Identification of three immediate-early genes of white ... - Springer Link

2 downloads 0 Views 260KB Size Report
May 5, 2011 - Identification of three immediate-early genes of white spot syndrome virus. Fanyu Lin • He Huang • Limei Xu •. Fang Li • Feng Yang. Received: ...
Arch Virol (2011) 156:1611–1614 DOI 10.1007/s00705-011-1004-1

BRIEF REPORT

Identification of three immediate-early genes of white spot syndrome virus Fanyu Lin • He Huang • Limei Xu Fang Li • Feng Yang



Received: 20 December 2010 / Accepted: 16 April 2011 / Published online: 5 May 2011 Ó Springer-Verlag 2011

Abstract Viral immediate-early (IE) genes generally encode regulatory proteins that are critical for viral replication. Their transcription, which is independent of de novo viral protein synthesis, is driven directly by host transcription factors. In this study, we examined promoter activities of 12 predicted regulatory genes of white spot syndrome virus (WSSV) belonging to the zinc finger protein family by EGFP-reporter assays in High Five cells. The results showed that the promoters of three genes (wsv056, wsv403 and wsv465) could drive reporter gene expression, and RT-PCR analysis revealed that their expression in WSSV-infected primary crayfish hemocytes was insensitive to the protein synthesis inhibitor cycloheximide (CHX). Therefore, they are IE genes of WSSV. Abbreviations WSSV White spot syndrome virus IE Immediate-early CHX Cycloheximide White spot syndrome virus (WSSV) is one of the most devastating viral pathogens of cultured shrimps. It contains a double-stranded DNA genome of approximately 300 kb,

F. Lin  H. Huang  L. Xu  F. Li (&)  F. Yang (&) Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration (SOA), Xiamen 361005, People’s Republic of China e-mail: [email protected] F. Yang e-mail: [email protected] H. Huang School of Life Science, Xiamen University, Xiamen 361005, People’s Republic of China

which encodes about 180 genes [1]. Based on temporal expression profiles, WSSV genes can be classified into immediate-early (IE), early, and late genes [2]. IE genes are the first class of viral genes expressed after primary infection or reactivation, and they are expressed independently of de novo viral protein synthesis. They often encode regulatory proteins that are critical for the control of downstream viral gene expression and/or modulation of the physiological state of the host cell to support viral replication [3]. Research on WSSV IE genes began in 2005, when three WSSV IE genes, ie1, ie2, and ie3, were identified by microarray analysis [4] from WSSV-infected shrimp. Later, Li et al. reported the identification of another 15 WSSV IE genes using primary cultured crayfish cells as an in vitro infection system [5]. In both reports, microarrays were used to screen for genes whose transcription was insensitive to protein synthesis inhibitors. Although microarrays are useful tools to detect gene expression, some genes that are expressed at low levels or genes with low-affinity probes may show negative results in experiments. Therefore, in this study, an alternative strategy was used to identify WSSV IE genes that might have been overlooked by previous microarray analyses. Our experiments were based on two features of viral IE genes. First, viral IE genes often encode regulatory proteins. Second, their transcription is independent of de novo viral protein synthesis, which means that IE gene transcription is very likely driven by host proteins alone and is insensitive to protein synthesis inhibitors during virus infection. We have noticed that the WSSV China isolate (accession no. AF332093) encodes sixteen proteins containing a C2/H2, C2/C2 or RING-H2 zinc finger motif [6]. The C2/ H2 and C2/C2 motifs are often present in transcription factors [7], while RING finger domains function as ligases

123

1612

F. Lin et al.

Table 1 Information about WSSV IE gene promoters Gene

Promoter

Position in genome (AF332093)

Construct

Primers

Primer sequence (50 –30 )

wsv056

p056

26359-25879

pIZ-p056/EGFP

056p-f

GCGGATCCGGTGGACCGCTGAGTCGA

056p-r

GCCTCGAGTTTTTTGGTTGTTGCTGCTGCTG

wsv063

p063

29541-29078

pIZ-p063/EGFP

wsv166

p166

89502-88981

pIZ-p166/EGFP

wsv184

p184

95271-95743

pIZ-p184/EGFP

wsv199

p199

104341-104737

pIZ-p199/EGFP

wsv222

p222

120541-121099

pIZ-p222/EGFP

wsv303

p303

172691-173161

pIZ-p303/EGFP

wsv403

p403

236201-236660

pIZ-p403/EGFP

wsv465

p465

272898-272424

pIZ-p465/EGFP

wsv477

p477

274081-274495

pIZ-p477/EGFP

wsv500 wsv502

p500 p502

287122-286771 286164-286586

GCGGATCCTGTGATAACAGACCCTCATG

063p-r

GCCTCGAGTAGGGGCGTTGCACCATC

166p-f

GCCGGATCCGAGGATTATGGCAAGTGGT

166p-r

GCCCTCGAGCTTATATACCCTTCAGATGTG

184p-f 184p-r

GCCGGATCCGGATACCTATGCTGTAAAAG GCCCTCGAGACTAAAGAAACCCACTCAGA

199p-f

GCGGATCCTCCTCCTCCATCTCCAGC

199p-r

GCCTCGAGGATCTAAGCACACTTTTCTA

222p-f

GCCGGATCCCGATAACGATGATGAGACTA

222p-r

GCCCTCGAGGTTGAGTACTTTCCCCTTTTA

303p-f

GCGGATCCACACCAGAATATTGAACTCG

303p-r

GCCTCGAGCTCGACGTCTGGTCCAC

403p-f

GCAAGCTTCTGGAAAGGGGGTACAATTT

403p-r

GCGGATCCGGTGCGTTCTCTACTGAGG

465p-f

GCCGGATCCCTGGAATCTGTCCGACCC

465p-r

GCCCTCGAGTGTAGTATATCTTTATGGTAGA

477p-f

GCAAGCTTAGAAAGAGGGTGAAAACCTG

477p-r

GCGGATCCGAGATGGGGTGATGATGTT

pIZ-p500/EGFP

500p-f

GCGGATCCTGTCCAATGTTCTCCCGTG

pIZ-p502/EGFP

500p-r 502p-f

GCCTCGAGGTAGTTGCCAGCCACCAC GCGGATCCCTTACTCGTCGAGAAACATG

502p-r

GCCTCGAGGTACACCAATTATAGGGACT

in ubiquitination [8]. Their frequent presence in the WSSV genome implies a critical role of the zinc finger protein family in the viral replication cycle. In fact, previous research has already proven that several WSSV IE proteins belonged to zinc finger protein family, including WSV069 (IE1) [4], as well as WSV079, WSV100 and WSV249 [5]. Among these, IE1 was found to exhibit transactivation activity as well as DNA-binding activity [9] and to take advantage of the shrimp STAT pathway to enhance its own expression [10, 11]. The promoter region of ie1 showed a strong ability to activate the expression of a reporter gene in insect Sf9 cells [4, 11]. Therefore, we asked if there are more IE genes among these zinc-finger-protein-coding genes that have not been identified yet. Since an IE gene promoter can be activated by cellular proteins, transient transfection assays were carried out to determine whether the promoters of these candidate genes can initiate reporter gene expression in insect cells. Briefly, the promoter regions (about 450 bp upstream of the start codon) of 12 candidate genes excluding the known IE genes ie1, wsv079, wsv100 and wsv249, were amplified with specific primer pairs (Table 1) from genomic DNA of WSSV [12]. DNA

123

063p-f

fragments were then cloned into the pIZDIE/EGFP reporter vector, which lacks a eukaryotic promoter [13]. The ie1 promoter (ie1p) and VP28 gene (wsv421, a late gene encoding envelope protein VP28) promoter (vp28p) were also amplified and inserted into the above vector, serving as positive and negative controls, respectively. The resulting constructs were used to transfect High Five cells seeded in 24-well plates (3 9 105 cells/well, 0.5 lg plasmid/well) using Cellfectin II Reagent (Invitrogen). Cells were fixed 24 h post-transfection with 4% paraformaldehyde, and the nuclei were stained with DAPI. The EGFP fluorescence was observed under a Leica DM6000B microscope. As shown in Fig. 1, cells transfected with positive control pIZ/ie1p-EGFP showed bright fluorescence, while no fluorescence was detected in negativecontrol pIZ/vp28p-EGFP-transfected cells. Compared to the controls, fluorescence signals were observed in cells transfected with pIZ/056p-EGFP, pIZ/403p-EGFP and pIZ/ 465p-EGFP, whereas no fluorescence was detected in cells transfected with the other plasmids with WSSV promoters (data not shown). These results suggested that promoters 056p, 403p and 465p can be activated in insect cells by cellular transcription factor(s).

Immediate-early genes of white spot syndrome virus

Fig. 1 Promoter activity assay for candidate WSSV IE genes. Scale bar, 25 lm. DAPI and EGFP green fluorescence signals were observed at 24 h after transfecting High Five cells with the indicated plasmids. pIZ/ie1p-EGFP is a positive control and pIZ/vp28p-EGFP

To determine if new viral protein synthesis is necessary for expression of the three candidate IE genes wsv056, wsv403 and wsv465, RT-PCR analysis was performed. Primary cultured crayfish hemocytes were seeded into 6-well-plate as described previously [5] and pretreated with the protein synthesis inhibitor cycloheximide (CHX) (100 lg/mL) or ethanol alone for 2 h. The cells were then challenged with WSSV (107 virions/well) in the present of the drug and harvested 8 h postinfection for total RNA isolation using TRI Reagent (Molecular Research Center). Mock infection was used as a control. Residual genome DNA was removed by DNase I treatment. First-strand cDNA was synthesized with oligo dT(18) primers using SuperScript reverse transcriptase (Invitrogen). The candidate IE genes were detected by PCR with the following primers: RT-wsv056-F, 5’-ACCGCCTGATCCAT AAG-3’; RT-wsv056-R, 5’-TACCACATTGGCATTCAT T-3’; RT-wsv403-F, 5’-ATGGTTGCTTCAACTCCGT-3’; RT-wsv403-R, 5’-TGTTACTGAGCACATGAGAG-3’; RT-wsv465-F, 5’-AGTGCCTTCCCCATCTTGA-3’; RTwsv465-R, 5’-TACGCGA GCATACTTGCGA -3’. In parallel, the ie1 gene was used as a positive control, while the viral DNA polymerase gene (wsv513, an early gene) and the VP28 gene (wsv421, a late gene) served as negative controls. Actin functioned as a loading control. IC3 (WSSV intergenic fragment) was used to eliminate possible genomic DNA contamination. All the primers of the controls were as described by Li et al. [5]. As shown in Fig. 2, in contrast to the DNA polymerase gene and the VP28 gene, which could only be detected in WSSV-infected cells without CHX treatment, wsv056, wsv403 and wsv465 were efficiently transcribed in the presence and absence of CHX, suggesting that their

1613

is a negative control. The other three plasmids, pIZ/056p-EGFP, pIZ/ 403p-EGFP and pIZ/465p-EGFP, contain the WSSV promoter regions of wsv056, wsv403 and wsv465, respectively

Fig. 2 Confirmation of WSSV IE genes by RT-PCR. Primary cultured crayfish hemocytes were pretreated with 100 lg/mL CHX (CHX?) or ethanol alone (CHX-) and challenged by WSSV (WSSV?). Non-challenged cells served as negative controls (WSSV-). Total RNA was extracted from these hemocytes at 8 h postinfection. Reverse transcription was conducted using oligo dT(18) primers. The candidate WSSV IE genes and the control genes, including the immediate-early gene ie1, the early DNA polymerase gene and the late VP28 gene, were amplified. Genomic DNA served as a positive control for PCR conditions. IC3 (WSSV intergenic fragment) was used as a WSSV genomic DNA contamination control, while actin served as a loading control

123

1614

expression is independent of new viral protein synthesis. Therefore, wsv056, wsv403, wsv465 are indeed WSSV IE genes. Among the newly identified IE proteins, WSV403, an E3 ubiquitin ligase, is able to interact with shrimp protein phosphatase (PPs), and its transcription occurs during latency and increases when the lytic stage starts [14]. Together with our finding that WSV403 is expressed in the immediate-early stage of primary viral infection, we speculate that this protein might be a regulator for both the initiation of primary infection and the reactivation of WSSV in the host. Moreover, WSV465 is predicted to contain a von Willebrand factor (vWF) type A domain. The majority of vWA-containing proteins are plasma proteins that are essential for hemostasis [15], and mutations inside this domain often lead to bleeding disorders. A similar domain of the vWF family also exists in a crayfish protein that is required for hemolymph clotting [16], which is an important immune response in crustaceans [17]. Hence, WSV465 might participate in the regulation of hemolymph clotting during WSSV infection. Further investigation of the function of these WSSV IE proteins and how they interact with their host cells would help us understand the mechanism of WSSV infection and replication. Acknowledgments This work was supported by Natural Science Foundation of China (40776096 and 40976100), National Department Public Benefit Research Foundation (200803012 and 201103034), Fujian Science and Technology Project (2009J01176) and the Earmarked Fund for Modern Agro-industry Technology Research System (No. CARS-47).

References 1. Escobedo-Bonilla C, Alday-Sanz V, Wille M, Sorgeloos P, Pensaert M, Nauwynck H (2008) A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus (peer reviewed article) 2. Marks H, Vorst O, van Houwelingen AM, van Hulten MC, Vlak JM (2005) Gene-expression profiling of White spot syndrome virus in vivo. J Gen Virol 86:2081–2100

123

F. Lin et al. 3. Yuan Y (2005) Identification and characterization of herpesviral immediate-early genes. Methods Mol Biol (Clifton Then Totowa) 292:231–246 4. Liu WJ, Chang YS, Wang CH, Kou GH, Lo CF (2005) Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp. Virology 334:327–341 5. Li F, Li M, Ke W, Ji Y, Bian X, Yan X (2009) Identification of the immediate-early genes of white spot syndrome virus. Virology 385:267–274 6. Yang F, He J, Lin X, Li Q, Pan D, Zhang X, Xu X (2001) Complete genome sequence of the shrimp white spot bacilliform virus. J Virol 75:11811–11820 7. Dreier B, Segal DJ, Barbas Iii CF (2000) Insights into the molecular recognition of the 50 -GNN-30 family of DNA sequences by zinc finger domains1. J Mol Biol 303:489–502 8. Zheng N, Wang P, Jeffrey PD, Pavletich NP (2000) Structure of a c-Cbl-UbcH7 complex: RING domain function in ubiquitin-protein ligases. Cell 102:533–539 9. Liu WJ, Chang YS, Wang HC, Leu JH, Kou GH, Lo CF (2008) Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate-early protein IE1. J Virol 82:11362–11373 10. Chen WY, Ho KC, Leu JH, Liu KF, Wang HC, Kou GH, Lo CF (2008) WSSV infection activates STAT in shrimp. Dev Comp Immunol 32:1142–1150 11. Liu WJ, Chang YS, Wang AH, Kou GH, Lo CF (2007) White spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1. J Virol 81:1461– 1471 12. Yang F, Wang W, Chen RZ, Xu X (1997) A simple and efficient method for purification of prawn baculovirus DNA. J Virol Methods 67:1–4 13. Luo T, Li F, Lei K, Xu X (2007) Genomic organization, promoter characterization and expression profiles of an antiviral gene PmAV from the shrimp Penaeus monodon. Mol Immunol 44:1516–1523 14. He F, Kwang J (2008) Identification and characterization of a new E3 ubiquitin ligase in white spot syndrome virus involved in virus latency. Virol J 5:151 15. Ruggeri ZM, Ware J (1993) von Willebrand factor. FASEB J 7:308 16. Hall M, Wang R, Van Antwerpen R, Sottrup-Jensen L, So¨derha¨ll K (1999) The crayfish plasma clotting protein: a vitellogeninrelated protein responsible for clot formation in crustacean blood. Proc Natl Acad Sci USA 96:1965 17. Vazquez L, Alpuche J, Maldonado G, Agundis C, Pereyra-Morales A, Zenteno E (2009) Review: immunity mechanisms in crustaceans. Innate Immunity 15:179