Identification of Three Novel Spectrin d/74 Mutations in Hereditary ...

Identification of Three Novel Spectrin d / 7 4 Mutations in Hereditary Elliptocytosis: Further Support for a Triple-Stranded Folding Unit Model of the Spectrin Heterodimer Contact Site By Nathalie Parquet, Isabelle Devaux, Laurent Boulanger, Colette Galand, Pierre Boivin, Marie-Christine Lecomte, Didier Dhermy, and Michel Garbarz Six individualswith hereditary elliptocytosis (HE)or hereditary pyropoikilocytosis (HPP)from three unrelated families were evaluated.Defects in the ability ofspectrin (Sp) to undergo self-associationwere present, and associatedwith of the Sp al7CkD fragment after limited increased recovery tryptic digestion (Spa”74variant). Because mutations associated with the Spa’”4 variant described to date have been localized to the 5’ coding region of the a-Sp gene (exon 2) or at the 3’ coding end of the B-Sp gene (exon 301, the polymerase chainreaction (PCR)-based single-strand conformation polymorphism (SSCP) method was used to detect mutations in these two regions. In one family with HE, an abnormal pattern of migration of PCR-amplified fragments

containing exon 2 was observed, and led to the detection of a new mutation (lle24Ser)in helix 3 of repeating segment al. In the two other families, an abnormal pattern of migration of PCR-amplified fragments containing exon 30 was observed in affected individuals, and sequencing led to the and identification of two new mutations (Ala2023Val p17. The elliptoTrp2024Arg) in helix 1 of repeating segment genic potential of these mutations emphasizes the importance of the conformational integrity of each of the three helices involvedin theformation of the Sp heterodimercontact site, and will help identify critical aminoacids involved in this interaction. 0 1994 by The American Society of Hematology.

H

(PCR)-based single-strand conformation polymorphism (SSCP) techniqueI6 to study exon 2 of the a-Sp gene and exon 30 of the p-Sp gene in three Spam4HE families. An abnormal conformation of the amplified p-Sp exon 30 was observed in two families. Abnormal mobility of the amplified a-Sp exon 2 was observed in members of a third family. DNA sequencing allowed the characterization of three novel Spam4mutations, one in the a-Sp gene and two in the pSp gene, respectively. One a-Sp mutation, Ile24Ser, is located in helix 3 of repeating segment a l , whereas the two pSp mutations, Ala2023Val and Trp2024Arg, are located in helix 1 of repeating segment p17, indicating that the conformational integrity of this helix is necessary for normal a-0 chain interaction and Sp heterodimer self-association.

EREDITARY elliptocytosis (HE) is a heterogeneous group of disorders characterized by the presence of elliptical red blood cells.’.* The clinical presentation of HE can range from an asymptomatic condition to severe hemolysis referred to as hereditary pyropoikilocytosis (HPP).3In all cases, the underlying alterations involve the red blood cell membrane skeleton.’.’ Spectrin (Sp), the main component of the membrane skeleton, is composed of two subunits, a and p, which are encoded by separate The a- and p-Sp chains intertwine in an antiparallel manner to form rod-like heterodimers, which, in turn, self-associate head to head to form tetramers and higher order oligomers. Using partial trypsin digestion, Sp chains have been dissected into domains (a1to aV,and PI to pIV domains)? Subsequent work has shown that Sp a- and @-chains consist of 22 and 17 repeating segments, respectively, with each repeat folded into a triple-helical structure containing three helices (3, 1, and 2, in the N to the C dire~tion).~.~.’ Helices 1 and 2 of one repeat also combine with helix 3 of the following repeating segment to give the molecule a rod-like structure.* In the formation of a0 dimers, the N-terminal a1 domain (in particular, the isolated helix 3 at the N-terminal end of the molecule) is thought to associate with the C-terminal @Idomain, which, unlike the other repeat units, contains only a diad of helices 1 and 2.9 Many of the mutations identified in patients with HE are located in regions coding for the Sp heterodimer contact site formed by the head-to-head contact of a- and &chains, and affect the ability of the molecule to self-associate into tetramers and higher order oligomer^.'.'^ Among them, the Spam4mutations” represent a group of elliptocytogenic mutations of Sp resulting in the formation of a 74-kD peptide, due to the cleavage after arginine at position 45 or lysine at position 48 of the a-chain.”.” The Spam4point mutations, which have been characterized so far, are located at the 5‘ coding region of the a-Sp gene (exon 2) or at the 3’ coding end (exon 30) of the 8-Sp gene.“*I3 The effect of these mutations provided the basis for a model of Sp self-association in which helices 1 and 2 of repeating segment p17 lie in direct apposition to helix 3 of repeating segment a 1. I 4 , l 5 In the present study, we applied the polymerase chain reaction Blood, Vol 84, No 1 (July l ) , 1994: pp 303-308

MATERIALSANDMETHODS Clinical material. We studied families CO, NI, and PE. Genetic trees of the families are presented in Fig 1. Clinical, hematologic, and biochemical descriptions of family CO have been previously reported.” Briefly, the proposita is a French white woman born in 1914 who has asymptomatic HE. When she was first studied in 1983, Sp self-association in solution was defective. Limited tryptic digestion of Sp dimers obtained at equilibrium after conversion of dimer to tetramer showed a decrease in the S p c ~ ” ~ ~ -peptide k D and the concomitant increase in the Spcym4-kDpeptide. Available family studies showed that one of her three daughters had elliptocytosis.

From INSERM U409, Genetique et Pathologie Moleculaires de L’Hematopoiese, Faculte‘ de MLdecine X . Bicuat, Paris, France. Submitted July 23, 1993; accepted February 23, 1994. Supported in part by the Association Frangaise contre les Myopathies and the Conseil Scientifique de I’UER Xavier Bichat, Universite‘ Paris VII. Address reprint requests to Michel Garbarz, MD,INSERM U409, Genetique et Pathologie Moleculaires de L’Hematopoiese, Faculte‘ de Medecine X . Bicuat, B.P. 416 75870, Paris Cedex 18, France. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “adveItisement” in accordance with I8 U.S.C. section I734 solely to indicate this fact. 0 I994 by The American Society of Hematology. OGQ6~497I/94/840I-00I6$3.00/0 303

304

PARQUETET AL

Family NI

Family CO HE

UF

I1

HE

HE

Familv PE

HPP

Fig 1. Pedigrees of HE families CO, NI, and PE. (0)a"" allele; (B) a"'" allele; arrows indicate each family's propositus.

Family NI originated from Senegal. The propositus is a boy born in 1990 inwhom elliptocytosis was discovered fortuitously. His blood laboratory values are: red blood cells, 4.6 X 10'2/L;hemoglobin (Hb), 11 g/&; packed cell volume (PCV), 31%; reticulocytes, 82,0OO/pL. Asymptomatic HE was also discovered in his father. The propositus of family PE is a French white boy born in 1990. He experienced severe neonatal anemia (Hb, 6 glL; reticulocyte count, 200,OOO/pL), with anisocytosis, poikilocytosis, and the presence of microcytes and microelliptocytes. The severity of the anemia required numerous blood transfusions, and subtotal splenectomy was performed when he was 1 year old. Elliptocytosis was fortuitously discovered in the father, who exhibited normal hematologic values. The mother was hematologically normal. Erythrocytemorphologyanddeformabilify. Cells were examined by light phase-contrast microscopy after fixation in 1% (voll vol) glutaraldehyde. Cell deformability was studied using an ektacytometer andwas followed as a function of the osmolality of the suspending medium, as previously described." Spectrin bicchemical analysis. The methods used have been previously described. They include estimation of the amount of Sp in the memb~ane,'~ extraction of Sp and analysis of Sp dimers and tetramers by nondenaturing gel electrophoresis," limited tryptic digestion of Sp followed by separation using sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) according tothe procedure of Laemmli:' and by two-dimensional electrophoresis.22 The polymorphism was quantified on one-dimensional PAGE of Sp tryptic digests as described by Alloisio et a l . 2 3 Amplification of genomic DNA by PCR. DNA was prepared from nucleated blood cells by standard methods. The two oligonucleotide and S'-CAATCAprimers 5'-TGAGAACTAGCAATTAACAG-3' AGAGAACTGAGTGAC-3' (primers A and B) were designed to anneal to target sequences 299 bases apart in genomic DNA, allowing the amplification of a segment containing exon 2 of the cySp gene and its flanking intronic sequences." DNA amplification was performed according to Saiki et a l . 2 4 Two other primers, 5'-ATCAGGAGTGAACGATTGGGTand S'ACAGTTGCCACCCTCCTGAG (primers C and D), were designed according to unpublished intronic sequences, kindly provided by Professor B.G. Forget. They anneal to target sequences 314 bases apart in genomic DNA, allowing the amplification of a segment containing exon 30 of the p-Sp gene and its flanking intronic sequences. PCR-SSCP. Seven to 10 microliters ofthePCR product was

mixed with an equal volume of 95% formamide containing xylene cyano1 and bromophenol blue, heated at 95°C for 5 minutes. cooled on ice, and loaded onto a 0.75 mm X 14 cm X 18 cm 6% standard polyacrylamide gel containing S% glycerol. Electrophoresis was run atroom temperature over 16 hours at 2.5 W. Gel electrophoresis were also performed using MDE gels (J.T. Baker, Paris, France) following the recommendations of the manufacturer. Gels were then silver-stained.*' Subcloning andsequencing of the amplijed DNA. Amplified DNAs from HE probands of families NI, PE, and CO were subcloned into the PGEM3Z (Promega Biotechnology, Madison, WI) plasmid vector. Positive subclones were sequenced by dideoxysequencing" using T7 DNA polymerase (Sequenase; United States Biochemical, Cleveland, OH) and the plasmid Sp6 and T7 promoter primers. Svnthesis and amplijicationof reticulocyte p - S p cDNA. Reticulocyte RNA was prepared from peripheral blood as described." Total RNAwas transcribed into single-stranded cDNA andcDNAwas then amplified by PCR as previously described.28The sequence of the upstream and downstream primers used are: S'-GAGAAGTGGGAAGCCCGCTG-3' and S'-CTGCGCCAGCTCATCTCGCCT-3' (primers E and F). They are designed to anneal to target sequences that span the last three exons of p-Sp and are located approximately 460 bp apart atthe 3' end of the coding region.' Primer E was biotinylated in the 5' end. Directsequencing of amplijed p-Sp cDNA. AmplifiedDNA products were analyzed by electrophoresis in 2% agarose gels, and purified using the Geneclean I1 Kit (Bio 101, La Jolla, CA) according to the instructions of the manufacturer. Twenty-five microliters of purified amplifiedproduct (corresponding to about 800 ng of doublestranded template) was added to 30 pL of streptavidin-coupled magnetic beads (Dynabeads M280 streptavidin; Dynal, Oslo, Norway) and single-stranded DNA was purified as described by the manufacturer. Sequencing reactions were performed usingan internal sequencing primer corresponding to the sequence just S' to primer F (5'-CACCTGGGCTGAGCTAGTAG-3') and commercially available sequencing reagents (Sequenase 2.0 kit). Direct sequencing of amplijed genomic DNA. Direct sequencing was also performed as described earlier on amplified genomic DNA corresponding to exon 30 of the p-Sp gene and exon 2 of the a-Sp gene. For direct sequencing of exon 30, genomic DNA was amplified using a biotinylated primer C and primer D. An internal oligonucleotide corresponding to a sequence at the endof exon 30 (5"CCCAGCTGGCCCTGGACTrCTCA-3') was used as the sequencing primer. For direct sequencing of exon 2, genomic DNAwas amplified using a biotinylated primer A and primer B. An internal oligonucleotide corresponding to a sequence at the beginning of intron 2 (5'ATCAAGAGAACTGAGTGAC-3'jZy wasusedasthe sequencing primer. RESULTS Erythrocytemorphology and erythrocytedeformability. Obvious elliptocytosis in the patient CO has previously been reported.I7 Theelliptocytosis observed in both the patientNI and his father appeared similar; cell fragmentation was not present. In contrast, erythrocytes from patient PE displayed fragmentation and poikilocytosis, whereas elliptocytosis without fragmentation was observed in his father (data not shown). Ektacytometric studies performed using cells from the fathers of NI and PE showed typical trapezoidal curves3" with a decreased ektacytometric index at isotonicity. In patient CO, the curve was trapezoidal, but the ektacytometric index at isotonicity was within the normal range. In patient PE, a markedly decreased ektacytometric index at isotonic-

305

NOVEL MUTATIONS IN Sprrln4 ELLIPTOCYTOSIS Table 1. Spectrin Biochemical Analyses Percentage of Sp Dimers in Percent of 74-kD Peptide Family Members 0°C Extracts (74 kD x 100 = 74 kD + 80 kD)

PE Propositus Father Mother NI Propositus Father Mother CO Proposita Daughter Control values

Sp Band 3 Ratio

ND 30% 3.3%

30%. 47%