Idiopathic and Radiation-Induced Ocular ... - Semantic Scholar

Download PDF
2 downloads 0 Views 87KB Size Report
Comment
tissues as an approximately 13-kb messenger RNA encoding a. 350-kDa protein serine/threonine protein kinase.6 ATM's ki- nase activity is itself enhanced in ...
A

R

T

I

C

L

E

S

Idiopathic and Radiation-Induced Ocular Telangiectasia: The Involvement of the ATM Gene Martine Mauget-Fay¨sse,1 Miche`le Vuillaume,2 Maddalena Quaranta,1 Norman Moullan,2 Sandra Ange`le,2 Marlin D. Friesen,3 and Janet Hall 2 PURPOSE. To investigate whether individuals, with no family history of ataxia telangiectasia (AT), in whom idiopathic or radiation-induced ocular telangiectasia developed are carriers of ATM gene mutations. METHODS. The ATM cDNA from lymphoblastoid cell lines established from 16 patients with idiopathic retinal or choroidal telangiectasia and 14 patients with radiation-induced telangiectasia after radiotherapy for age-related macular degeneration (AMD) was screened using the restriction endonuclease fingerprinting technique. The frequency of each detected variant was determined in the French population by either a mass spectrometry– based technique or variant-specific endonuclease digestion. RESULTS. Twenty-one ATM missense alterations, at 10 different sites, 8 of which would result in an amino acid substitution at a conserved position in the ATM protein were found. Four were novel changes, three of which were not detected in the 128 French control subjects screened. Eleven of 16 of the individuals with either idiopathic polypoidal choroidal vasculopathy or juxtafoveolar retinal telangiectasis and 6 of 14 individuals that had choroidal telangiectasis after radiotherapy for AMD carried ATM sequence variants. These latter six individuals had a significantly shorter delay time before the presentation of this vasculopathy compared with those individuals who had a wild-type ATM (11.8 ⫾ 3.4 months vs. 17.5 ⫾ 4.5 months, P ⫽ 0.024). They had also received a lower average dose of X-rays, although this difference did not reach statistical significance (18.7 ⫾ 3.9 Gy vs. 23.7 ⫾ 5.6 Gy, P ⫽ 0.09). CONCLUSIONS. ATM missense variants could confer an AT-like phenotype and influence the formation of retinal and choroidal vascular abnormalities. (Invest Ophthalmol Vis Sci. 2003;44: 3257–3262) DOI:10.1167/iovs.02-1269

O

ne of the clinical characteristics of the radiation-sensitive, cancer-prone disease ataxia telangiectasia (AT), caused in the majority of cases by mutations in the ATM gene (ATM; Mendelian Inheritance in Man [MIM] 208900; http://www.

From the 1Rabelais Ophthalmology Center, Lyon, France; and the DNA Repair Group and the 3Nutrition and Cancer Unit, International Agency for Research on Cancer, Lyon, France. Supported in part by grants from La Ligue Nationale Contre le Cancer, Comite´ De´partemental du Rho ˆ ne (JH). Submitted for publication December 12, 2002; revised February 5, 2003; accepted February 16, 2003. Disclosure: M. Mauget-Fay¨sse, None; M. Vuillaume, None; M. Quaranta, None; N. Moullan, None; S. Ange`le, None; M.D. Friesen, None; J. Hall, None The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Corresponding author: Janet Hall, Head, DNA Repair Group, International Agency for Research on Cancer, 150 Cours Albert Thomas, 69372, Lyon 08, France; [email protected].

2

Investigative Ophthalmology & Visual Science, August 2003, Vol. 44, No. 8 Copyright © Association for Research in Vision and Ophthalmology

ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), is the development of telangiectases in the eyes and ears.1 This disease is extremely rare, with the incidence of AT being estimated to be in the range between 1 per 40,000 and 1 per 300,000 live births in various populations.2,3 However, the frequency of ATM heterozygotes in the general population, based on both epidemiologic studies and more recently on direct mutation analysis of the ATM gene in control populations, is of the order of 1%. Although heterozygous carriers of the ATM gene show none of the clinical features of AT, there has been consistent evidence since the first report by Swift et al.4 that they have a higher risk of development of cancer, particularly of the female breast (reviewed in Ange`le and Hall5). The ATM gene has 66 exons scanning 150 kb of genomic DNA on chromosome 11 and is expressed in a wide range of tissues as an approximately 13-kb messenger RNA encoding a 350-kDa protein serine/threonine protein kinase.6 ATM’s kinase activity is itself enhanced in response to DNA doublestrand breaks, resulting in a phosphorylation cascade activating many proteins, each of which in turn affects a specific signaling pathway. These substrates include the protein products of a number of well-characterized tumor-suppressor genes including TP53, BRCA1, and CHK2, which play important roles in triggering cell cycle arrest, DNA repair, or apoptosis (reviewed by Shiloh and Kastan7). At the cellular level, cell lines established from patients with AT show hypersensitivity to ionizing radiation (IR) and other agents that cause DNA double-strand breaks with defects in both G1/S and G2/M checkpoint responses, defective inhibition of DNA replication and increased chromosomal instability being seen after such exposures (reviewed in Shiloh and Kastan7 and Khanna et al.8). The profile of ATM mutations in children with AT has revealed that most are unique and uniformly distributed along the length of the gene. Most patients with AT are compound heterozygotes with two different ATM mutations; patients homozygous for the same ATM mutation are rare.7 The predominate type of mutation found in the ATM gene in patients with AT results in a truncated and unstable ATM protein. However, a considerable percentage of ATM alleles from patients with AT contain in-frame insertions/deletions or missense mutations. It would be expected that many such changes would give rise to the expression of a stable, albeit mutant, form of the ATM protein. The presence of such a mutant protein with residual function, or the presence of a small amount of normal protein, has been found in some cases of AT to lead to a milder clinical presentation and altered cancer predisposition.9 ATM heterozygotes in the general population thus fall into two groups distinguished by their mutation profile.10,11 One group is heterozygous for a truncating allele, which would be expected to give rise to little or no protein and could lead to ATM haploinsufficiency.12 The second group is heterozygous for a missense allele, resulting in amino acid substitutions or short in-frame deletions or insertions and the expression of 3257

3258

Mauget-Fay ¨ sse et al.

IOVS, August 2003, Vol. 44, No. 8

TABLE 1. Clinical and Molecular Characteristics of Patients TEL Line 2 5 8 26 32 35 10 13 17 23 24 25 29 30 14 15 34 1 4 11 12 18 6 7 16 22 20 27 28 31

Clinical Diagnosis RICT RICT RICT RICT RICT RICT Average ⫾ RICT RICT RICT RICT RICT RICT RICT RICT Average ⫾ IPCV IPCV IPCV IPCV IPCV IPCV IPCV IPCV Average ⫾ IJRT IJRT IJRT IJRT Average ⫾ IJRT IJRT IJRT IJRT Average ⫾

Sex F F F M F F

SD F F F F M F F F SD M M M F F F F F SD M M F M SD F F F M SD

Age of Diagnosis or Onset (y)

Total X-ray Dose (Gy)

Time to Development of RICT (mo)

ATM Sequence Change*

85 69 77 76 73 73 75.5 ⫾ 5.4 75 84 75 72 85 71 76 79 77.1 ⫾ 5.2 76 72 83 75 73 77 62 76 74.3 ⫾ 5.9 60 55 65 42 55.5 ⫾ 9.9 62 54 44 73 58.3 ⫾ 12.3

18.0 12.0 20.0 24.0 18.0 20.0 18.7 ⫾ 3.9 28.8 16.0 28.8 28.8 28.8 18.0 20.0 20.0 23.7 ⫾ 5.6

11 12 12 18 10 8 11.8 ⫾ 3.4 18 18 12 15 18 12 23 24 17.5 ⫾ 4.5

4258 C3T 5557 G3A 5262 G3T 4578 C3T 5557 G3A 5557 G3A None None None None None None None None None 4578 C3T 3161 C3G 1229 T3C 5557 G3A homozygote 2512 A3G, 4258 C3T, 5557 G3A 5557 G3A 4578 C3T, 5557 G3A 735 C3T 5557 G3A 6315 G3C 998 C3T, 5557 G3A None None None None

* Nucleotide numbering follows the cDNA sequence (Genbank accession no. U33841), with nucleotide position 1 assigned to the first nucleotide of the ATG initiation codon.

some ATM protein that may act in a dominant–negative manner competing with the wild-type ATM protein. It has been predicted that carriers of such an allele would have an increased cancer risk, as has been seen for the 7271G3 T missense ATM sequence alteration that is associated with an increased breast cancer risk9,13 or perhaps of developing clinical phenotypes associated with AT, such as radiation sensitivity and telangiectases or vasculopathies. To test this hypothesis we performed a pilot study in which we investigated whether 30 individuals with no family history of AT, in whom idiopathic or radiation-induced ocular telangiectasia developed of either choroidal or retinal origin, were carriers of ATM mutations.

SUBJECTS

AND

METHODS

Subjects and Establishment of Cell Lines The protocol of this study was reviewed and approved by the local ethics committees, and informed consent was obtained from all the study participants. This study adhered to the tenets of the Declaration of Helsinki. The 30 individuals (9 males and 21 females) included in the pilot study had either choroidal or retinal telangiectasia (Table 1). Within the group with choroidal telangiectasia was one subset of eight patients who had idiopathic polypoidal choroidal vasculopathy (IPCV). These individuals were diagnosed by biomicroscopic fundus examination and fluorescein and indocyanine green (ICG) angiographies. The second subset (14 patients) in this group had age-related macular degeneration (AMD) with subfoveal choroidal neovasculariza-

tion as a complication. They were treated with external beam radiotherapy and had subsequent development of radiation-induced choroidal telangiectasia (RICT).14,15 RICT was diagnosed by microscopic fundus examination and ICG angiography. These complications were detected relatively late after radiotherapy, with the average onset in the group in the present study being 15.1 ⫾ 4.9 months after radiotherapy. The second group of eight patients included in this study had idiopathic juxtafoveolar retinal telangiectasia (IJRT), diagnosed by biomicroscopic fundus examination and fluorescein angiography. In two patients, the IJRT was unilateral and in six bilateral and in all individuals resulted in the formation of macular edema. Lymphocytes were separated from fresh blood samples with a single-density gradient (Ficoll; Pharmacia, Uppsala, Sweden) and a lymphoblastoid cell line (TEL line) established by infection with Epstein-Barr virus in each patient. The cell lines were routinely cultured in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS) in an atmosphere of 5% CO2. To determine the frequency of specific ATM sequence changes in the French population, genomic DNA was isolated from the buffy coat of blood samples obtained from 49 male and 80 female blood donors living in the Rho ˆ ne area of France by using separation columns (Qiagen SA, Courtaboeuf, France) and following the manufacturer’s protocol.

ATM Sequence Analysis RT-PCR of the ATM Open Reading Frame. Total RNA was extracted from each TEL line (TRIzol; Invitrogen, SARL, Cergy Pontoise, France). The RT-PCR was performed with reverse transcriptase

ATM and Ocular Telangiectasia

IOVS, August 2003, Vol. 44, No. 8

3259

TABLE 2. Primers for Analysis by SOMA and PSDM Sequence and aa Change*

Technique for Analysis

C735T V245V

SOMA

C998T S333F

SOMA

T1229C V410A†

SOMA

A2512G M838V†

PSDM

C3161G P1054R

SOMA

C4258T L1420F

SOMA

C4578T P1526P

PSDM

G5262T K1754N†

SOMA

G5557A D1853N

SOMA

G6315C R2105S†

SOMA

SOMA Oligonucleotides‡ C8s T8s T8as C8as C7s T7s T7as C7as C7s T7s T7as C7as

C9s G9s G9as C9as C7s T7s T7as C7as

G8as T8as T8s G8s G8as A8as A8s G8s G9as C9as C9s G9s

pCAACTTTC pTAACTTTC pAAGTTAAC pAAGTTGAC pTATTCTT pTATTTTT pAAATACT pGAATACT pCGCCTTG pTGCCTTG pAGGCACA pAGGCGCA

pCTTATTCAA pGTTATTCAA pGAATAACGA pGAATAAGGA pCTTGCCA pTTTGCCA pGCAAAAA pGCAAGAA

pGTCATCTT pGTCATATT pTATGACAA pGATGACAA pTGTATCTT pTGTATTTT pAATACAAA PGATACAAA pCATATTCCT pCATATTGCT pCAATATGCA pGAATATGCA

SOMA Transitions

Primer Sequences (5ⴕ33ⴕ) and Restriction Enzymes for PSDM and SOMA§

1211.331092.7 1218.831107.7 1247.83619.4 1255.83619.4 1069.73625.4 1077.23625.4 1083.23610.4 1091.23610.4 1075.23795.5 1082.73810.5 1096.03932.6 1104.23948.6

FP: ATATCTTAGCAGCTCTTACTActggagTCAAGACTTTGGCTGT RP: AAGTGGGAAGAATTTCATCTCCctggagACACACTCGAATTC BpmI or GsuI

1375.431074.6 1395.431114.7 1416.93948.6 1436.93988.6 1067.23619.4 1074.73619.4 1100.23643.4 1108.23643.4

1226.831218.8 1238.831242.8 1247.831098.7 1260.331123.9 1234.331218.8 1241.831233.8 1244.331107.7 1252.331123.7 1363.431002.2 1383.431022.9 1392.43779.5 1412.43819.5

FP: TCTGCTAGTGAATGAGATAAGctggagAGGAAGTAGAGGAAAG RP: ATTCAATCAAATTTTCTTTGACctggagATTACGAAATCCTG BpmI or GsuI FP: ATAAAAGATCACCTTCAGAAGctggagAATGATTTTGATCTTG RP: GAGATTAAAATGACACTGAATGctggagTGGTAACACTTTAC BpmI or GsuI FP: ATTTGACCGTGGAGAAGTAGAATCg RP: CTAACACTACTATCAGGGTAATCG ClaI FP: TCTCTATTTCATATTTAACCACActggagTTCCCGTAGGCTGATC RP: ATTTACAGGAAAGTCTTTTCCCATctggagAAGAATGGCCCATT BpmI or GsuI FP: ACTAAATCTGTTTATTTTCTActggagCTATCAGAAAATTCTT RP: GCTTCTTATAAACATTATTTGTctggagTGCTTGCTCACATA BpmI or GsuI FP: GCTTCTCCCTTTGTTGTGAC RP: TTTCTGAACCTCCACCTGCTCATACcCTA StyI FP: TTTTAGCCACAAAGACTGGActggagTCTGGGAGATTTATAA RP: TTGATGTTCTAAAAGGCTGTAGctggagCAGCATTGGATCTG BpmI or GsuI FP: TCAGACTGTACTTCCATACTTctggagTGATATTTTACTCCAA RP: AATCCCTGAACATGTGTAGAAActggagTTCTCCATGATTCA BpmI or GsuI FP: GGTGTCCTGAACTAGAAGAACctggagACCAAGCAGCATGGAG RP: TCAAGTCAAATTTCTTACCTGActggagTGCAATGGTCCCAC BpmI or GsuI

* Nucleotide numbering follows the cDNA sequence (Genbank accession no. U33841), with nucleotide position 1 assigned to the first nucleotide of the ATG initiation codon. † Not reported in the AT Mutation Database (http://www.vmresearch.org/atm.htm) ‡ s, sense oligonucleotide; as, antisense oligonucleotide; p, 5⬘-phosphate; variant bases are indicated in bold. § The lowercase bases are mismatches that were specifically introduced to generate the ClaI, StyI, BpmI, or GsuI restriction endonuclease sites. (Superscript II; Invitrogen) according to the manufacturer’s recommendations. The reaction products were used as a template to amplify the entire ATM open reading frame (ORF) using the following primers, ATM A: 5⬘-atgagtctagtacttaatgatctgc-3⬘; and ATM B: 5⬘-aaggctgaatgaaagggtaattc-3⬘. The PCR reaction was performed in 25 ␮L containing 1 ␮L of the RT product, 1⫻ PCR buffer, 1 ␮M of each primer, 400 ␮M of each dNTP, 2 U of a polymerase (Expand Long Template; Roche Diagnostics, Meylan, France) and 0.66 ␮g of a polymerase antibody (TaqStart; Clonetech-BD Biosciences, Bedford, MA). Restriction Endonuclease Fingerprinting Analysis. The diluted RT-PCR product of 9205 bp was used as a template for the amplifications, by nested PCR, of eight overlapping fragments of 1.0 to 1.6 kb that were analyzed by the restriction endonuclease fingerprinting (REF) technique.16 The primers used for the eight nested PCRs were as previously described by Gilad et al.17 except for primers 1a, 1b, 6b, and 7a which were: 1a, ATM A; 1b, 5⬘-ggtctgcaggctgacccagtaaataac-3⬘; 6b, 5⬘-gataggtctgcatgatgaccg-3⬘; and 7a, 5⬘-aatgatcaagaagttggatgcc-3⬘. The PCR product for each fragment was digested in five separate tubes with a pool of one to three different restriction endonucleases (list of enzymes available on request) overnight at 37°C in the presence of 0.2 U shrimp alkaline phosphatase (Roche Diagnostics). The individual digests were pooled and labeled using 5 ␮Ci of ␥-[33P] adenosine triphosphate (ATP) and 5 U of T4 polynucleotide

kinase (New England Biolabs, Inc., Beverly, MA) for 45 minutes at 37°C. The labeled products were denatured for 3 minutes at 90°C and then analyzed under three electrophoresis conditions: 0.5⫻ and 0.8⫻ mutation-detection electrophoresis (MDE) gels without glycerol and a 0.8⫻ MDE gel with 10% glycerol, in 0.6⫻ TBE (5.34 mM Tris, 0.15 mM EDTA, and 5.34 mM boric acid). The electrophoresis was performed at a constant power of 20 W for 4 hours for the 0.5⫻ MDE gel, 20 W for 6 hours for the 0.8⫻ MDE gel without glycerol, and 14 W overnight for the 0.8⫻ MDE gel containing 10% glycerol at 22° to 24°C. Gels were dried and subjected to autoradiography for 12 hours at room temperature. All fragments with an altered REF pattern were sequenced using a ready reaction cycle sequencing kit (Prism Big Dye Terminator ver. 2.0; Applied Biosystems, Courtaboeuf, France) to determine the exact base changes. Primers used for the amplification of the different exons were those described by Sandoval et al.18

Determination of the Frequencies of ATM Sequence Changes in Control subjects. The frequency of each ATM sequence change found in the TEL cell lines was assessed in a French control group, using either a mass spectrometry– based technique, short oligonucleotide mass analysis (SOMA),19 or endonuclease digestion after PCR-mediated, site-directed mutagenesis (PSDM).20

3260

Mauget-Fay ¨ sse et al.

SOMA is a specific and sensitive genotyping method that allows the simultaneous analysis of three polymorphisms using multiplex-PCR and electrospray ionization tandem mass spectrometry (ESI-MS/MS) analysis.19 Genomic DNA (40 ng) was amplified with primers (Table 2) containing the recognition site (CTGGAG) for the type-IIs endonuclease BpmI in a reaction volume of 25 ␮L containing 2 mM MgCl2, all four deoxyribonucleoside triphosphates each at 200 ␮M, 0.5 ␮M of each primer, and 2.5 U of Taq polymerase (Platinum Taq; Invitrogen). Cycling conditions were 94°C for 2 minutes followed by 40 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, with a final extension at 72°C for 5 minutes. The PCR product was digested overnight at 37°C with 5 U BpmI (New England Biolabs, Inc.) or at 30°C with 5 U of its isoenzyme GsuI (Fermentas Inc., Hanover, MD). The 7-, 8-, or 9-mer oligonucleotides generated (Table 2) were then characterized by ESI-MS/MS based on both the molecular weight and sequence. Before analysis by ESI-MS/MS, the pellet was resuspended in 6 ␮L high-performance liquid chromatography (HPLC) mobile phase (80:20 vol/vol; solvent A to solvent B), where solvent A was 0.4 M 1,1,1,3,3,3hexafluoro-2-propanol (HFIP, pH 7.0) (Roth-Sochiel, Lauterberg, France) and solvent B was 0.8 M HFIP with methanol (50:50 vol/vol). Samples (5 ␮L) were introduced into the mass spectrometer through HPLC with a 15 cm ⫻ 800 ␮m microcolumn (Vydac C18; LC Packings, Amsterdam, The Netherlands) operated at a flow rate of 20 ␮L/min. The HPLC gradient was increased from an initial 20% B to 75% B at 7.1 minutes. After a 2-minute holding phase, the gradient was returned to initial conditions. Oligonucleotide peaks eluted at approximately 8 minutes. Mass spectra were obtained on a triple-quadruple mass spectrometer (Quattro-LC; Micromass, Manchester, UK) equipped with an electrospray ion source operated in the negative ion mode. The capillary voltage was held at 5 kV and the cone voltage at 77 volts. Argon pressure in the collision cell was 4.2 ⫻ 10⫺3 mBar, and collision energy was held at 38 volts. The mass spectrometer was set to less than unit resolution. Data were collected by selected-reaction monitoring, using transitions for each oligonucleotide as shown in Table 2. PSDM allows the presence of an altered allele to be detected by the ability of a restriction endonuclease to cut a PCR fragment containing a defined polymorphism. When the polymorphism does not create or abolish a restriction enzyme recognition site, primers can be designed that create an allele-specific restriction enzyme recognition site.20 This approach was used to determine the frequency of the ATM sequence variants A2512G and C4578T. The primers and the corresponding restriction enzyme are listed in Table 2. The lowercase g and c are mismatches that were specifically introduced to create ClaI and StyI restriction sites, respectively. In both cases, only the wild-type allele is cut by the endonuclease. The PCR product was digested with ClaI and StyI, according to the manufacturer’s instructions, and the fragments analyzed by electrophoresis on a 3% agarose gel (NuSieve; BioWittaker, Walkersville, MD). DNA samples known to be carrying the mutant allele were included in each analysis, with the genotype of the control samples being determined by the banding pattern observed on the gels. A random sample of DNAs were also analyzed by direct sequencing of the corresponding exon and complete concordance between the different techniques was observed (data not presented). The frequency of each sequence change was determined in at least 120 healthy blood donors.

RESULTS ATM Sequence Alterations The efficiency of the REF mutation screening technique has been estimated to be on the order of 70%, depending on the electrophoresis conditions used.21 In the present study, each REF fragment was analyzed under three different electrophoresis conditions, thus maximizing mutation detection. Using such an approach, we found 21 ATM missense sequence variants, at

IOVS, August 2003, Vol. 44, No. 8 TABLE 3. Frequency of ATM Sequence Variants Sequence Change and aa Change* C735T V245V C998T S333F T1229C† V410A A2512G† M838V C3161G P1054R C4258T L1420F C4578T P1526P G5262T† K1754N G5557A D1853N G6315C† R2105S

Rare Allele Frequency (TEL Lines‡)

Rare Allele Frequency (Controls ‡)

0.017 1/304 0.017 1/30 0.017 1/30 0.017 1/30 0.017 1/30 heterozygote 0.033 2/30 0.067 4/30 0.017 1/30 0.167 8/30 heterozygote 1/30 homozygote 0.017 1/30

0.008 2/129 0.008 2/129 0.004 1/129 0 0/128 0.043 11/129 0.0195 5/129 0.050 13/129 0 0/129 0.128 23/129 heterozygote, 5/129 homozygote 0 0/128

* Nucleotide numbering follows the cDNA sequence (Genbank accession no. U33841), with nucleotide position 1 assigned to the first nucleotide of the ATG initiation codon. † Not reported in the AT Mutation Database (http://www. vmresearch.org/atm.htm) ‡ Frequency refers to heterozygote frequency, except for position 5557, where both heterozygous and homozygous carriers of this sequence variant were identified. The TEL lines were established from 9 males and 21 females; the control population consisted of 49 males and 80 females.

10 different sites on the ATM gene, in 17 of 30 TEL lines examined. Eight of 10 of the sequence changes would be predicted to result in an amino acid substitution in the ATM protein at a conserved position, whereas the 735C3 T and 4578C3 T variants were silent alterations (Tables 1, 3). No truncating ATM mutations were found. Four of the sequence changes in the TEL lines were novel (Table 3)—that is, not reported in the latest update of the ATM mutation database (http://www.benaroyaresearch.org/ bri_investigators/atm.htm hosted by the Benaroya Research Institute at Virginia Mason, Seattle, WA). Three of the novel changes: A2512G, G5262T, and G6315C were not detected in the French control subjects screened and thus may represent mutations or rare polymorphisms. The genotype distribution of all the polymorphisms was consistent with Hardy-Weinberg equilibrium. The most frequently found alteration was the 5557G3 A polymorphism, which was present in 9 of 30 of the TEL lines (30%). However, there were no significant differences in the frequency of the A allele between the TEL patients (A allele frequency 0.167) and the population control subjects (A allele frequency 0.128). Three of the TEL patients carried more than one ATM sequence variant, always in combination with the 5557A allele. The 998T allele was detected only once in the TEL patients. This same genotype combination (998T, 5557A) was also found in the only two control individuals carrying this rare sequence variant. The 4578T allele was present in combination with the 5557A allele in one patient, a combination that has not been found in the 13 carriers of the 4578T allele in the

IOVS, August 2003, Vol. 44, No. 8 control group. The third patient carried multiple changes: the novel variant 2512G was detected together with the 4258T and 5557A alleles. Neither the 2512G allele nor the combination of 4258T and 5557A was detected in the control population. Six of 14 patients in whom RICT developed after radiotherapy for AMD had ATM sequence variants, five of which would change the coding potential of the ATM gene. These six individuals showed a significantly shorter delay time before the presentation of this vasculopathy, compared with those who had wild-type ATM (11.8 ⫾ 3.4 months vs. 17.5 ⫾ 4.5 months, P ⫽ 0.026). They had also received a lower average dose of X-rays than the group with wild-type ATM, although this difference did not reach statistical significance (18.7 ⫾ 3.4 Gy vs. 23.7 ⫾ 5.7 Gy, P ⫽ 0.09).

DISCUSSION The purpose of this pilot study was to investigate whether individuals, with no family history of AT, who had idiopathic or radiation-induced ocular telangiectasia of either choroidal or retinal origin, were carriers of ATM mutations. The molecular origins of these telangiectases are poorly understood. Three case reports have described the clinical features of siblings affected by bilateral idiopathic juxtafoveolar retinal telangiectasia (IJFT),22–24 suggesting a genetic influence on the pathogenesis of this disease. The main systemic association noted for IJFT, reported in two case series, is with diabetes.25,26 One of the few identified risk factors for the development of IJFT is previous radiation exposure.27 IPCV is a chronic disease with a diverse clinical spectrum and a variable outcome.28,29 It can be associated with extensive alterations of the retinal pigment epithelium as seen in individuals with diffuse retinal epitheliopathy, or with the presence of drusen-hyaline excrescences found in the Bruch’s membrane as seen in patients with AMD.30,31 These polypoidal vascular dilations are located in the postcapillary choroidal veins. A recent histopathology study showed that these polypoidal structures are composed of saccular dilated thin-walled blood vessels without pericytes. The positive immunohistochemical staining for vascular endothelial growth factor in the retinal pigment epithelium and the vascular endothelial cells suggest that this vascular complex is a subretinal choroidal neovascularization.32 Telangiectasic dilations of the vessels in the outer portions of the choroidal neovascular network has been reported as a complication in patients who have undergone radiotherapy for subfoveal choroidal neovascularization secondary to AMD.14,15,33 In the cohort of patients observed by Spaide et al.,33 who were treated either in New York, where most patients were treated with 10 Gy, 12.6% of patients exhibited development of a vascular abnormality, or in Belgium, where the patients were treated with 20 Gy, 7.1% had abnormalities. The appearance of these abnormalities was 3 to 9 months after external beam radiation in New York and detailed as somewhat later in the Belgian group of patients.33 The patients with RICT included in this present study had been treated with doses (between 15 and 28.8 Gy in four to eight fractions) that more closely resembled those used in Belgium, with a total of 19 (6.4%) eyes of the 295 eyes treated developing RICT. These choroidal telangiectases were not present in any of these patients in the first 6 months after irradiation.14,15 The radiation dose and fractionation schedules thus appear to be determinants for the time of onset, rate of progression, and severity of these vasculopathies. It has been suggested that concomitant chemotherapy and preexisting diabetes may exaggerate the vasculopathy by intensifying the oxygen-derived free-radical assault on the vascular cells.34

ATM and Ocular Telangiectasia

3261

The most frequent sequence variant detected in the ATM gene in the study population was the common polymorphism 5557G3 A. The 5557A allele has been found to modulate the penetrance of hereditary nonpolyposis colorectal cancer in carriers of germline MLH1 and MSH2 mutations.35 It has also been detected more frequently in patients with prostate cancer who had a severe late responses to radiation therapy: 35% of the radiosensitive cases compared with 18% in those who received comparable radiotherapy but who did not have late sequelae.36 It has been suggested that the 3161G variant allele found in one TEL patient, may be more common in breast cancer cases selected for first-degree family history and early age of onset.37 However a recent study by Spurdle et al.38 found no evidence for an association of this variant with a moderate or high risk of breast cancer in Australian women. It remains to be established whether these nonconservative amino acid substitution variants result in altered ATM function. The frequency of all the ATM sequence variants identified in the present study population was determined in the French general population and, for three variants, no carriers were identified in more than 120 healthy control subjects, suggesting that these are ATM mutations or rare polymorphisms. Unfortunately, the power of the study is insufficient to be able to detect differences between the patients and the control subjects when the prevalence of the rare allele is less than 6%. Although the number of individuals examined in each group was small, 9 (56%) of 16 of the patients with idiopathic retinal or choroidal telangiectasia had sequence alterations that would be predicted to change the amino acid sequence of the ATM protein. This frequency is higher than that recently reported in by Dork et al.,39 who found that 46% of the 192 breast cancer patients screened carried ATM missense variants. Three individuals with idiopathic telangiectasia also had an exonic sequence that would not change the ATM coding sequence. However the 735C3 T substitution has been suggested to enhance the alternative splicing of exon 940 and was found 5.6 times more frequently in individuals with diffuse large B-cell lymphoma than in individuals in random cases.41 In summary, a high frequency of carriers of rare ATM missense sequence variants was found within these groups of patients in whom ocular telangiectasia of either choroidal or retinal origin developed. Spaide et al.33 have suggested that the RICT arises as a growth of new blood vessels at the border of the older area of choroidal neovascularization. Radiation has been shown to affect vascular endothelial cells in vitro inducing morphologic responses, DNA breaks, and vascular endothelial cell apoptosis.33 Thus, although the radiotherapy may temporarily affect the ability of the blood vessels to grow, the neovascularization stimuli probably remain, resulting in the eventual reactivation of vessel growth causing the RICT that was present in the patients. The mode and action of these stimuli remain to be established but may be related to alterations in the cellular responses to oxidative stress, as has been noted in patients with AT in which ocular telangiectases are one of the characteristic clinical manifestations.42 There is mounting evidence for oxidative stress in ATM-deficient cells, although the mechanism underlying ATM’s involvement and the interplay with different signaling pathways remains to be established.7 For instance, a functional link has been established between ATM and the insulin response pathway,43 and, as discussed earlier, one of the few identified risk factors for the development of IJFT is previous radiation exposure with the main systemic association being with diabetes. The findings of a high frequency of ATM missense sequence alterations and no truncating mutations in these patients would be consistent with our working hypothesis that missense ATM variants could confer an AT-like phenotype acting in a dominant negative fashion. To our knowledge this is the first report

3262

Mauget-Fay ¨ sse et al.

implicating the ATM gene, outside AT-affected families, in a non-neoplastic clinical disorder, and this study has identified a potential susceptibility gene for the development of ocular telangiectasia of either choroidal or retinal origin. A larger study with more cases is planned to assess whether these preliminary findings are significant, with a detailed personal history being taken in particular of past radiation exposure and diabetes. The establishment of lymphoblastoid cell lines from the study group will allow the assessment of whether these rare ATM sequence variants confer altered ATM function.

Acknowledgments The authors thank Brigitte Chapot for technical assistance, Paola Pisani, Ruggero Montesano, and Yossi Shiloh for advice, Micheline Absi from the Blood Transfusion Service in Lyon for help in the study.

References 1. Sedgwick RP, Boder E. Ataxia-telangiectasia. In: De Jong JMBV, ed. Hereditary Neuropathies and Spinocerebellar Atrophies: Handbook of Clinical Neurology. Amsterdam/New York: Elsevier Science Publishers BV; 1991:347– 423. 2. Swift M, Morrell D, Cromartie E, et al. The incidence and gene frequency of ataxia-telangiectasia in the United States. Am J Hum Genet. 1986;39:573–583. 3. Woods CG, Bundey SE, Taylor AM. Unusual features in the inheritance of ataxia telangiectasia. Hum Genet. 1990;84:555–562. 4. Swift M, Reitnauer PJ, Morrell D, et al. Breast and other cancers in families with ataxia-telangiectasia. N Engl J Med. 1987;316:1289 – 1294. 5. Ange`le S, Hall J. The ATM gene and breast cancer: is it really a risk factor? Mutat Res. 2000;462:167–178. 6. Savitsky K, Bar-Shira A, Gilard S, et al. A single ataxia-telangiectasia gene with a product similar to PI 3-kinase, Science. 1995;268: 1749 –1753. 7. Shiloh Y, Kastan MB. ATM: genome stability, neuronal development, and cancer cross paths. Adv Cancer Res. 2001;83:209 –254. 8. Khanna KK, Lavin MF, Jackson SP, et al. ATM, a central controller of cellular responses to DNA damage. Cell Death Diff. 2001;8: 1052–1065. 9. Stankovic T, Kidd AMJ, Sutcliffe A, et al. ATM mutations and phenotypes in ataxia-telangiectasia families in the British Isles: expression of mutant ATM and the risk of leukemia, lymphoma, and breast cancer. Am J Hum Genet. 1998;62:334 –345. 10. McConville CM, Stankovic T, Byrd PJ, et al. Mutations associated with variant phenotypes in ataxia-telangiectasia. Am J Hum Genet. 1996;59:320 –330. 11. Gatti RA, Tward A, Concannon P. Cancer risk in ATM heterozygotes: a model of phenotypic and mechanistic differences between missense and truncating mutations. Mol Genet Metab. 1999;68:419 – 422. 12. Barlow C, Eckhaus MA, Scha¨ffer AA, Wynshaw-Boris A. Atm haploinsufficiency results in increased sensitivity to sublethal doses of ionizing radiation in mice. Nat Genet., 1999;21:359 –360. 13. Chenevix-Trench G, Spurdle AB, Gatei M, et al. Dominant negative ATM mutations in breast cancer families. J Natl Cancer Inst. 2002;94:205–215. 14. Mauget-Fay¨sse M, Coquard R, Franc¸ais-Maury C, et al. Radiotherapy for age-related macular degeneration: risk factors, prevention and treatment of side-effects. J Fr Ophtalmol. 2000;23:127–136. 15. Mauget-Fay¨sse M, Chiquet C, Milea D, et al. Long term results of radiotherapy for subfoveal choroidal neovascularisation in age related macular degeneration. Br J Ophthalmol. 1999;83:923–928. 16. Liu Q, Somer SS. Restriction endonuclease fingerprinting (REF): A sensitive method for screening mutations in long, contiguous segments of DNA. Biotechniques. 1995;18:470 – 477. 17. Gilad S, Khosravi R, Harnik R, et al. Identification of ATM mutations using extended RT-PCR and restriction endonuclease fingerprinting, and elucidation of the repertoire of A-T mutations in Israel. Hum Mutat. 1998;11:69 –75.

IOVS, August 2003, Vol. 44, No. 8 18. Sandoval N, Platzer M, Rosenthal A, et al. Characterization of ATM gene mutations in 66 ataxia telangiectasia families. Hum Mol Genet. 1999;8:69 –79. 19. Laken S, Jackson PE, Kinzler KW, et al. Genotyping by mass spectrometric analysis of short DNA fragments. Nat Biotech. 1998; 16:1352–1356. 20. Maillet P, Vaudan G, Chappuis P, et al. PCR-mediated detection of a polymorphism in the ATM gene. Mol Cell Probes. 1999;13:67– 69. 21. Gilad S, Khosravi R, Shkedy D, et al. Predominance of null mutations in ataxia–telangiectasia. Hum Mol Genet. 1996;5:433– 439. 22. Menchini U, Virgili G, Bandello F, et al. Bilateral juxtafoveolar telangiectasis in monozygotic twins. Am J Ophthalmol. 2000;129: 401– 403. 23. Issacs TW, McAllister IL. Familial idiopathic juxtafoveolar retinal telangiectasis. Eye. 1996;10:639 – 642. 24. Leys A, Gilbert HD, Van De Sompel W, et al. Familial spastic paraplegia and maculopathy with juxtafoveolar retinal telangiectasis and subretinal neovascularization. Retina. 2000;20:184 –189. 25. Chew EY, Murphy RP, Newsome DA, et al. Parafoveal telangiectasis and diabetic retinopathy. Arch Ophthalmol. 1986;104:71–75. 26. Millay RH, Klein ML, Handelman IL, et al. Abnormal glucose metabolism and parafoveal telangiectasia. Am J Ophthalmol. 1986; 102:363–370. 27. Maberley DA, Yannuzzi LA, Gitter K, et al. Radiation exposure: a new risk factor for idiopathic perifoveal telangiectasis. Ophthalmology. 1999;106:2248 –2252; discussion 2252–2253. 28. Yannuzzi LA, Sorenson J, Spaide RF, et al. Idiopathic polypoidal choroidal vasculopathy (IPCV). Retina. 1990;10:1– 8. 29. Spaide RF, Yannuzzi LA, Sklater JS, et al. Indocyanine green videoangiography of idiopathic polypoidal choroidal vasculopathy. Retina. 1995;15:100 –110. 30. Uyama M, Mitsumasa W, Yoshimi N, et al. Apolypoidal choroidal vasculopathy: natural history. Am J Ophthalmol. 2002;133:639 – 648. 31. Lip PL, Hope-Ross MW, Gibson JM. Idiopathic polypoidal choroidal vasculopathy: a disease with diverse clinical spectrum and systemic associations. Eye. 2000;14:695–700. 32. Terasaki H, Miyake Y, Suzuki T, et al. Polypoidal choroidal vasculopathy treated with macular translocation: clinical pathological correlation. Br J Ophthalmol. 2002;86:321–327. 33. Spaide RF, Leys A, Hermann-Delemazure B, et al., Radiation-associated choroidal neovasculopathy. Ophthalmology. 1999;106: 2254 –2260. 34. Archer DB, Gardiner TA. Ionizing Radiation and the retina. Curr Opin Ophthalmol. 1994;5:59 – 65. 35. Maillet P, Chappuis PO, Vaudan G, et al. A polymorphism in the ATM gene modulates the penetrance of hereditary non-polyposis colorectal cancer. Int J Cancer. 2000;88:928 –931. 36. Hall EJ, Schiff PB, Hanks GE, et al. A preliminary report: frequency of A-T heterozygotes among prostate cancer patients with severe late responses to radiation therapy. Cancer J Sci Am. 1998;4:385–389. 37. Larson GP, Zhang G, Ding S, et al. An allelic variant at the ATM locus is implicated in breast cancer susceptibility. Genet Test. 1997–98;1:165–170. 38. Spurdle AB, Hopper JL, Chen X, et al. No evidence for association of ataxia-telangiectasia mutated gene T2119C and C3161G amino acid substitution variants with risk of breast cancer. Breast Cancer Res. [serial online]. 2002;4:R15. 39. Dork T, Bendix R, Bremer M, et al. Spectrum of ATM gene mutations in a hospital-based series of unselected breast cancer patients. Cancer Res. [serial online]. 2001;61:7608 –7615. 40. Laake K, Jansen L, Hahnemann JM, et al. Characterization of ATM mutations in 41 Nordic families with ataxia telangiectasia. Hum Mutat. 2000;16:232–246. 41. Grønbæk K, Worm J, Ralfkiaer E, et al. ATM mutations are associated with inactivation of the ARF-TP53 tumour suppresser in diffuse large B-cell lymphoma. Blood, 2002;100:1430 –1437. 42. Rotman G, Shiloh Y. ATM: from gene to function. Hum Mol Genet. 1998;7:1555–1563. 43. Yang DQ, Kastan MB. Participation of ATM in insulin signalling through phosphorylation of eIF-4E-binding protein 1. Nat Cell Biol. 2000;2:893– 898.