the RRE was initially identified by Rosen et al. using chimeric chloramphenicol acetyltransferase (CAT)-env re- porter plasmids (43). The inhibitory effect of CRS ...
JOURNAL OF VIROLOGY, Nov. 1991, p. 5732-5743
Vol. 65, No. 11
0022-538X/91/115732-12$02.00/0 Copyright C) 1991, American Society for Microbiology
Identification of Posttranscriptionally Active Inhibitory Sequences in Human Immunodeficiency Virus Type 1 RNA: Novel Level of Gene Regulation FRANK MALDARELLI,* MALCOLM A. MARTIN, AND KLAUS STREBEL Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892 Received 3 December 1990/Accepted 26 July 1991
cis-acting inhibitory region (IR) sequences were identified within the gaglpol gene of the human immunodeficiency virus type 1 (HIV-1) by using a novel feedback-stimulated, rev-independent tat reporter gene to screen HIV-1 sequences in transient expression assays. Two regions, a 1,295-nucleotide segment in the gag gene (IR-1) and a 1,932-nucleotide segment of the pol gene (IR-2), each inhibited reporter gene expression 10- to 20-fold. IR-1 and IR-2 both contained subsequences which inhibited reporter gene expression. Introduction of IR sequences into a heterologous reporter plasmid, pCMV-CAT, resulted in decreased chloramphenicol acetyltransferase expression, suggesting that the inhibitory effect was not restricted to a reporter gene under the control of the HIV-1 promoter. The presence of HIV IR sequences in cis did not alter relative levels of reporter gene RNA; however, fractionation studies revealed IR-containing RNA accumulated in the nucleus. These findings demonstrate that IR sequences within the gaglpol region affect gene expression by altering the cellular distribution of viral RNA. The human immunodeficiency virus type 1 (HIV-1) contains one of the most complex known retroviral genomes, encoding at least nine genes (39, 45) that are all expressed from a single promoter located in the 5' long terminal repeat (LTR). Expression of HIV-1 genes is highly regulated and involves not only transcriptional mechanisms modulating the promoter activity but also posttranscriptional events such as differential splicing of primary transcripts into mature mRNAs. Two HIV-1-encoded proteins, tat and rev, are essential for these processes and are under intense investigation. tat functions by interacting with a cis-acting sequence (TAR) present at the 5' end of all viral mRNAs (6, 15, 40) and increases the rate of transcriptional initiation or elongation of nascent HIV RNA (25, 30, 33, 47). rev is required for the appearance of unspliced or singly spliced mRNAs in the cytoplasm and increases the half-life of these mRNAs (16-18, 37, 38). The rev gene product functions by interacting with a unique cis-acting element, the rev-responsive region (RRE), located in the env gene of HIV-1 (14, 23, 38). Several studies suggest the presence of additional sequences embedded within the coding regions of the HIV-1 env and gag genes which may participate in regulating HIV gene expression, either independently of or in concert with the revIRRE interaction. The presence of cis-acting repressor sequences (CRS) located within the env gene upstream of the RRE was initially identified by Rosen et al. using chimeric chloramphenicol acetyltransferase (CAT)-env reporter plasmids (43). The inhibitory effect of CRS sequences was detected in the absence of rev and did not require the presence of splice sites. These inhibitory regions have not been analyzed independently of the RRE, and their function remains unclear. In addition, observations by HadzopoulouCladaras and coworkers (22) and Dayton et al. (13) have indicated that expression of the gag gene requires the
*
of the RRE in cis and the rev gene product in trans and suggest the existence of cis-acting sequences in the HIV-1 gag gene. We have constructed a series of subclones of the infectious molecular clone pNL43 (1), deleting various portions of the HIV-1 genome downstream of the gag gene, and analyzed the transient expression of gag. Only constructs containing both the RRE element and the capacity to express rev produced gag proteins even when splicing was excluded, suggesting that the gag gene region may contain cis-acting inhibitory sequences. A sensitive, feedback-stimulated reporter gene was subsequently developed to analyze the inhibitory effect of these gaglpol sequences. Two regions, inhibitory region 1 (IR-1) and IR-2, which inhibited expression of reporter genes in two independent test systems were identified in the gag and pol genes, respectively. The inhibitory effects were orientation dependent and functioned only when part of the transcriptional unit. Analysis of the transcriptional patterns revealed that IR-containing RNA was synthesized but accumulated in the nucleus of transfected cells. These findings suggest that IR sequences do not affect transcriptional activity of a gene but rather inhibit gene expression posttranscriptionally, resulting in the exclusion of RNA from the cytoplasm. presence
MATERIALS AND METHODS Cell lines. The HeLa 3T1 cell line, which contains a stably integrated copy of the HIV-1 LTR-driven CAT gene and which is transcriptionally silent in the absence of the tat gene product, was obtained from B. Felber (19); HeLa and SW480 cell lines were obtained from the American Type Culture Collection. Cell lines were maintained in Dulbecco modified Eagle medium supplemented with 10% heat-inactivated fetal bovine serum, 2 mM glutamine, and 100 U each of penicillin and streptomycin per ml of medium. Cloned DNAs. Construction of the infectious molecular clone of HIV-1, pNL43, has been described previously (1).
Corresponding author. 5732
VOL. 65, 1991
HIV-1 gaglpol INHIBITORY SEQUENCES A
A 196 105
,,:n
FIG. 1. (A) cis inhibition of gag production in transient expression assays. SW480 cells were transfected by the calcium phosphate technique with DNA of each of the indicated constructs or were mock transfected. As a source of tat for transactivation, pNLenv-4 and pNLenv-6 were cotransfected with pAR (20). Samples of cell lysates prepared 48 h following transfection were subjected to SDS-polyacrylamide gel electrophoresis and electroblotted onto nitrocellulose membranes; HIV proteins were detected by sequential incubation first with human anti-HIV-1 plasma and then with [125I]protein A and were then subjected to autoradiography. An overnight exposure is presented; molecular masses (in kilodaltons) are indicated at the left, and HIV-1 protein designations are shown at the right. (B) Structures of plasmids used to detect inhibitory sequences in the HIV-1 gaglpol genes. Deletions in the infectious molecular clone pNL43 are indicated by dotted lines. The major splice donor site (SD) and splice acceptor in the integrase gene (SA) are indicated. Prot, protease.
C-
t C Go
_
-
-gpl60!120
-
P55gag
442
p41 .~~~
27.8 __
18.3 -
-
p24
-
p17
15.3 -
B
so} p17
p24
SA
p71
IProt
IZ lP
Rar.i Tmrowap.
kts
*nv
I
=f
gpl 20
9p
EF4zz.
I
LI UIL-- ,I 343
.,ZIL*z* E. _~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ IF
rev
----
I vi? T Eev
I
I
---e ] -
T I r
z
---
2819
.. -------------------........
Construction of subgenomic plasmid, pAR, which encodes the first coding exons of tat and rev, as well as vpu, has been described (20). The reporter plasmid pSV2-luciferase was provided by S. Subramani, and the pAL4-SV ,-globin expression plasmid was obtained from P. Sharp. Deletion mutants of HIV-1 were constructed by restricting pNL43 DNA with the indicated enzymes, blunting DNA ends with Escherichia coli DNA polymerase, and religating (Fig. 1B). pNLenv-1 deleted a KpnI-BglII (nucleotides [nt] 6343 to 7031, numbering according to the pNL43 sequence; GenBank accession number M19921 [41]) fragment; pNLenv-4 deleted the EcoRI-XhoI (nt 5743 to 8887) fragment; and pNLenv-6 deleted a BalI-XhoI (nt 2619 to 8887) fragment. pTS-1 (see Fig. 3) contains a functional tat gene upstream of the coding sequence of HIV-1 and was constructed by a stepwise cloning procedure summarized as follows. (i) The EcoRI- HindIll tat-encoding fragment of pNL43 (nt 5743 to 6026) was inserted at the BssHII site (nt 711) between the end of the U5 portion of the LTR and the major splice donor; a SmaI linker was placed between the HindlIl site and the BssHII site, maintaining the BssHII recognition sequence 3' to the insert. (ii) A mutation in the major splice donor was introduced by cloning the BssHII-EcoRI (nt 711 to 5743) fragment from the splicing-defective proviral plasmid,
pNLENV-4
pLENV-6
-----
r
pNLENV-1
9005
5743
T,5..LIrzvzzL---
pNL43
7031
7-
.-
5733
------
8887
pNL5B, which was obtained by site-directed mutagenesis techniques to remove nt 747 to 773 from pNL43 (gift of Francois Clavel). This deletion changed the consensus sequence of the major splice donor from 5'-TG"GTGAGT-3' to 5'-TG"GTGQGC-3'; G and C at positions 6 and 8, respectively, of the consensus splice donor sequence are infrequently found at splice donor sites (48). (iii) The downstream tat gene was inactivated by cloning the EcoRI-NcoI (nt 5743 to 10568) fragment of pNLdTAT, which was constructed by R. Willey with use of site-directed mutagenesis techniques, to introduce two termination codons following the sequence for the first 11 amino acids of tat, changing the sequence from CCCTGGAAGC to CCCTGAIAG. Plasmid pTA-1 was constructed to contain the EcoRI-KpnI (nt 5743 to 6343) fragment of pNL43 introduced into the BssHII site at position 711. This tat-containing fragment includes the splice donor sequence at the end of the tat exon; no SmaI linker was inserted, and the BssHII recognition sequence was retained 3' to the insert. The deletion of nt 747 to 773 and the downstream tat mutations were included as for pTS-1. Deletipns of pTS-1 were generated by restricting the plasmid with the indicated enzymes, filling in the staggered ends where necessary, and religating (see Fig. 4): pTS-2, ApaI-XhoI (nt 2006 to 8887); pTS-5, BalI (2619 to 4551); pTS-6, BssHII-ApaI (711 to 2006); pTS-8, both BalI (2619 to
5734
MALDARELLI ET AL.
4551) and BssHII-ApaI (711 to 2006); pTS-25, SpeI-XhoI (1507 to 8887); pTS-251, SpeI-BamHI (1507 to 8465); pTS23, SphI-XhoI (1443 to 8887); and pTS-7, BssHII-XhoI (711 to 8887). Subconstructs of plasmid pTS-2 were similarly cloned: pTS-21, BssHII-SpeI (711 to 1507); pTS-22, BssHIISphI (711 to 1443); and pTS-24, XmnI-XmnI (838 to 1272). Deletion plasmids of pTS-6 were similarly constructed: pTS-61 by KpnI deletion (3865 to 9005), pTS-63 by BalIKpnI (2619 to 9005) deletion, and pTS-64 by BalI-NsiI (2619 to 2887) deletion. Plasmid pTS-711 was constructed by inserting into plasmid pTS-7 restricted with SmaI the bluntended XmnI-HindIII fragment (1272 to 1712) of pNL43. Similarly, pTS-26 was constructed by inserting the bluntended PvuII-PstI (1145 to 1415) fragment, pTS-75 was constructed by inserting the BssHII-XmnI (711 to 838) fragment, and pTS-74 was constructed by inserting the XmnI-XmnI fragment (838 to 1272). Deletions of pTA-1 were constructed by restriction digest using the indicated enzymes, fill-in, and religation: pTA-25, SpeI-XhoI (1507 to 8887); and pTA-251, SpeI-BamHI (1507 to 8465). Sequences containing inhibitory activity were also introduced between the end of the coding sequence and the polyadenylation site of pCMV-CAT (gift of N. Ahmad [2]), which places the CAT gene under control of the cytomegalovirus (CMV) immediate-early promoter. The blunt-ended BssHII-ApaI fragment (711 to 2006) was cloned into the HpaI site in the forward (pCMV-2) or reverse (pCMV-2i) orientation (see Fig. 6). Similarly, pCMV-23 contained an insertion of the blunt-ended BssHII-SphI (711 to 1443) fragment, pCMV-711 contained the XmnI-HindIII (1272 to 1712) fragment, pCMV-22 contained the blunt-ended SphIApal (1443 to 2006) fragment, and pCMV-26 contained the PvuII-PstI fragment (1145 to 1415). Plasmid pCMV-3 was cloned with the blunt-ended BssHII-ApaI (711 to 2006) fragment inserted at the NarI site (position 238 of the pUC18 vector). The locations and orientations of inserts were verified by restriction analysis, dideoxy nucleotide sequencing, or both. DNA transfection. Cloned DNAs (1.5 to 4.5 pmol) were transfected into HeLa or HeLa 3T1 cells by the calcium phosphate precipitation technique as previously described (49); following glycerol shock, cells were fed with Dulbecco modified Eagle medium. Lysates were prepared for detection of HIV-1 proteins and for quantitation of CAT activity or RNA levels 24 to 48 h following transfection. Variation in transfection efficiency of pTS or pCMV subconstructs was internally controlled by cotransfecting S or 10 ,ug of the reporter plasmid pSV2-luciferase and normalizing samples by luciferase activity as described previously (42). Luciferase assay. Lysates of transfected cells were prepared by Triton X-100 lysis as described elsewhere (42). The luciferase gene product was detected by measuring light produced from the ATP-dependent oxidation of luciferin by luciferase; the photons emitted following the transient flash were quantitated for 3 min with a Beckman LS-1801 scintillation counter, and the data were analyzed as described by Nguyen et al. (42). CAT assay. Cell lysates were prepared by the method of Gorman et al. (21) or Nguyen et al. (42); acetylation of chloramphenicol was assayed by using thin-layer chromatography to separate reaction products, and the fraction of chloramphenicol acetylated was determined by scintillation counting (21). For quantitation purposes, a kinetic analysis was performed by taking aliquots from each assay at several time points during 30 to 60 min to determine the linear range of the acetylation reaction.
J. VIROL.
Slot blot RNA quantitation. Total cellular RNA was prepared from transfected cell cultures by guanidinium isothiocyanate lysis and a phenol-chloroform-isoamyl alcohol extraction technique (10, 11) (Stratagene kit 200345). Serial dilutions of RNA preparations were applied to nitrocellulose paper by using a slot blot apparatus (Minifold; Schleicher & Schuell) (52, 53). CMV CAT-specific RNA was detected by hybridizing filters with a DNA probe for the CAT gene prepared from an M13 phage-derived plasmid, mpCAT (35), which contains the BglII-EcoRI fragment (spanning the transcription start site) from plasmid pA1OCAT2; this construct contains 256 nt homologous to the CAT-coding sequence. Uniformly labeled probes were prepared by annealing a universal M13 primer to the positive strand of mpCAT DNA and extending with Klenow polymerase in the presence of [a-32P]dCTP and unlabeled dATP, dGTP, and dTTP (44). Actin-specific RNA was detected by using a probe derived by extending the random hexamer-primed promoterless plasmid pB-actin (gift of 0. J. Semmes) with Klenow polymerase in the presence of [32P]dCTP and unlabeled deoxynucleoside triphosphates (44). Filters were hybridized overnight at 42°C in 50 mM sodium phosphate buffer (pH 6.5) containing 50% formamide, S x Denhardt's solution, and 0.1% sodium dodecyl sulfate (SDS), washed with 2x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% SDS at room temperature, and then washed with 0.2x SSC-0.1% SDS at 65°C for 35 to 60 min. Northern (RNA) blot analysis. HeLa cells were transfected with pCMV-CAT or with IR-containing derivatives, and total cellular poly(A)+ RNA was affinity purified by an oligo(dT)-cellulose batch technique (8). RNA samples were electrophoresed on neutral 1% agarose-formaldehyde gels and transferred to nitrocellulose membranes as described previously (44). Dried membranes were prehybridized for 3 to 6 h at 42°C with a solution containing 50% formamide, 5 x SSC, 4x Denhardt's solution, 0.1% SDS, and 20 mM sodium phosphate, pH 6.5. Filters were hybridized overnight at 42°C, using a 5' CAT oligonucleotide probe with a sequence complementary to the first 96 nt of the CAT message and 20 nonpairing bases: 5'-GGTACATTGAGCAACTGACTGAA ATGCCTCAAAATGTTCTTTACGATGCCATTGGGATA TATCAACGGTGGTATATCCAGTGATTTTTTTCTCCAT AAATCGAAGGAATCGAGGAC-3'; the probe was 5' end labeled with _y32p (7) to a specific activity of 5 x 107 to 1 x 108 cpm/,Lg of probe, and 4 x 106 to 10 x 106 cpm/ml of hybridization solution was used to detect CAT RNA. Filters were washed with 2x SSC-0.1% SDS at room temperature and then with 0.2% SSC-0.1% SDS at 60°C for 45 min. Following autoradiography, membranes were stripped by heating in water at 85°C for 30 min, rehybridized with a 5'-end-labeled HIV-1 probe complementary to nt 713 to 794 of pNL43, and subjected to autoradiography. S1 nuclease digestion analysis. HeLa cells were cotransfected with CAT-containing plasmids and the internal control P-globin expression plasmid pAL4-SV; 24 to 48 h following transfection, cells were lysed in buffer containing 0.5% Nonidet P-40, 20 mM vanadyl riboside complex, 10 mM Tris (pH 7.6), and 10 mM NaCl, and nuclear and cytoplasmic fractions were prepared (31). RNA was purified from each fraction by the guanidinium isothiocyanate method (10, 11) and hybridized to 0.1 x 106 to 1 x 106 cpm of each 5'-end-labeled oligonucleotide probe at 56°C, using an aqueous hybridization technique (5). The sequences of the probes were as follows: 3' CAT probe, 5'-GGCATTCC ACCACTGCTCCCATTCATCAGTTCCATAGGTTGGA ATCTAAAATACACAAACAATTAGAATGTCATCAAA
HIV-1 gaglpol INHIBITORY SEQUENCES
VOL. 65, 1991
TT-3'; and 3' ,B-globin probe, 5'-CAGCACAATAACCAGC ACGTTGCCCAGGAGCTGTAGGAAAATCTTCTTCCG3'. The sequence of the 5' CAT probe is given above. Samples were digested as described previously (5), using 250 U of Si nuclease at room temperature for 30 min (5' CAT and 3' P-globin probes) or 500 U of S1 nuclease at 37°C for 60 min (3' CAT probe). Following digestion, samples were ethanol precipitated and electrophoresed on denaturing 8% acrylamide gels; gels were dried and subjected to autoradiography. Immunoblot analysis. Transfected cells were lysed in 100 ,ul of lysis buffer {50 mM Tris HCl (pH 8.0), 5 mM EDTA, 100 mM NaCl, 0.2% deoxycholate, 0.5% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate}, and proteins were electrophoretically separated on 12.5% SDSpolyacrylamide gels as described previously (49). Proteins were transferred onto nitrocellulose membranes in the BioRad Western immunoblot apparatus by electroblotting at 150 mA overnight. Membranes were blocked in TN buffer (10 mM Tris HCl [pH 7.4], 150 mM NaCl) containing 5% dry milk and washed in TN-T buffer (10 mM Tris HCl [pH 7.4], 150 mM NaCl, 0.3% Tween 20). Membranes were incubated for 3 h with detergent-treated plasma from a HIV-1-seropositive individual diluted 1:1,000 in TN-T buffer containing 3% bovine serum albumin (BSA), washed sequentially in TN-TN buffer (TN-T buffer including 0.05% Nonidet P-40) and TN-T buffer, incubated for 1.5 h with [125I]protein A diluted (0.1 ,uCi/ml) in TN-T/3% BSA, and then washed in TN-TN containing 10 mM EDTA and in TN buffer. The membranes were air dried and subjected to autoradiography. RESULTS Intragenic sequences inhibit gaglpol expression. To identify potentially inhibitory elements present in the HIV-1 gaglpol region, we constructed two subgenomic plasmids which contain gaglpol sequences but lack a functional rev gene and the RRE sequence (Fig. 1B). pNLenv-4 encodes the entire gag and pol genes, while pNLenv-6 encodes a portion of the gaglpol region, truncated within reverse transcriptase-coding sequences, which eliminates all known HIV splice acceptor sites, thereby preventing splicing of potentially inhibitory gag sequences from RNA transcripts. Subgenomic constructs of HIV proviral DNA and the wild-type infectious clone, pNL43, were independently transfected into SW480 cells, and transient expression of viral proteins was analyzed by Western blotting. As shown in Fig. 1A, high levels of gpl60e,v, p55gag, p24gag, and p17gag were detectable in cells transfected with pNL43. Transfection of the clone pNLenv-1 (Fig. 1B), which is identical to pNL43 but is replication incompetent because of a deletion in the env gene, exhibited the same protein profile except that gpl6Oenv was missing (Fig. 1A, pNLenv-1). Removal of the RRE and the rev gene coding sequence in pNLenv-4 completely inhibited HIV-1 gag and env expression as monitored by immunoblotting (Fig. 1A, pNLenv-4). Transfection of pNLenv-6, in which all known splice acceptors and most of the HIV-1 coding sequence except the gag gene had been removed, resulted in the synthesis of very low levels of p55gag (Fig. 1A, pNLenv-6). The inefficiency of gag expression from pNLenv-6 suggests that the gaglpol region itself contained sequences inhibitory for rev-independent
expression. Construction and assay of a reporter plasmid to detect inhibitory sequences. To investigate the presence and locations of possible inhibitory sequences within the HIV-1 gag
5735
A. 5' LTR
X Li
3!
SA SA
-
TAT
LTR
PoIaaykt-on
8887
.:[9-
-r-
S-g-,
-UT
.
BssH Sma nKer
CAT act vi:y
B.
24
hl foliownsg rans'ect.or, -
pTS-7 caciurn phosptate
transtection CAT.........
.CAT
TAT CAT
-LTR. . . ...---... ..
1.3-diacetate CM
*
3-acetate CM
.#
- l-acetate CM
*'--_
--V. TR
0. Mock
-CM pTS-7
FIG. 2. Construction and assay of a tat reporter gene plasmid. (A) tat reporter plasmid pTS-7. The coding sequence for the first 66 amino acids of tat was inserted between the HIV-1 5' and 3' LTRs of pNL43 as described in Materials and Methods. There are no known splice donor sequences present; two described splice acceptor sites (SA) remain. The tat initiator methionine codon is the first AUG from the 5' end of the transcripts. (B) Reporter gene assay. HeLa 3T1 cells were transfected with 1.5 pmol of pTS-7 DNA or were mock transfected. Cell lysates prepared 24 to 48 h following transfection were assayed for CAT activity in a 1-h assay, and the reaction products were separated by thin-layer chromatography. An overnight exposure of the autoradiogram is presented. The positions of nonacetylated chloramphenicol (CM) and of 1- and 3-monoacetylated and 1,3-diacetylated derivatives are indicated.
and pol genes, a sensitive assay using tat as a reporter gene was developed. In this construct, tat is under the control of the HIV-1 promoter; its expression is feedback stimulated as a result of the transactivating effect of newly synthesized Tat protein on the HIV promoter. Because feedback stimulation magnifies relatively low levels of tat expression, only sequences with strong inhibitory effect should be detectable. This tat reporter plasmid, pTS-7, was constructed by inserting the nucleotide sequence encoding the first 66 amino acids of tat, which retain full transactivating potential (46), between the HIV-1 5' and 3' LTR sequences (Fig. 2A). tat expression was measured in transient expression assays of pTS-7 in the HeLa 3T1 cell line (19), which contains an integrated copy of the HIV-1 LTR-driven CAT gene. In the absence of tat, negligible CAT activity was detected (Fig. 2B, Mock). In contrast, assay of lysates of HeLa 3T1 cells transfected with pTS-7 revealed nearly complete acetylation of chloramphenicol (Fig. 2B, pTS-7) in a 1-h reaction, indicating that pTS-7 directs the synthesis of high levels of Tat. By comparing CAT activity during linear chloramphenicol acetylation as a function of time, a 600- to 700-fold stimulation of activity by pTS-7 over the activity of mocktransfected cultures was consistently detected. HIV-1 gag and pol genes contain inhibitory sequences. pTS-7 was used as a reporter gene to detect cis-acting inhibitory sequences by cloning portions of the HIV-1 proviral DNA between the tat reporter sequence and the polyadenylation signal. Any possible expression of the downstream tat gene was prevented by introduction of stop codons into these sequences, as detailed in Materials and
5736
J. VIROL.
MALDARELLI ET AL.
A
S
MOCK
B
9s.
9
pTS-1
pTS-5
S
pTS-8
pTS-6
x
_,ev
gag
pTS-1
CC:
pTS-5
TAT
RI-2
TAT
i
2619
pTS-6
7
_
TAT
1
4551
JR-i
v fI- .[ 2006 --
pTS-8 LI
!-IR-1
. TATL-i
-----
L
I
IR-2
FIG. 3. (A) Identification of two inhibitory regions within the HIV-1 gaglpol genes. HeLa 3T1 cells were transfected with indicated tat reporter plasmids or were mock transfected; CAT activity was determined on aliquots of cell lysates containing an equivalent amount of protein in a 15-min reaction; a 6-h exposure of the chromatogram is presented. Each construct was assayed at least five independent times, and a typical experiment is presented. (B) Structures of pTS-7-derived plasmids containing HIV-1 sequences. pTS-1 contains the HIV-1 sequence from nt 711 to the 3' end inserted downstream of the tat reporter gene; pTS-5 contains a deletion of 1,932 nt from within the pol sequence; pTS-6 contains a 1,295-nt deletion of the gag gene; pTS-8 contains both of these deletions. The internal tat gene (black rectangle) and the major splice donor have been mutated as described in Materials and Methods.
Methods. For the initial screening, the entire HIV-1 coding sequence was introduced downstream of the tat reporter gene (Fig. 3, pTS-1); splicing of gaglpol sequences from the tat reporter gene was suppressed by mutating the major splice donor site located upstream of the start of the gag gene. This splice site mutation has the additional effect of inhibiting expression of downstream genes, because the first consensus splice donor is located at nt 4962, which is 4,307 nt downstream from the mRNA start site. Transient expression studies revealed that the introduction of a nearly full length copy of proviral DNA downstream of the reporter tat gene completely blocked its expression (Fig. 3A, pTS-1). Similarly, no tat expression was detected following the removal of a 1,932-nt fragment from the pol region of pTS-1 (Fig. 3A, pTS-5). Deletion of a 1,295-nt portion of the gag gene resulted in a minor (fivefold) increase in CAT activity, suggesting that a small amount of tat expression had occurred (Fig. 3A, pTS-6). In contrast, a construct in which both the 1,932 nt from the pol region and the 1,295 nt from the gag gene were deleted resulted in a more than 150-fold increase in CAT activity (Fig. 3A, pTS-8). These findings identify the presence of two noncontiguous inhibitory regions, designated IR-1 and IR-2, in the gag and pol genes of HIV-1; the presence of either segment
in the context of the HIV-1 coding sequence was sufficient to suppress tat expression. To further delineate the inhibitory sequences within IR-1 and IR-2, a series of deletion mutants was constructed and the effect on tat expression was determined. As shown in Fig. 4, the most significant inhibitory effects of IR-1 sequences were observed with pTS-23, pTS-24, and pTS-25. Expansion of the deletion in the 3' direction in pTS-24 resulted in a complete loss of inhibitory activity (pTS-21 and pTS-22), while removal of 294 nt from the 3' end of IR-1 in pTS-24 (pTS-711) reduced but did not eliminate the inhibitory effect. Deletions from the 5' and 3' ends of the insert in pTS-25 showed reduced but detectable inhibition of tat expression (Fig. 4, pTS-74). The 5' 127 nt of IR-1, which contains the splice donor mutation, had no inhibitory activity (pTS-75). Constructs containing part of the central region shared by pTS-24 and pTS-25 lacked any inhibitory activity (pTS-26). Taken together, these data suggest that IR-1 contains multiple sequences, each with a relatively weak inhibitory effect, e.g., from nt 838 to 1272 (pTS-74) and 1272 to 1711 (pTS-711), which when present together (pTS-2) exert a strong and additive inhibitory effect. Alternatively, the inhibition observed may require a large, centrally located sequence with a specific conformational structure, which
HIV-1 gaglpol INHIBITORY SEQUENCES
VOL. 65, 1991
Fold Inhibition
IR-1 I Ia
TAT
I
pl7gag
I_
5737
p24 gag
p15gag
pTS-2
12.8
pTS-21
1.0 1.3
1507 I.-
.,-
'.
:-
'.
'.
-
:. .,. '.
:. :. :.
:
:
1443
_.. -
-
:. :.
-
:
=-7_
--`
....................................a
1272
r--
1712
=2m
1145
1415
=00
r--
838
1272
pTS-24
16.0 pTS-711 4.0 - pTS-26 0.7 pTS-74 4.8
;;;No 1507 -
1443
I-::
.-
.-77--7
.08
838
-
r-
IR-2
r--
3826
;;no ,-
,=,,-.=
,
2006
2619
2006
2619 2887
;=m
T--
pTS-75
1.0
-
2619
9
10.4 21.0
.; pTS-61 35.8 pTS-62 7.2 - pTS-63 1.1 - pTS-64 16.5
3826
:am
r-
pTS-25 pTS-23
,
;am 2006
pTS-22
3826
FIG. 4. Deletional analysis of gaglpol IR-1 and IR-2. Plasmids were constructed to contain the HIV IR-1 or IR-2 sequence indicated by the shaded inserts downstream of the tat reporter gene. Cloned DNAs were cotransfected with pSV2-luciferase for internal standardization into HeLa 3T1 cells. CAT assays were performed on aliquots of cell lysates containing equivalent amounts of luciferase activity. For each sample, the percentage of chloramphenicol acetylation compared with that of the positive control (pTS-7) was determined and the fold inhibition was calculated. The results of typical experiments are presented. Numbers refer to nucleotide positions in the infectious molecular clone pNL43. Inserts are shaded according to the degree of their inhibition.
may not be intact or fully functional in the smaller constructs pTS-74, -26, and -711. The IR-2 region was similarly studied by analyzing the inhibitory activity of subfragments in the pTS-7 reporter plasmid. A construct, pTS-61, lacks the 3' 725 bp of IR-2 as defined in Fig. 3 and contains an additional 613 bp at the 5' end (Fig. 4). Analysis of this construct revealed a 36-fold inhibition of CAT activity compared with that observed with the parental reporter plasmid, pTS-7. No inhibitory activity was detected in the 613-nt segment in an independent test (Fig. 4, pTS-63); however, deletion of that sequence from pTS-61 reduced the inhibitory effect about fivefold (Fig. 4, pTS-62). In addition, an internal 268-nt deletion of pTS-61 (pTS-64) reduced the inhibitory effect approximately twofold and had therefore less of an effect than the 5' deletion in pTS-62. These findings suggest a role for the primary sequence or a secondary structural requirement in the inhibitory effect of IR-2. Splice donor or acceptor sites do not alter the inhibitory
effects of IR-1 sequences. Several reports have addressed a potential effect of the presence of splice sites on the levels of
from reporter plasmids in eukaryotic systems. Therefore, we constructed an additional series of plasmids to investigate the effects of splice site sequences on the expression of IR-1-containing reporter plasmids. As the basic construct, we chose pTS-25 (Fig. 4). Introduction of a splice acceptor sequence downstream of inhibitory se-
gene expression
quences in the absence of a splice donor site had no effect on inhibition of tat expression (Fig. 5, pTS-251), which was still 13.5-fold compared with that obtained with pTS-7. The further addition of an upstream splice donor sequence, which enclosed the inhibitory region between splice donor and acceptor sites, abolished the inhibitory effect and resulted in tat expression equivalent to that obtained from pTS-7 (Fig. 5, pTA-251). Elimination of a splice acceptor site from pTA-251, resulting in plasmid pTA-25, resulted in weak but consistently detectable inhibition (Fig. 5, pTA-25). Elimination of the inhibitory activity of pTS-25 by flanking the putative responsible sequences between splice donor and acceptor sites strongly suggests that splicing removes this element, resulting in high levels of tat expression. It is possible that the relatively modest (threefold) inhibition seen
5738
J. VIROL.
MALDARELLI ET AL.
IR-1 -containing Construct TAT
SD
pTS-251
Fold Inhibition
IR-1
E
pTS-25
Summary IR-1 SA
X
m 1507
-
+
-
10.4
-
+
+
13.5
+
+
+
1.3
+
+
-
2.9
8887
_ "466
j
pTA-251
8465
E1
pTA-25
_
1
FIG. 5. Individual splice sites do not alter the inhibitory effect of IR-1. Plasmids were constructed with no consensus sequences for splice sites (pTS-25), with a single splice acceptor 3' to the IR-containing sequence (pTS-251), with splice donor and acceptor sequences flanking IR-1 (pTA-251), or with a single splice donor sequence 5' to the IR-containing sequence (pTA-25). The presence of splice donor (SD; r ), splice acceptor (SA; 41 ), and inhibitory sequences (dark boxes) are indicated in the diagram and summarized in the table. Transfections and CAT assays were performed, and results are presented as in Fig. 4.
with pTA-25 reflects the presence of an inefficient and cryptic splice acceptor within IR-1 sequences, allowing it to be removed by splicing in some of the transcripts and resulting in low levels of tat expression. IR sequences inhibit expression of a heterologous reporter gene. To determine whether an HIV-1 gaglpol sequence would function as an inhibitory sequence in the context of a heterologous promoter and reporter gene, IR-1-containing sequences were introduced into the CMV promoter-driven
CAT expression vector pCMV-CAT (Fig. 6). Levels of expression of pCMV-CAT and derivatives containing the IR-1 sequences were compared by transient assay in HeLa cells. Introduction of the entire IR-1 element into pCMVCAT resulted in a 58-fold reduction of CAT activity compared with that for pCMV-CAT (Fig. 6, pCMV-2). This inhibitory effect was largely orientation dependent, since only a threefold reduction in CAT activity was detected when the IR-1 element was inserted in the opposite orientaFold
CAT Construct
IR-1 inse3rt
SV40
Designation
Inhibition
pCMV-2
58.5
pCMV-2i
3.1
pCMV-22
1.9
pCMV-711
17.5
pCMV-26
3.7
pCMV-23
77.0
SV40
PtIyA W
ndthrwon
1
I
It= 2006
;LiLiziz.
X
LlzI zz==
2006
1272
. .11-
1
4.
114S
E
5.
-i
1
1415
.-.M
r---l 1443
PCMV-CAT
1.0
FIG. 6. Evidence that IR elements function as inhibitory sequences in a heterologous reporter gene. Subclones of pCMV-CAT were prepared by introducing IR-1 sequences as indicated into a HpaI site 3' to the simian virus 40 (SV40) small-t splice site. DNA (4.5 pmol) of each construct was cotransfected with the internal control pSV2-luciferase into HeLa cells; CAT assays were performed on aliquots of cell lysates containing equivalent amounts of luciferase activity. To determine fold inhibition, the percentage of acetylation was determined and compared with that in assays of lysates of cells transfected with pCMV-CAT. The results of typical experiments are presented.
HIV-1 gaglpol INHIBITORY SEQUENCES
VOL. 65, 1991
B
A 1 cm1
I'
IIcma !a
0 00
A.
MOCK
CMV-CAT
CMV-2
_
-
CMV-2i
5739
CMV-3
_am
1:1 1:3
1:9
1:27 1:81
28 S
18 S
-p
--
FIG. 7. Northern blot analysis of CAT transcripts. (A) Poly(A)+ RNA was prepared from HeLa cells transfected with pCMV-CAT, pCMV-2, or pCMV-2i, separated on neutral formaldehyde-1% agarose gels, transferred to nitrocellulose membranes, probed with a 5'-end-labeled oligonucleotide complementary to the first 96 nt of the CAT-coding sequence, and subjected to autoradiography. (B) Membranes were stripped and then rehybridized to a singlestranded HIV-specific probe as described in Materials and Methods. Migration of 18S and 28S RNA markers is indicated at the left.
tion (pCMV-2i). Additional constructs containing portions of the IR-1 were also assayed. Sequences with detectable inhibitory activity in the tat reporter system, such as pTS711 and pTS-23, also were inhibitory when introduced into pCMV-CAT (Fig. 6, pCMV-711 and pCMV-23). Constructs with no inhibitory effect in the tat reporter system, such as pTS-22 and pTS-26, exhibited minimal inhibition of CAT activity when introduced into pCMV-CAT (Fig. 6, pCMV-22 and pCMV-26, respectively). These data demonstrate that the inhibitory effect of IR sequences was not unique to the HIV promoter-driven tat reporter gene but could function in the context of a heterologous promoter as well. The IR-1 sequence was also introduced into a site 735 nt upstream from the start of the CAT mRNA; analysis of this clone, pCMV-3, revealed no inhibition of CAT activity (data not shown), indicating that this DNA segment did not function as a DNA silencer element in plasmid pCMV-CAT. IR-induced inhibition of gene expression is a posttranscriptional event. To determine whether HIV inhibitory sequences affected a transcriptional or posttranscriptional step in reporter gene expression, the presence and relative size of CAT mRNA was analyzed by Northern blotting; whole cell preparations of poly(A)-selected RNA were separated on formaldehyde-agarose gels and transferred to nitrocellulose, and the CAT RNA was detected with an oligonucleotide probe complementary to the 5' portion of the CAT-coding sequence. As shown in Fig. 7, CAT transcripts were present in cells transfected with the parental pCMV-CAT or with derivatives containing the IR-1 sequence in the inhibitory (pCMV-2) or noninhibitory (pCMV-2i) orientation (Fig. 7A). The parental CMV-CAT transcript was present as a species of approximately 1.7 kb, while the CMV-2 transcript was identified as a principal band of approximately 3 kb. The increase in the size of this CAT transcript corresponds to the additional 1,295 nt present in the IR-1 sequence, which was identified on the CAT message by using an oligonucleotide probe complementary to the IR-1 insertion (Fig. 7B, CMV-
3-actin _ B. 4m 4 am FIG. 8. Slot blot analysis of CAT RNA in transfected HeLa cells. HeLa cells were transfected with pCMV-CAT, with the IR-1-containing derivative pCMV-2 or pCMV-2i, or with pCMV-3, which contains the IR-1 sequence upstream of the CMV promoter and mRNA start site, and total RNA was prepared as described in the text. Serial threefold dilutions were applied to nitrocellulose filters by using a slot blot apparatus, and CAT-specific RNA was detected by hybridization to a single-stranded, uniformly labeled probe complementary to the 5' portion of the CAT gene. The first dilution contained 27% of the total RNA from a T-25 flask. As an internal control, an aliquot containing 8% of the total RNA from the transfected cells was applied to nitrocellulose filters and hybridized to a uniformly labeled P-actin probe. Exposure times were normalized to that for the P-actin signal.
2). No low-molecular-weight CAT RNA species were identified in RNA preparations from pCMV-2-transfected cells, suggesting that the introduction of the IR-1 sequence in the inhibitory orientation did not result in truncated or aberrantly spliced transcripts. A minor additional transcript was identified in cells transfected with pCMV-2i, which is slightly shorter than the intact CAT message (Fig. 7A, CMV-2i); the significance of this transcript is unclear, since the CAT activity detected from this construct is similar to that of the parental pCMV-CAT (Fig. 6). As expected, none of the CMV-2i transcripts (containing IR sequences in the reverse orientation) hybridized to the single-stranded oligonucleotide probe complementary to the HIV sense strand (Fig. 7B, CMV-2i). Steady-state levels of CAT RNA were quantitated by slot blot analysis of total cellular RNA; comparable levels of CAT RNA were identified in cells transfected with pCMV-CAT, CMV-2, CMV-2i, or pCMV-3, which contains the IR-1 upstream of the CMV promoter and the RNA start site (Fig. 8). These findings indicate that the presence of the IR-1 sequence in the inhibitory orientation did not affect steady-state levels of total cell CAT mRNAs. The intracellular distribution and splicing pattern of CAT RNA was investigated by comparing relative levels of spliced and unspliced RNA in nuclear and cytoplasmic fractions in quantitative S1 digestion studies. The parental plasmid pCMV-CAT and IR-containing derivatives used in these studies contain a single intron, the 66-nt simian virus 40 small-t intron. To detect unspliced and spliced mRNA from these constructs, we used a 5'-end-labeled oligonucleotide probe complementary to the sequence spanning the 3' splice acceptor of the small-t intron (Fig. 9A). To internally control for transfection efficiency, the 3-globin expression plasmid pAL4-SV (9) was cotransfected with the CAT constructs. Nuclear and cytoplasmic fractions were prepared from transfected cells by a Nonidet P-40 lysis procedure (31); RNA purified from each fraction was hybridized to oligonucleotide probes and digested with S1 nuclease. A large proportion of CAT RNA transcribed from pCMV-CAT was found in the cytoplasm as a spliced transcript (Fig. 9A, pCMV-CAT). In contrast, the CAT RNA containing the IR-1
5740
J. VIROL.
MALDARELLI ET AL. CMV-CAT CMV-2 CMV-2i
A.
|. v
L
P obe
"
Jnsoliced
-
Spiiced
"
1]
| v.| > |I.|
°I
0
mRNA ATG
CAT coding
sequence
CMV
small-, intron
IR-1 ir%suc1on
B.
CMV-CAT
z
P
-I
Spliced
d
SV-40
CMV-2i
i-Io)
2
U
L)
c
I
ODe
Unspliced
mRNA
CMV-2
-.
_
(A)n exon
llexon2!e2on _
3
Inlron 2
FIG. 9. Intracellular distribution of CAT transcripts. HeLa cells were transfected with pCMV-CAT or the IR-containing derivatives pCMV-2 and pCMV2i; as an internal control for transfection efficiency, the P-globin-expressing plasmid pAL4-SV was cotransfected. Nuclear (Nucl.) and cytoplasmic (Cyto.) RNAs were prepared as described in the text. (A) RNA was hybridized to the 3' portion of the CAT message spanning the small-t intron splice acceptor (80-nt probe; 69 nt protected by unspliced RNA and 45 nt protected by spliced RNA). (B) RNA was hybridized to the 3' portion of the P-globin message spanning the intron 2 splice acceptor (51-nt probe; 41 nt protected by unspliced RNA and 30 nt protected by spliced RNA). Si digests were performed as described in Materials and Methods; the products were electrophoresed on denaturing 8% acrylamide gels and visualized by autoradiography. The positions of the probes and sizes of the fragments protected are indicated; noncomplementary portions of the probe are denoted by bold lines, and hybridizing sequences are represented by blocks. Exposure times were normalized to that for the B-globin signal. SV-40, simian virus 40. sequence in the inhibitory orientation accumulated in the nucleus of transfected cells; only small amounts of CAT RNA were detectable in the cytoplasm (Fig. 9A, pCMV-2). The majority of the CAT IR-1 RNA was present in the nucleus primarily as a spliced transcript, demonstrating that the presence of the IR-1 element did not prevent splicing (Fig. 9A, pCMV-2). The distribution of pCMV-2i transcripts, which contain the IR-1 sequence in a noninhibitory orientation, was similar to that detected for pCMV-CAT, with spliced mRNA present in the cytoplasm (Fig. 9A, pCMV-2i). These data indicate that the presence of IR-1 in the inhibitory orientation resulted in retention of CAT transcripts in the nucleus without inhibiting splicing of the RNA. In all instances, transcripts made from the cotransfected control ,-globin plasmid were detected primarily in the cytoplasm as spliced mRNAs (Fig. 9B), demonstrating that the IR-1 sequence did not affect intracellular distribution or the splicing of an unrelated RNA in trans.
DISCUSSION Alternative splicing of HIV-1 mRNA results in the expression of the full complement of HIV-1 genes from a single 5'
promoter. Regulation of HIV-1 RNA processing absolutely requires the product of the HIV-1 rev gene to express full-length and singly spliced mRNAs (16, 22, 37, 38). The nature of this interaction and the mechanism by which it regulates HIV-1 RNA processing are not known. While the
RRE has been demonstrated
as
the binding site for Rev, the
presence of the RRE alone appears to be insufficient to make a gene rev responsive, and an additional requirement for
splice site and intron recognition has been suggested from transient expression studies using env-expressing plasmids or recombinant reporter constructs (9, 36). For example, in studies by Chang and Sharp (9), introduction of the RRE sequence into the intervening sequence 2 intron of the ,-globin reporter gene did not increase levels of unspliced ,B-globin RNA expressed in the cytoplasm even in the presence of rev; only when the ,-globin consensus splice donor or acceptor sites were mutated to suboptimal splice sites or were replaced by a corresponding HIV-1 splice site did expression of the construct become rev responsive (9). No rev responsiveness was detected in expression of an intronless thymidine kinase-RRE recombinant plasmid (9). Furthermore, Lu and coworkers (36) reported that mutation
VOL. 65, 1991
of the 5' splice donor abolished env expression even in the presence of Rev, and the authors concluded the presence of a 5' splice site was critical to rev responsiveness. In contrast, however, several other groups have reported rev responsiveness in env expression plasmids and RRE-containing CAT and growth hormone reporter genes which do not contain any known splice sites (32, 43). As suggested by Chang and Sharp (9), this discrepancy may be due to the presence of cryptic splice signals in the plasmids presumed to be intronless, although such cryptic splice sites remain to be identified. Other cis-acting sequence elements which inhibit gene expression have been identified within the HIV genome, although their relevance for HIV replication, and in particular for rev-regulated gene expression, remains unknown. For example, Rosen and coworkers, using recombinant CAT-env constructs, identified several CRS elements which are distinct from the RRE within the env gene; removal of these elements increased basal CAT activity 10-fold and decreased rev responsiveness 3-fold in HeLa and CHO cell lines (43). On the other hand, Malim and coworkers, using an env reporter gene, did not detect any difference in basal transcription or rev responsiveness in COS cells after the CRS elements were removed (38). The presence of inhibitory elements in gag and pol gene sequences has been inferred from the expression studies of HIV-1 subviral constructs by Dayton and coworkers (13) and Hadzopoulou-Cladaras et al. (22), who detected no expression of gaglpol unless the RRE was present in cis and the rev gene product was supplied in trans. In this report, communication, we describe a tat-based reporter plasmid, pTS-7, used to identify cis-acting inhibitory sequences within the HIV-1 gag and pol genes. cis-acting elements may alter expression in a promoter-specific manner (3) and can have unpredictable effects on splicing patterns (24, 26). As an alternative to the standard, non-HIV reporter plasmids, pTS-7 was constructed as an HIV LTR-driven, rev-independent reporter plasmid. Two specific sequences, IR-1 and IR-2, were identified in the HIV-1 gag and pol genes, respectively, which reduced tat expression 10- to 36-fold, indicating the presence of strongly inhibitory sequences which were capable of suppressing tat expression. We did not detect the effects of other previously described HIV-1 cis-acting sequences, such as the CRS in env (43), which are located in intron sequences in our test plasmids and would be most likely removed by splicing. We are currently applying the tat reporter system to investigate other regulatory sequences present in HIV-1. The inhibitory effect of the IR family of sequences is a posttranscriptional event; IR-containing CAT mRNA species were polyadenylated and present in levels comparable to those of CAT mRNA alone (Fig. 7). Quantitative Si analyses indicated that the presence of the IR-1 sequence in the inhibitory orientation resulted in the exclusion of CAT mRNA from the cytoplasm, while spliced and unspliced IR-containing mRNA accumulated in the nucleus of cells transfected with pCMV-2 (Fig. 9). This finding suggests that IR-1 contains a signal that leads to nuclear retention without interfering with utilization of the small-t splice acceptor, as reflected in a large decrease in cytoplasmic RNA. The precise sequence or structural determinants within the IR segments responsible for cis inhibition are not known, although IR-1-induced inhibition was orientation dependent (Fig. 6, pCMV-2 and pCMV-2i). Analyses of computergenerated secondary structures (28) did not identify any common stable structures among the folding patterns of the
HIV-1 gaglpol INHIBITORY SEQUENCES
5741
IR RNAs; as expected, multiple stem-loop structures were predicted, and further investigation is required to determine the actual folded structures of these regions and their possible role in inhibition. The observation that IR-1 and IR-2 show a more pronounced effect in the context of the entire HIV-1 coding sequence (150-fold for pTS-1) than when analyzed as isolated segments (13- and 36-fold for pTS-2 and pTS-61, respectively) is compatible with defined secondary structures whose formation may be influenced by surrounding sequences. However, we cannot exclude the possibility of a position effect or an interaction of IR elements with additional, as yet undefined sequences which could enhance the inhibitory activity. We are currently investigating the mechanism of this cis inhibition; in particular, we are testing whether the presence of IR-1 or IR-2 can confer rev responsiveness to a plasmid containing an RRE sequence. Inhibitory sequences in HIV-1 gag and pol genes described in this work were identified by using subconstructs of the pNL43 infectious molecular clone of HIV-1 (Fig. 1). Although we demonstrated that these sequences also function in the context of the entire viral genome (Fig. 3), the direct analysis in the context of a replication-competent, full-length HIV-1 provirus is complicated by the fact that IR elements include coding sequences of virion structural proteins. Thus, changes in IR sequences would in most cases affect protein sequences as well, which in turn could affect the replication potential of such mutants. Furthermore, the complexity of HIV gene regulation would preclude an unequivocal characterization of IR elements in a replicationcompetent system. Nevertheless, even though our results of studies with reporter genes do not strictly imply a role for IR sequences in the regulation of HIV-1 gene expression, our ability to demonstrate inhibitory activity of IR elements in two independent test systems suggests that the results obtained are not a peculiarity of the test system used but an inherent property of the sequence elements. Expression studies of a number of viral and cellular genes have identified cis-acting sequences which affect processing of RNA transcripts (4, 12, 24, 27, 29, 34, 50, 51), and our speculation is that IR sequences may similarly influence HIV-1 gene expression, either early or late in the infectious cycle. Early in the HIV infectious cycle, tat is absolutely required to transactivate the HIV LTR and stimulate transcription. tat is produced from a multiply spliced mRNA, but since many of the splice site sequences and polypyrimidine tracts associated with HIV splice sites may be functionally suboptimal, splice site recognition may be a slow process. IR-induced nuclear sequestration of HIV mRNA may increase the probability that splicing events occur, thereby ensuring tat expression. During the later stages of replication, a prolonged nuclear half-life may facilitate interaction of the rev gene product with the RRE sequence and ensure expression of the HIV products required for virion assembly: full-length HIV RNA, virus-encoded enzymes, and virion structural proteins. ACKNOWLEDGMENTS We are indebted to Ronald Willey, Francois Clavel, Nafees Ahmad, Phillip Sharp, Suresh Subramani, John Semmes, and KuanTeh Jeang for providing plasmids and to Alicia Buckler-White for sequencing and oligonucleotide synthesis. We thank Charles Buckler for computer assistance. REFERENCES 1. Adachi, A., H. E. Gendelman, S. Koenig, T. Folks, R. Willey, A. Rabson, and M. A. Martin. 1986. Production of acquired immu-
5742
J. VIROL.
MALDARELLI ET AL.
nodeficiency syndrome-associated retrovirus in human and non2. 3. 4. 5.
6. 7. 8. 9.
10.
11. 12.
13.
14. 15.
16.
17.
18.
19. 20.
21.
human cells transfected with an infectious molecular clone. J. Virol. 59:284-291. Ahmad, N., and S. Venkatesan. 1988. Nef protein of HIV-1 is a transcriptional repressor of HIV-1 LTR. Science 241:14811485. Alam, J., and J. L. Cook. 1990. Reporter genes: application to the study of mammalian gene transcription. Anal. Biochem. 188:245-254. Arrigo, S., and K. Beemon. 1988. Regulation of Rous sarcoma virus RNA splicing and stability. Mol. Cell. Biol. 8:4858-4867. Berk, A. J. 1989. Characterization of RNA molecules by S1 nuclease analysis. Methods Enzymol. 180:334-347. Berkhout, B., R. H. Silverman, and K.-T. Jeang. 1989. Tat transactivates the human immunodeficiency virus through a nascent RNA target. Cell 59:273-282. Boorstein, W. R., and E. A. Craig. 1989. Primer extension analysis of RNA. Methods Enzymol. 180:347-369. Bradley, J. E., G. A. Bishop, T. St. John, and J. A. Frelinger. 1988. A simple rapid method for the purification of poly A+ RNA. BioTechniques 6:114-116. Chang, D. D., and P. A. Sharp. 1989. Regulation of HIV rev depends upon recognition of splice sites. Cell 59:789-795. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:52945299. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159. Cullen, B. R., J. J. Kopchick, and D. W. Stacey. 1982. Effect of intron size on splicing efficiency in retroviral transcripts. Nucleic Acids Res. 10:6177-6190. Dayton, A. I., E. F. Terwilliger, J. Potz, M. Kowalski, J. G. Sodroski, and W. A. Haseltine. 1988. Cis-acting sequences responsive to the rev gene product of the human immunodeficiency virus. J. AIDS 1:441-452. Dayton, E., D. Powell, and A. Dayton. 1989. Functional analysis of CAR, the target sequence for the protein of HIV-1. Science 246:1625-1629. Dingwall, C., I. Ernberg, M. J. Gait, S. M. Green, S. Heaphy, J. Karn, A. D. Lowe, M. Singh, M. A. Skinner, and R. Valerio. 1989. Human immunodeficiency virus 1 tat protein binds transactivation-responsive region (TAR) RNA in vitro. Proc. Natl. Acad. Sci. USA 86:6925-6929. Emerman, M., R. Vazeux, and K. Peden. 1989. The rev gene product of the human immunodeficiency virus affects envelopespecific RNA localization. Cell 57:1155-1165. Feinberg, M. B., R. F. Jarrett, A. Aldovini, R. C. Gallo, and F. Wong-Staal. 1986. HTLV-III expression and production involve complex regulation at the levels of splicing and translation of viral RNA. Cell 46:807-817. Felber, B. K., M. Hadzopoulou-Cladaras, C. Cladaras, T. Copeland, and G. N. Pavlakis. 1989. rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNA. Proc. Natl. Acad. Sci. USA 86:1495-1499. Felber, B. K., and G. N. Pavlakis. 1988. A quantitative bioassay for HIV-1 based on trans-activation. Science 239:184-187. Gendelman, H. E., W. Phelps, L. Feigenbaum, J. M. Ostrove, A. Adachi, P. M. Howley, G. Khoury, H. S. Ginsberg, and M. A. Martin. 1986. Trans-activation of the human immunodeficiency virus long terminal repeat sequence by DNA viruses. Proc. Natl. Acad. Sci. USA 83:9759-9763. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.
22. Hadzopoulou-Cladaras, M., B. K. Felber, C. Cladaras, A. Athanassopoulos, A. Tse, and G. N. Pavlakis. 1989. The rev (trslart) protein of human immunodeficiency virus type 1 affects viral mRNA and protein expression via a cis-acting sequence in the env region. J. Virol. 63:1265-1274. 23. Hammarskjold, M.-L., J. Heimer, B. Hammarskjold, I. Sangwan, L. Albert, and D. Rekosh. 1989. Regulation of human
24.
25.
26. 27. 28.
29.
30.
31. 32. 33. 34.
35. 36.
37.
38.
39.
40. 41.
42.
43.
immunodeficiency virus env expression by the rev gene product. J. Virol. 63:1959-1966. Hampson, R. K., L. LaFollette, and F. M. Rottman. 1989. Alternative processing of bovine growth hormone mRNA is influenced by downstream exon sequences. Mol. Cell. Biol. 9:1604-1610. Hauber, J., A. Perkins, E. P. Heimer, and B. R. Cullen. 1987. Trans-activation of human immunodeficiency virus gene expression is mediated by nuclear events. Proc. Natl. Acad. Sci. USA 84:6364-6368. Huang, M. T. F., and C. M. Gorman. 1990. The simian virus 40 small-t intron, present in many common expression vectors, leads to aberrant splicing. Mol. Cell. Biol. 10:1805-1810. Hwang, L.-H. S., J. Park, and E. Gilboa. 1984. Role of introncontained sequences in formation of Moloney murine leukemia virus env mRNA. Mol. Cell. Biol. 4:2289-2297. Jaeger, J. A., D. H. Turner, and M. Zuker. 1990. Predicting optimal and suboptimal secondary structure for RNA. Methods Enzymol. 183:281-306. Joyner, A. L., and A. Bernstein. 1983. Retrovirus transduction: segregation of the viral transforming function and the herpes simplex tk gene in infectious Friend spleen focus-forming virus thymidine kinase vectors. Mol. Cell. Biol. 3:2191-2202. Kao, S.-Y., A. F. Calman, P. A. Luciw, and B. M. Peterlin. 1987. Anti-termination of transcription within the long terminal repeat of HIV-1 by tat gene product. Nature (London) 330:489-493. Kaufman, R. J., and P. A. Sharp. 1982. Construction of a modular dihydrofolate reductase cDNA gene: analysis of signals utilized for efficient expression. Mol. Cell. Biol. 2:1304-1319. Knight, D. M., F. A. Flomerfelt, and J. Ghrayeb. 1987. Expression of the art/trs protein of HIV and study of its role in viral envelope synthesis. Science 236:837-840. Laspia, M. F., A. P. Rice, and M. B. Mathews. 1989. HIV-1 tat protein increases transcriptional initiation and stabilizes elongation. Cell 59:283-292. Libri, D., M. Goux-Pelletan, E. Brody, and M. Y. Fiszman. 1990. Exon as well as intron sequences are cis-regulating elements for the mutually exclusive alternative splicing of the P-tropomyosin gene. Mol. Cell. Biol. 10:5036-5046. Loeken, M. R., G. Khoury, and J. Brady. 1986. Stimulation of the adenovirus E2 promoter by simian virus 40 T antigen or ElA occurs by different mechanisms. Mol. Cell. Biol. 6:2020-2026. Lu, X., J. Heimer, D. Rekosh, and M.-L. Hammarskjold. 1990. Ul small nuclear RNA plays a direct role in the formation of a rev-regulated human immunodeficiency virus env mRNA that remains unspliced. Proc. Nati. Acad. Sci. USA 87:7598-7602. Malim, M. H., J. Hauber, R. Fenrick, and B. R. Cullen. 1988. Immunodeficiency virus rev trans-activator modulates the expression of the viral regulatory genes. Nature (London) 335:181-183. Malim, M. H., J. Hauber, S. Le, J. V. Maizel, and B. R. Cullen. 1989. The HIV-1 rev transactivator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature (London) 338:254-257. Muesing, M., D. Smith, C. Cabradilla, C. Benton, L. Lasky, and D. Capon. 1985. Nucleic acid structure and expression of the human AIDS/lymphadenopathy retrovirus. Nature (London) 313:450-458. Muesing, M. A., D. H. Smith, and D. J. Capon. 1987. Regulation of mRNA accumulation by a human immunodeficiency virus trans-activator protein. Cell 48:691-701. Myers, G., A. B. Rabson, J. A. Berzofsky, T. F. Smith, and F. Wong-Staal (ed.). 1990. Human retroviruses and AIDS 1990. Theoretical biology and biophysics. Los Alamos National Laboratory, Los Alamos, N.M. Nguyen, V. T., M. Morange, and 0. Bensaude. 1988. Firefly luciferase luminescence assays using scintillation counters for quantitation in transfected mammalian cells. Anal. Biochem. 171:404-408. Rosen, C. A., E. Terwilliger, A. Dayton, J. G. Sodroski, and W. A. Haseltine. 1988. Intragenic cis-acting art gene-responsive sequences of the human immunodeficiency virus. Proc. Natl. Acad. Sci. USA 85:2071-2075.
HIV-1 gaglpol INHIBITORY SEQUENCES
VOL. 65, 1991
44. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., p. 10.13-10.26. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 45. Schwartz, S., B. K. Felber, D. M. Benko, E.-M. Fenyo, and G. N. Pavlakis. 1990. Cloning and functional analysis of multiply spliced mRNA species of the human immunodeficiency virus type 1. J. Virol. 64:2519-2529. 46. Seigel, L. J., L. Ratner, S. J. Josephs, D. Derse, M. B. Feinberg, G. R. Reyes, S. J. O'Brien, and F. Wong-Staal. 1986. Transactivation induced by human T-lymphotropic virus type III maps to a viral sequence encoding 58 amino acids and lacks tissue specificity. Virology 148:226-231. 47. Selby, M. J., E. S. Bain, P. A. Luciw, and B. A. Peterlin. 1989. Structure, sequence, and position of the stem-loop in tar determine transcriptional elongation by tat through the HIV-1 long terminal repeat. Genes Dev. 3:547-558. 48. Shapiro, M. B., and P. Senapathy. 1987. RNA splice junctions of different classes of eukaryotes: sequence statistics and func-
5743
tional implications in gene expression. Nucleic Acids Res. 15:7155-7174. 49. Strebel, K., T. Klimkait, F. Maldarelli, and M. A. Martin. 1989. Molecular and biochemical analyses of human immunodeficiency virus type 1 vpu protein. J. Virol. 63:3784-3791. 50. Streuli, M., and H. Saito. 1989. Regulation of tissue-specific alternative splicing: exon-specific cis-elements govern the splicing of leukocyte common antigen pre-mRNA. EMBO J. 8:787796.
51. Stoltzfus, C. M., S. K. Lorenzen, and S. L. Berberich. 1987. Noncoding regions between the env and src genes of Rous sarcoma virus influence splicing efficiency of the src gene 3' splice site. J. Virol. 61:177-184. 52. Thomas, P. S. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77:5201-5205. 53. White, B. A., and F. C. Bancroft. 1982. Cytoplasmic dot hybridization. J. Biol. Chem. 257:8569-8572.
