay et al. 1997a,b) and subsequent activation of the ETS transcription factor, pnt (Kla¨mbt, 1993). Therefore, it may be Pnt that directly activates wrapper transcription through the regulatory sequences studied here. One of the identified motifs needed for transcriptional activity of wrapper is: CGGAGAG, which loosely conforms to the consensus binding site for ETS transcription factors (C/A)GGA(A/T) (A/G)(C/T) (Sharrocks et al. 1997). However, further experiments are needed to determine if Pnt directly interacts with these regulatory sequences, as well as the precise mechanism whereby spi signaling regulates wrapper. Taken together with previous studies, these results suggest that the spi signaling pathway may play at least two roles in promoting survival of midline glia: (1) activating wrapper, needed for neuron–glial interactions and (2) phosphorylating, thereby inactivating head involution defective (Bergmann et al. 2002), which would otherwise cause programmed cell death in midline glia.


Sox, POU, and homeodomain proteins in CNS transcriptional regulation: Many genes expressed in the CNS of metazoan organisms are regulated through synergistic interactions between Sox HMG-containing proteins and POU domain proteins (Ambrosetti et al. 2000; Ma et al. 2000; Tanaka et al. 2004; Bailey et al. 2006). Recently, many vertebrate genes expressed in the developing CNS have been shown to contain highly conserved noncoding DNA regions enriched for binding sites for three classes of transcription factors: Sox, POU, and homeodomain proteins (Bailey et al. 2006). Experiments indicated that Sox and POU proteins work together to activate, while homeodomain proteins repress and limit expression of CNS genes. Interestingly, several motifs identified here as important for regulation in midline glia of Drosophila resemble binding sites for Sox (G1: CACAAT; Wegner 1999), POU (G4: ATGCAAAT, G6: ATGCAACA, and G8: ATGCGTGG; Pankratova and Polanovsky 1998), and homeodomain proteins (G5: ATTTTATC; Kalionis and O’Farrell 1993). Reporter gene expression in midline neurons: That the wrapper K:GFP, but not the wrapper G:GFP construct is expressed in certain midline neurons, identifies a midline neural silencer in the 43-bp region present in the G fragment, but absent in the K fragment. Within this region, 27 bp are highly conserved in all 12 Drosophila species (Figure 1B) and two of the three mutations in the G fragment that cause slight activation of reporter gene expression in midline neurons (wrapper G4:GFP and wrapper G8:GFP; Figure 7) are found within the 43bp region. All three sites that lead to activation in midline neurons, G4, G6, and G8, conform to a POU domain binding site (Pankratova and Polanovsky 1998), suggesting a POU domain protein expressed in midline neurons may bind to one or more of these sites to keep the wrapper gene silent. One POU domain protein, Dfr, binds to the sequence ATGCAAAT in other gene regulatory regions to activate transcription, including those of two genes expressed in midline glia: dfr itself and slit (Certel et al. 1996; Ma et al. 2000). This sequence is found at site G8 in the wrapper regulatory region, but when changed to ATGC TAGC, caused a low level of activation in midline neurons (Figure 7X), rather than reducing expression in midline glia. Although the number of midline glia is reduced in a dfr mutant background, those that remain express a high level of reporter gene expression driven by wrapper sequences and the results suggest dfr is not absolutely required for wrapper reporter gene expression in midline glia. Mutations in the POU domain motifs within the wrapper regulatory sequences suggest a notable difference between the CNS genes studied previously in vertebrates (Bailey et al. 2006) and the midline glial gene studied here. The POU domain binding sites appear to limit expression in midline neurons (rather

797

than activate expression as in vertebrate CNS genes), and it is the Sox and homeodomain binding sites that are needed for activation. This may reflect a key difference in regulatory control of glial vs. neural genes and it is plausible that other midline glial genes excluded from midline neurons will contain silencer elements similar to the one identified here, but further experiments are needed to confirm this. Reporter gene expression in other tissues: Some of the wrapper reporter gene constructs are expressed in other tissues during embryogenesis. In addition to midline glia, the wrapper W:GFP construct is expressed in a few cells within the lateral CNS (Figure 3, A–I) and a subset of somatic muscle cells (not shown). The wrapper G:GFP construct is also expressed in some somatic muscles and in the salivary glands (not shown), the wrapper G7:GFP construct is expressed in cells of the gut (Figure 7T), and the smaller wrapper K:GFP construct is expressed in certain CNS midline neurons (including progeny of the median neuroblast; Figure 3, V–X), unlike the endogenous wrapper gene. These results indicate genes expressed within midline glia must share motifs closely related to those found within genes expressed in tissues such as (1) the lateral CNS glia, (2) midline neurons, (3) trachea, (4) muscles, (5) salivary glands, and (6) gut, and slight changes in these sequences can switch expression from midline glia to one or more of these tissues. Summary: These results demonstrate that certain Drosophila CNS genes contain short, 30–80-bp highly conserved genomic signatures indicative of regulatory function. Within the conserved regulatory region of wrapper, a combination of a minimum of four sites (CACGT, GCGGAGAG, CACAAT, and the T-rich motif) is required for transcriptional activation in midline glia. In addition, a neuron silencer is required to repress expression of a midline glial gene in midline neurons. Finally, these experiments also highlight sim/tgo and the spi signaling pathway as key components in the regulation of wrapper. Future experiments are needed to determine (1) if Sim and/or Pnt directly bind the sequences identified here, (2) which proteins expressed in midline neurons repress wrapper through the midline neuron silencer identified here, and (3) if other genes expressed in midline glia also contain the conserved motifs identified here. These motifs and other conserved sequence signatures should be valuable for studying both (1) conservation in regulatory regions to identify transcription factor binding sites and/or possible structural components of regulatory DNA and (2) any variations within these otherwise conserved blocks in divergent species. Relatively small changes within these regions could lead to a change in the spatial or temporal expression pattern of a gene that may ultimately lead to novel functions within various fly species.

798


We thank John Nambu for the D fsh87 mutant flies and Ben-Zion Shilo for the UAS-sspi4a flies. We are grateful to Michael Purugganan, Trudy Mackay, Greg Gibson, and other members of the North Carolina State University Genetics Department for help with sequencing and to Trudy Mackay and Faye Lawrence for fly food. We thank Tony Perdue for help with confocal microscopy, Laura Mathies for the use of her microscopes, Amanda Welty, Anna Edens, and Kelly Daigle for help with the injections of fly embryos, and Trudy Mackay and Laura Mathies for comments on the manuscript. The dfr and spi mutant lines were obtained from the Bloomington Stock Center and the wrapper antibody was obtained from the Iowa Hybridoma Center. This work was supported by National Science Foundation grant no. 0416812 to P.E.

LITERATURE CITED Ambrosetti, D. C., H. R. Scholer, L. Dailey and C. Basilico, 2000 Modulation of the activity of multiple transcriptional activation domains by the DNA binding domains mediates the synergistic action of Sox2 and Oct-3 on the fibroblast growth factor-4 enhancer. J. Biol. Chem. 275: 23387–23397. Bailey, P. J., J. M. Klos, E. Andersson, M. Karlen, M. Kallstrom et al., 2006 A global genomic transcriptional code associated with CNS-expressed genes. Exp. Cell Res. 312: 3108–3119. Barolo, S., L. A. Carver and J. W. Posakony, 2000 GFP and betagalactosidase transformation vectors for promoter/enhancer analysis in Drosophila. Biotechniques 29: 726–732. Bergmann, A., M. Tugentman, B.-Z. Shilo and H. Steller, 2002 Regulation of cell number by MAPK-dependent control of apoptosis: a mechanism for trophic survival signaling. Dev. Cell 2: 159–170. Berman, B. P., B. D. Pfeiffer, T. R. Laverty, S. L. Salzberg, G. M. Rubin et al., 2004 Computational identification of developmental enhancers: conservation and function of transcription factor binding-site clusters in Drosophila melanogaster and Drosophila pseudoobscura. Genome Biol. 5: R61. Bossing, T., and G. M. Technau, 1994 The fate of the CNS midline progenitors in Drosophila as revealed by a new method for single cell labelling. Development 120: 1895–1906. Brand, A. H., and N. Perrimon, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415. Campbell, G., H. Go¨ring, T. Lin, E. Spana, S. Andersson et al., 1994 RK2, a glial-specific homeodomain protein required for embryonic nerve cord condensation and viability in Drosophila. Development 120: 2957–2966. Certel, K., M. G. Anderson, R. J. Shrigley and W. A. Johnson, 1996 Distinct variant DNA-binding sites determine cell-specific autoregulated expression of the Drosophila POU domain transcription factor drifter in midline glia or trachea. Mol. Cell. Biol. 4: 1813–1823. Dickson, B. J., 2002 Molecular mechanisms of axon guidance. Science 298: 1959–1964. Estes, P. A., J. Mosher and S. T. Crews, 2001 Drosophila singleminded represses gene transcription by activating the expression of repressive factors. Dev. Biol. 232: 157–175. Freeman, M. R., J. Delrow, J. Kim, E. Johnson and C. Q. Doe, 2003 Unwrapping glial biology: Gcm target genes regulating glial development, diversification and function. Neuron 38: 567–580. Gabay, L., R. Seger and B. Z. Shilo, 1997a MAP kinase in situ activation atlas during Drosophila embryogenesis. Development 124: 3535–3541. Gabay, L., R. Seger and B. Z. Shilo, 1997b In situ activation pattern of Drosophila EGF receptor pathway during development. Science 277: 1103–1106. Garbe, D. S., and G. J. Bashaw, 2004 Axon guidance at the midline: from mutants to mechanisms. Crit. Rev. Biochem. Mol. Biol. 39: 319–341. Giebel, B., I. Stuttem, U. Hinz and J. A. Campos-Ortega, 1997 Lethal of scute requires overexpression of daughterless to elicit ectopic neuronal development during embryogenesis in Drosophila. Mech. Dev. 63: 75–87.

Halter, D. A., J. Urban, C. Rickert, S. S. Ner, K. Ito et al., 1995 The homeobox gene repo is required for the differentiation and maintenance of glia function in the embryonic nervous system of Drosophila melanogaster. Development 121: 317–332. Jacobs, J. R., 2000 The midline glia of Drosophila: a molecular genetic model for the developmental functions of glia. Prog. Neurobiol. 62: 475–508. Kalionis, B., and P. H. O’Farrell, 1993 A universal target sequence is bound in vitro by diverse homeodmains. Mech. Dev. 43: 57–70. Kearney, J. B., S. B. Wheeler, P. Estes, B. Parente and S. T. Crews, 2004 Gene expression profiling of the developing Drosophila CNS midline cells. Dev. Biol. 275: 473–492. Kla¨mbt, C., 1993 The Drosophila gene pointed encodes two ETSlike proteins which are involved in the development of the midline glial cells. Development 117: 163–176. Ma, Y., K. Certel, Y. Gao, E. Niemitz, J. Mosher et al., 2000 Functional interactions between Drosophila bHLH/PAS, Sox, and POU transcription factors regulate CNS midline expression of the slit gene. J. Neurosci. 20: 4596–4605. Nambu, P. A., and J. R. Nambu, 1996 The Drosophila fish-hook gene encodes a HMG domain protein essential for segmentation and CNS development. Development 122: 3467–3475. Nambu, J. R., R. G. Franks, S. Hu and S. T. Crews, 1990 The singleminded gene of Drosophila is required for the expression of genes important for the development of CNS midline cells. Cell 63: 63–75. Nambu, J. R., J. O. Lewis, K. A. Wharton and S. T. Crews, 1991 The Drosophila single-minded gene encodes a helixloop-helix protein that acts as a master regulator of CNS midline development. Cell 67: 1157–1167. Noordermeer, J. N., C. C. Kopczynski, R. D. Fetter, K. S. Bland, W. Y. Chen et al., 1998 Wrapper, a novel member of the Ig superfamily, is expressed by midline glia and is required for them to ensheath commissural axons in Drosophila. Neuron 21: 991–1001. Ohshiro, T., and K. Saigo, 1997 Transcriptional regulation of breathless FGF receptor gene by binding of TRACHEALESS/ dARNT heterodimers to three central midline elements in Drosophila developing trachea. Development 124: 3975–3986. Pankratova, E. V., and O. L. Polanovsky, 1998 Oct-1 promoter region contains octamer sites and TAAT motifs recognized by Oct proteins. FEBS Lett. 426: 81–85. Papatsenko, D., A. Kislyuk, M. Levine and I. Dubchak, 2006 Conservation patterns in different functional sequence categories of divergent Drosophila species. Genomics 88: 431–442. Patel, N. H., 1994 Imaging neuronal subsets and other cell types in whole-mount Drosophila embryos and larvae using antibody probes. In: Drosophila melanogaster: Practical uses in cell and molecular biology. Methods Cell Biol. 44: 445–487. Pennacchio, L. A., N. Ahituv, A. M. Moses, S. Prabhakar, M. A. Nobrega et al., 2006 In vivo enhancer analysis of human conserved non-coding sequences. Nature 444: 499–502. Rajewsky, N., M. Vergassola, U. Gaul and E. D. Siggia, 2002 Computational detection of genomic cis-regulatory modules applied to body patterning in the early Drosophila embryo. BMC Bioinformatics 3: 30. Rebeiz, M., T. Stone and J. W. Posakony, 2005 An ancient transcriptional regulatory linkage. Dev. Biol. 281: 299–308. Rubin, G. M., and A. C. Spradling, 1982 Genetic transformation of Drosophila with transposable element vectors. Science 218: 348–353. Salzberg, A., D. D’Evelyn, K. L. Schulze, J. K. Lee, D. Strumpf et al., 1994 Mutations affecting the pattern of the PNS in Drosophila reveal novel aspects of neuronal development. Neuron 13: 269–287. Schroeder, M. D., M. Pearce, J. Fak, H. Fan, U. Unnerstall et al., 2004 Transcriptional control in the segmentation gene network of Drosophila. PLoS Biol. 9: E271. Schweitzer, R., M. Shaharabany, R. Seger and B. Z. Shilo, 1995 Secreted Spitz triggers the DER signaling pathway and is a limiting component in embryonic ventral ectoderm determination. Genes Dev. 9: 1518–1529. Sharrocks, A. D., A. L. Brown, Y. Ling and P. R. Yates, 1997 The ETS-domain transcription factor family. Int. J. Biochem. Cell Bio. 29: 1371–1387. Shilo, B.-Z., 2005 Regulating the dynamics of EGF receptor signaling in space and time. Development 132: 4017–4027.

Gene Regulation in Midline Glia Sinha, S., M. D. Schroeder, U. Unnerstall, U. Gaul and E. D. Siggia, 2004 Cross-species comparison significantly improves genome-wide prediction of cis-regulatory modules in Drosophila. BMC Bioinformatics 5: 129. Sonnenfeld, M., M. Ward, G. Nystrom, J. Mosher, S. Stahl et al., 1997 The Drosophila tango gene encodes a bHLH-PAS protein that is orthologous to mammalian Arnt and controls CNS midline and tracheal development. Development 124: 4571–4582. Stark, A., M. F. Lin, P. Kheradpour, J. S. Pedersen, L. Parts et al., 2007 Discovery of functional elements in 12 Drosophila genomes using evolutionary signatures. Nature 450: 219–232. Tanaka, S., Y. Kamachi, A. Tanouchi, H. Hamada, N. Jing et al., 2004 Interplay of SOX and POU factors in regulation of the Nestin gene in neural primordial cells. Mol. Cell. Biol. 24: 8834–8846. Tearle, R. G., and C. Nusslein-Volhard, 1987 Tubingen mutants and stock list. Dros. Inf. Serv. 66: 209–269. Thomas, J. B., S. T. Crews and C. S. Goodman, 1988 Molecular genetics of the single-minded locus: a gene involved in the development of the Drosophila nervous system. Cell 52: 133–141.

799

Ward, M. P., J. T. Mosher and S. T. Crews, 1998 Regulation of bHLH-PAS protein subcellular localization during Drosophila embryogenesis. Development 125: 1599–1608. Wegner, M., 1999 From head to toes: the multiple facets of Sox proteins. Nucleic Acids Res. 27: 1409–1420. Wenick, A. S., and O. Hobert, 2004 Genomic cis-regulatory architecture and trans-acting regulators of a single interneuron-specific gene battery in C. elegans. Dev. Cell 6: 757–770. Wheeler, S. R., J.B. Kearney, A.R. Guardiola and S.T. Crews, 2006 Single-cell mapping of neural and glial gene expression in the developing Drosophila CNS midline cells. Dev. Biol. 294: 509–524. Xiong, W. C., H. Okano, N. H. Patel, J. A. Blendy and C. Montell, 1994 repo encodes a glial-specific homeo domain protein required in the Drosophila nervous system. Genes Dev. 8: 981–994. Zinzen, R. P., K. Senger, M. Levine and D. Papatsenko, 2006 Computational models for neurogenic gene expression in the Drosophila embryo. Curr. Biol. 16: 1358–1365. Communicating editor: K. Golic