Ikaros Is Regulated through Multiple Histone Modifications and ...

0888-8809/07/$15.00/0 Printed in U.S.A.

Molecular Endocrinology 21(5):1205–1215 Copyright © 2007 by The Endocrine Society doi: 10.1210/me.2007-0053

Ikaros Is Regulated through Multiple Histone Modifications and Deoxyribonucleic Acid Methylation in the Pituitary Xuegong Zhu, Sylvia L. Asa, and Shereen Ezzat Department of Medicine (X.Z., S.E.), Mount Sinai Hospital and University of Toronto; Department of Pathology (S.L.A.), University Health Network and University of Toronto; and The Ontario Cancer Institute (X.Z., S.L.A., S.E.), Toronto, Ontario, Canada M5G 2M9 The transcription factor Ikaros (Ik) is at the center of a functionally diverse chromatin-remodeling network that is critical for the development and regulation of both the immune and endocrine systems. Dominant negative forms of Ik result in neoplastic growth in mouse genetic studies and have been identified in human tumors. Ik modulates chromatin accessibility through associations with members of the NURD complex including histone deacetylase complexes. We show here that Ik expression in mouse pituitary corticotroph cells is

itself regulated through histone modifications as well as DNA methylation. Examination of primary human pituitary specimens also identified a correlation of loss of Ik expression with the presence of DNA methylation in the untranslated exon 1 CpG island. These findings have important implications for the understanding of Ikaros’ role in epigenetic functions and suggest a potential role for demethylating agents in the treatment of related disorders. (Molecular Endocrinology 21: 1205–1215, 2007)

I

KAROS (Ik) IS THE founding member of a family of zinc-finger DNA-binding proteins and has been implicated in extensive chromatin remodeling (1). Genetic studies have established that Ik proteins play critical roles during development and homeostasis of the immune system (1, 2). More recently, a similar paradigm has been identified in the development and function of the hypothalamic-pituitary neuroendocrine system (3, 4). Ik is required to promote cell fate decisions in the hematopoietic stem cell, particularly along the lymphoid pathway (5). In differentiated mature lymphocytes, Ik functions as a tumor suppressor by negatively regulating proliferation (6, 7). Loss of Ik DNAbinding activity results in T-cell leukemias and lymphomas (1). Ik-deficient T cells display augmented responses to activating signals, whereas forced expression of Ik results in G1 arrest (8). However, Ik can also function as a potentiator of gene expression through recruitment of the Swi/Snf chromatin-remodeling complexes (9). In the endocrine system, loss of Ik leads to impaired activation of proopiomelanocortin hormone expression in pituitary corticotroph cells, resulting in loss of adrenocortical hormone production

and increased mortality (3). Ik is also essential for hypothalamic GHRH neuronal development, and Ikdeficient mice have reduced GHRH, a contracted pituitary somatotroph population, and dwarfism (4). Conversely, within the pituitary, Ik recruits a deacetylase complex and limits access of the pituitary transcription activator-1 to the proximal GH promoter while activating the prolactin promoter and facilitating pituitary transcription activator-1 binding to this region in mammosomatotroph pituitary cells (10). As in the immune system, the dominant negative isoform Ik6 is implicated in pituitary tumorigenesis where it is expressed in nearly 40% of human pituitary adenomas (11). In the current studies, we used mouse and human pituitary cells with variable levels of Ik expression (3) to examine putative mechanisms responsible for Ik regulation. Our data identify Ik targets, including histone modifications as well as DNA methylation, as important elements in the modulation of the Ik gene itself.

First Published Online March 6, 2007 Abbreviations: AcH3, Acetyl-histone 3; AcH4, acetyl-histone 4; 5-Aza-dC, 5-Aza-2⬘-deoxycytidine; ChIP, chromatin immunoprecipitation; CHX, cycloheximide; COBRA, combined bisulfite restriction analysis; CtBP, C-terminal binding protein; HDAC, histone deacetylase complex; Ik, Ikaros; MSP, methylation-specific PCR; RACE, rapid amplification of cDNA end; TSA, trichostatin-A. Molecular Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.

Ikaros Is Sensitive to Methylation and Deacetylation Inhibition

RESULTS

To determine potential epigenetic control in the regulation of Ik, we subjected pituitary AtT20 corticotroph cells to pharmacological treatment with the DNA methyltransferase inhibitor 5-Aza-2⬘-deoxycytidine (5Aza-dC) or the histone deacetylase complex (HDAC) inhibitor trichostatin-A (TSA). Both treatments significantly (⬃30-fold) up-regulated Ik protein levels as de1205

1206 Mol Endocrinol, May 2007, 21(5):1205–1215

Zhu et al. • Epigenetic Control of Ikaros

termined by Western blotting (Fig. 1, A and B) and by immunocytochemistry of treated cells (Fig. 1C). Studies of the 5⬘ end of Ik mRNA have revealed differential utilization of sequences encoded by untranslated exons 1a and 1b that are spliced independently to the first translated exon 2 (see Fig. 2). This differential exon utilization by hematopoietic cells is supported by two upstream promoter regions that lie in the vicinity of two DNA hypersensitivity sites (12). To map the transcription initiation

Fig. 2. Determination of the Ik Transcription Initiation Site in Mouse Pituitary Cells A, Total RNA from normal mouse pituitary cells, untreated pituitary corticotroph AtT20 cells, or those treated with 5-Aza-dC or TSA were subjected to 5⬘ RACE examination. A single product consistent with a common initiation site in pituitary cells was subjected to DNA sequencing. Note the potentiating effect of 5-Aza-dc or TSA treatment. B, The newly identified pituitary Ik start site (arrow). Primers used for 5⬘ RACE are shown in boxed areas. GATA-1, GATA binding protein-1; cap, catabolite activator protein; ADR1, alcohol dehydrogenase regulator.

Fig. 1. Effect of DNA Methyltransferase Inhibition or Histone Deacetylase Inhibition on Endogenous Ik Gene Expression A, Western blotting detects increased Ik protein expression in pituitary AtT20 corticotroph cells after treatment with 1, 5, and 10 ␮M 5-Aza-dC and 0.3 and 0.6 ␮M TSA. B, Ik protein concentrations were quantified by densitometry and graphically depicted as the mean ⫾ SE from three independent experiments. C, Treated cells were collected in pellets and fixed for immunohistochemistry using an antibody that recognizes the C terminus of Ik proteins. Ik immunoreactivity increased after treatment with 5 and 10 ␮M 5-Aza-dC and 0.3 and 0.6 ␮M TSA treatment. Ik(⫹) denotes a positive control of AtT20 cells transfected with the Ik cDNA.

site specifically in mouse pituitary cells, we used 5⬘ rapid amplification of cDNA end (RACE) and an oligonucleotide from within the coding region (Fig. 2B). RNA from normal mouse pituitary cells and from AtT20 corticotroph cells yielded a single product (Fig. 2A) that was sequenced to identify a new start site 140 bp upstream of the ATG translation site (Fig. 2B). This transcript differs from the two previously described start sites in hematopoietic cells (Fig. 3A). RT-PCR examination confirmed the newly identified transcription initiation site in normal mouse pituitary cells (Fig. 3B). No product was detectable using a forward primer situated in the previously described regions identified as “1a” (data not shown). The newly identified transcription start site in exon 1 was epigenetically down-regulated in pituitary corticotroph AtT20 tumor cells as evidenced by significant up-regulation after 5-Aza-dC or TSA treatment

Zhu et al. • Epigenetic Control of Ikaros

Mol Endocrinol, May 2007, 21(5):1205–1215 1207

The Ik Promoters Display Variable Degrees of DNA Promoter Methylation Using MethPrimer software (http://www.urogene.org/ methprimer/), we identified a CpG island containing 24 CpG sites in untranslated exon 1 and its 5⬘ upstream region (Fig. 4A). To examine the potential impact of DNA methylation in pituitary Ik regulation, we used bisulfite sequencing. As shown in Fig. 4B, we found the CpG island surrounding exon 1 to be methylated in AtT20 cells but not in normal mouse pituitary cells. The sensitivity of this region to DNA methylation inhibition was consistent with the data derived from 5-Aza-dC treatment. Examination of the 5⬘ region upstream of

Fig. 3. Effect of Methylation Inhibition or Histone Deacetylation Inhibition on Endogenous Ik mRNA Expression A, Schematic representation of the mouse Ik untranslated exon 1 and the previously described putative start sites depicted by interrupted bent arrows. The newly identified pituitary Ik start site is illustrated by a solid bent arrow. All numbering is based on GenBank accession no. AL 596450. Corresponding cDNA positions are shown in parentheses. Primers used for RT-PCR examination are illustrated immediately below. B, Normal mouse pituitary cells and pituitary AtT20 cells were treated with the methylation inhibitor 5-Aza-dC or the HDAC inhibitor TSA as indicated in Fig. 1 and detailed in Materials and Methods. Impact on mRNA expression was determined by RT-PCR using specific primers for exon 1 and compared with the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). C, Effect of 5-Aza-dC or TSA treatment on Ik protein and mRNA expression was examined without or with 3 h of pretreatment with CHX. CHX treatment abrogates new protein synthesis (upper panel) but does not interfere with 5-Aza-dC- or TSA-mediated mRNA induction (lower panel).

(Fig. 3B). To exclude the possibility that these agents served to stabilize mRNA and/or protein degradation, these experiments were repeated without or prior pretreatment with cycloheximide (CHX). CHX treatment alone failed to significantly impact Ik mRNA or protein expression (Fig. 3C). Although CHX pretreatment prevented protein induction by 5-Aza-dC or TSA, it failed to attenuate their impact on Ik mRNA levels (Fig. 3C). These findings formally prove that the effect of 5-Aza-dC or TSA is not governed by indirect mediating factors. They also suggest a potential role for histone modifications and a possible contribution from DNA methylation in the regulation of pituitary Ik expression.

Fig. 4. Effect of Methylation Inhibition or HDAC Inhibition on DNA Methylation of the Mouse Pituitary Ik Promoter A, Schematic representation of the CpG island in exon 1 and its associated promoter region. Specific CpG sites are indicated by individual marks and are numbered. B, DNA sequencing after bisulfite treatment revealed evidence of methylation (indicated by arrowhead) in AtT20 cells (unsuccessful C to T conversion) but not in normal pituitary cells (successful C to T conversion). C, DNA from 5-Aza-dCtreated cells (10 ␮M), untreated AtT20 cell,s and normal mouse pituitary was bisulfite treated before sequencing. Open circles represent unmethylated and closed circles methylated CpG dinucleotides. Each row represents an independent treatment and sequencing reaction. Potential CpG methylation sites inhibited by 5-Aza-dC treatment are shown by black circles. Nucleotide numbering is based on GenBank accession no. AL 596450.

1208

Mol Endocrinol, May 2007, 21(5):1205–1215

exon 2 contains TATA and CAAT boxes and a possible canonical promoter. Hence, we also examined the effect of 5-Aza-dC and TSA on exon 2. In contrast to exon 1, however, few if any methylated sites were identified in the 5⬘ upstream region of exon 2 in either normal mouse or AtT20 pituitary cells (Fig. 4C). Pituitary Ik Displays Selective Sensitivities to Histone Modifications To probe the potential importance of histone acetylation and/or histone methylation in impacting pituitary Ik regulation, we used a chromatin immunoprecipitation (ChIP) approach targeting the corresponding exon 1 and the 5⬘ upstream region of exon 2 corresponding to our DNA methylation analyses. ChIP examination of exon 1 showed that 5-Aza-dC treatment significantly abrogates histone methylation (Fig. 5, left panels). As

Zhu et al. • Epigenetic Control of Ikaros

expected, TSA treatment resulted in enhanced histone acetylation [acetyl-histone 3 (AcH3), acetyl-histone 4 (AcH4)]. However, TSA treatment also revealed that enhanced histone acetylation was associated with reciprocal reduction in histone methylation (Fig. 5, top left panel). In contrast to our findings on exon 1, exon 2 showed a more balanced degree of histone methylation and histone acetylation (Fig. 5, right panels). These findings are consistent with a contribution from histone methylation as well as histone acetylation in regulating pituitary Ik gene expression. Ik Is Down-Regulated by Hypermethylation in Human Pituitary Tumors To examine the physiological relevance of our findings, we extended our studies to the primary human pituitary gland. We used 5⬘ RACE to determine the

Fig. 5. Effect of Methylation Inhibition or HDAC Inhibition on Histone Methylation or Acetylation of the Mouse Ik Promoter by ChIP A, DNA from 5-Aza-dC-treated (5 or 10 ␮M), TSA-treated (0.3 or 0.6 ␮M), or control AtT20 cells was cross-linked and immunoprecipitated with methylation (MetH3-K9)-specific AcH3, AcH4, or control IgG antibodies followed by PCR amplification using primers specific for Ik exon 1 or exon 2 (B) as indicated in Figs. 3A and 4A. Input DNA represents PCR products without prior immunoprecipitation. DNA from plasmid was amplified as positive controls; negative controls omitted DNA template (data not shown). The bar graphs represent corresponding mean densitometric changes from at least three independent experiments.

Zhu et al. • Epigenetic Control of Ikaros

transcription start site in normal and tumorous pituitary specimens (Fig. 6A). The transcription start site in exon 1 is situated nearly 14 kb upstream of the trans-

Mol Endocrinol, May 2007, 21(5):1205–1215 1209

lation start site (Fig. 6A). This information was used for the design of RT-PCR examination of multiple normal and neoplastic pituitary specimens (Table 1) (Fig. 6B).

Fig. 6. Ik Is Silenced through Selective DNA Methylation in the Human Pituitary A, Identification of the Ik transcription start site in the human pituitary by 5⬘ RACE. A single product consistent with a common initiation site in a normal fetal pituitary and pituitary tumor was subjected to DNA sequencing (left panel). Specimen numbers in parentheses are listed in Table 1. The newly identified human pituitary Ik start site is indicated by the bracketed arrow. Primers used for 5⬘ RACE are underlined (right panel). All numbering is based on GenBank accession nos. AC142233 and NM006060. B, The human Ik untranslated exon 1 is located within a CpG island where individual CG sites are denoted by vertical bars below the graph. The dotted line indicates the regions examined by bisulfite sequencing and MSP as detailed in Materials and Methods. Sequence numbering follows GenBank accession no. AC142233. C, RT-PCR amplification of Ik mRNA expression was performed on primary human pituitary samples as listed in Table 1. D, MSP demonstrates changes in methylated (M) and unmethylated (U) DNA in normal pituitaries and pituitary tumors. The first lane, marked by (M), denotes a methylated positive control (Universal Methylated DNA). E, Both DNA and RNA were extracted from the same seven human pituitary tumor specimens represented by samples 43–49, followed by RT-PCR and MSP as indicated. M and U denote methylated and unmethylated products, respectively. Note that samples with detectable mRNA expression (specimens 46, 47, 49) are unmethylated, whereas those showing lack of mRNA abundance (44, 45, 48) are methylated. F, Summary of methylation ratio in Ik mRNA nonexpressing (⫺) and expressing (⫹) human pituitary specimens 43–49 shown in E. HSF, Heat shock transcription factor; cap, catabolite activator protein; ADR1, alcohol dehydrogenase regulator; PGK, phosphoglycerate kinase.

1210 Mol Endocrinol, May 2007, 21(5):1205–1215

Zhu et al. • Epigenetic Control of Ikaros

Table 1. List of Primary Human Pituitary Samples Case

mRNA analyses 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 DNA analyses 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 mRNA and DNA analyses 43 44 45 46 47 48 49

Sex

Pathologic Diagnosis

mRNA Expression

M F F M M F M F M F M M F F M F F M F F M

Normal adult Normal fetal Normal fetal Normal fetal Normal fetal Normal fetal Lactotroph adenoma (sparsely granulated) Corticotroph adenoma Lactotroph adenoma (sparsely granulated) Silent subtype 3 adenoma Mixed lactotroph-somatotroph adenoma Somatotroph adenoma (densely granulate) Lactotroph adenoma Lactotroph adenoma Oncocytoma Gonadotroph adenoma Somatotroph adenoma (sparsely granulated) Somatotroph adenoma (densely granulated) Somatotroph adenoma (densely granulated) Corticotroph adenoma Somatotroph adenoma (sparsely granulated)

⫺ ⫹ ⫺ ⫺/⫹ ⫹ ⫹ ⫺ ⫺ ⫹ ⫺ ⫹ ⫺/⫹ ⫺ ⫺ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺/⫹

F M M F M F F M F F M F M M M M F F F M M

Normal adult Normal adult Normal adult Normal adult Normal fetal Normal fetal Acidophil stem cell adenoma Gonadotroph adenoma Gonadotroph adenoma Lactotroph adenoma (sparsely granulated) Lactotroph adenoma (sparsely granulated) Somatotroph adenoma (sparsely granulated) Lactotroph adenoma (sparsely granulated) Somatotroph adenoma (sparsely-granulated) Gonadotroph adenoma Somatotroph adenoma (densely granulated) Lactotroph adenoma Corticotroph adenoma Corticotroph adenoma Lactotroph adenoma (sparsely granulated) Mixed lactotroph-somatotroph adenoma

M M M M M M M

Gonadotroph adenoma Oncocytic adenoma Oncocytic adenoma Gonadotroph adenoma Somatotroph adenoma (sparsely granulated) Lactotroph adenoma (sparsely granulated) Oncocytic adenoma

⫹ ⫺ ⫺ ⫹ ⫹ ⫺ ⫹

DNA Methylation

Methylation Ratio (%)

⫺ ⫺ ⫹ ⫹ ⫺ ⫺ ⫹ ⫺ ⫺/⫹ ⫹ ⫹ ⫺ ⫺ ⫹ ⫹ ⫺ ⫺ ⫹ ⫺/⫹ ⫹ ⫹

13 9 24 26 2 1 23 9 22 28 51 8 5 42 19 7 3 49 23 20 62

⫹ ⫹ ⫹ ⫺ ⫺ ⫹ ⫺/⫹

12 39 30 2 7 47 18

M, Male; F, female; ⫹, strong; ⫺, negative; ⫺/⫹, intermediate.

Indeed, four of five normal human fetal pituitary specimens expressed Ik mRNA transcripts (Fig. 6C). In contrast, Ik mRNA expression was down-regulated in 11 of 22 (⬃50%) of pituitary tumor samples (Fig. 6, C, E, and F).

The human Ik exon 1 region also contains a CpG island (Fig. 6B). Thus, we used methylation-specific PCR (MSP) and bisulfite sequencing to detect the methylation status of human pituitary specimens. MSP examination revealed lack of methylation of Ik in two of

Zhu et al. • Epigenetic Control of Ikaros

Mol Endocrinol, May 2007, 21(5):1205–1215 1211

two fetal pituitaries (26 and 27) and two of four (22 and 23) normal adult pituitary samples (Fig. 6D). In contrast, 13 of 22 (59%) human pituitary tumors demonstrated evidence of DNA methylation (Fig. 6, D and E). Moreover, in tumors in which DNA and RNA were available from the same samples, we performed parallel RT-PCR and MSP analysis. This examination confirmed that, with a single exception (sample 43), samples with detectable Ik mRNA expression (tumors 46, 47, and 49) were unmethylated (Fig. 6E). In contrast, tumors with Ik mRNA down-regulation (tumors 44, 45, and 48) showed evidence of exon 1 CpG island methylation (Fig. 6, E and F). We also examined the degree of methylation using combined bisulfite restriction analysis (COBRA) (Fig. 7). The human Ik 5⬘ region contains 28 CpG sites that were examined by bisulfite sequencing (Fig. 7A). Figure 7B shows a string on a bead representation of the individually detected methylation sites in a representative human fetal pituitary and a pituitary tumor. This region includes potential Taq1-generated sites as depicted in Fig. 7C. The same COBRA analysis was also performed on samples from which sufficient RNA and DNA were available (samples 43–49). Figure 7E summarizes the mean of degree of DNA methylation identified by COBRA examination in human pituitary specimens. The average level of methylation was estimated at nearly 18% and 26% in adult normal and tumorous tissue, respectively, with possibly lower degree in fetal pituitary tissue (Fig. 7, C and E).

DISCUSSION Our studies indicate that the mechanisms through which Ik has been implicated to affect its repressive functions are also involved in governing Ik expression itself. Ik repressive functions are largely determined by its ability to recruit HDAC complexes. Here we show that HDAC activity significantly impacts Ik gene regulation itself. We also provide evidence that histone methylation as well as DNA methylation are also involved in governing Ik gene expression. It has been estimated that nearly 70% of all CpG dinucleotides in the mammalian genome are methylated (13). The remaining unmethylated CpG residues are mostly located in the promoter regions of constitutively active genes referred to as CpG islands. DNA methylation is well known to have a transcriptional silencing function, and this mechanism of silencing tumor suppressors plays an important role in several tumorigenic states. This is mediated, in part, by recruitment of HDACs through the methyl-DNA binding motifs of components of several HDAC-containing complexes (14). More recently, direct functional links between DNA and histone methylation have also been uncovered. Indeed, genetic evidence indicates that histone methylation maybe a prerequisite for DNA methylation (15). Loss of DNA methylation affecting

Fig. 7. Differential Degrees of DNA Methylation in the Normal and Neoplastic Human Pituitary A, The human Ik 5⬘ region containing 28 CpG sites was examined by bisulfite sequencing. B, A string on a bead representation of the individual detected methylation sites in pituitary tumors and normal human pituitary is shown. C, The degree of DNA methylation in normal and neoplastic pituitary specimens was quantified by COBRA. Note that the degree of and site of methylation results in variable Taq1-generated products. D, The same COBRA analysis was performed on samples from which sufficient RNA and DNA (samples 43–49) permitted RT-PCR and MSP examination (see Fig. 6E and Table 1). E, Summary of mean ⫾ SE of degree of DNA methylation by COBRA examination in human pituitary specimens.

H3-Lys 9 and other histone modifications have also been found in human cells (16). These findings have supported the view that DNA and histone methylation likely have a reinforcing relationship with both being required for stable epigenetic silencing. The current studies extend these observations, documenting evidence for both DNA methylation as well as histone modifications in targeting the pituitary Ik exon1 region. Histone protein acetylation plays a crucial role in regulating transcriptional activity. Acetylation complexes (such as cAMP response element binding protein binding protein/p300) or deacetylation complexes (including HDACs) are typically recruited to DNA-bound transcription factors in response to signaling pathways. Histone

1212

Mol Endocrinol, May 2007, 21(5):1205–1215

hyperacetylation by histone acetyltransferases are typically associated with transcriptional activation, presumably by remodeling the nucleosomal structure into an open conformation that is more accessible to transcription complexes. Conversely, HDAC recruitment is associated with transcriptional repression reversing the chromatin remodeling process. This gene repression can be cell type- and promoter-specific. The ability of Ik to repress gene transcription has been described to occur through the HDAC complexes containing mSin3 (17) and Mi-2 proteins (18). Some of the earlier findings of histone underacetylation in the vicinity of Ik recruitment sites (17) are consistent with the importance of HDAC in mediating Ik action. Forced Ik expression also potently abrogates pharmacologically mediated HDAC inhibition on several promoters including that for the cell survival signal encoded by Bcl-XL (19). Ik has also been implicated in human neoplasia through expression of a non-DNA-binding isoform. This dominant negative Ik6 isoform has been identified in nearly a third of human T-cell acute leukemia cases. Ik6 has also been detected in acute myeloid leukemia, where it has been shown to enhance myeloid precursor cells to activate Bcl-XL (20). The importance of these findings has been supported by genetic studies in animals in which heterozygous dominant negative forms of Ik recapitulate lymphoproliferative disorders, presumably through inactivation of the wild-type Ik allele (6). Ik6 is also expressed in nearly 40% of human pituitary tumors (11), in which we have shown it to play a role in up-regulating an antiapoptotic signal (19). Interestingly, our current data show that the human endogenous Ik gene is also subject to DNA-methylation control in the pituitary gland. Moreover, our data show for the first time that the human promoter driving Ik expression in the pituitary is methylated to a frequency and degree that correlates with its extent of expression. Thus, specimens that failed to show detectable levels of Ik mRNA expression were more likely to show evidence of significant promoter DNA hypermethylation. Conversely, human fetal pituitaries and primary adenomas that expressed Ik mRNA transcripts showed lack of evidence of methylation. Ik may exert repressive functions through interactions with other corepressors such as C-terminal binding protein (CtBP). However, mutations that block Ik/ CtBP interactions do not completely abolish Ik’s repressive functions on engineered promoters. Ik is known to interact with other corepressors including CtBP-interacting protein (21). CtBP-interacting protein association with Ik’s exon 7-encoded C terminus does not require CtBP but relies heavily on intact Rb. Epigenetic silencing of tumor suppressors has emerged as an important theme in a variety of human tumors (22, 23). The current studies elucidate potential mechanisms by which the zinc finger transcription factor Ik itself can be epigenetically regulated. Given the established role of Ik in developmental and neoplastic

Zhu et al. • Epigenetic Control of Ikaros

conditions, our findings will provide insight into mechanisms by which Ik and its actions can be manipulated for experimental and therapeutic purposes.

MATERIALS AND METHODS Cells and Cell Culture Pituitary corticotroph AtT20 cells were grown in Ham’s F-10 medium supplemented with 15% horse serum and 2.5% fetal calf serum (all from Sigma, St. Louis, MO) with 2 mM glutamine, 100 IU/ml penicillin, and 100 ␮g/ml streptomycin (37 C, 95% humidity, 5% CO2 atmosphere incubation). Primary mouse pituitary cells and stably transfected Ik1 AtT20 clones were generated using standard selection techniques as previously described (10, 11). Primary human fetal and adult pituitary specimens were collected at the time of autopsy after informed consent and Institutional Research Board approval. Their details are listed in Table 1. 5-Aza-dC, TSA, and CHX Treatments AtT20 cells were plated at 1⫻106 cells in a 10-cm dish. For assessment of impact of DNA methylation, cells were treated with freshly prepared 1, 5, and 10 ␮M of the DNA methyltransferase inhibitor 5-Aza-dC (Sigma) for 5 d. At 48-h intervals, fresh medium containing the drug was added. For assessment of chromatin histone acetylation, cells were treated with 0.3 and 0.6 ␮M of the histone deacetylase inhibitor TSA (Sigma) for 24 h. For CHX (5 ␮g/ml; Sigma) experiments, cells were pretreated for 3 h without or with subsequent treatment with 5-Aza-dC or TSA as indicated above. Each experiment was independently performed in three separate dishes in at least three independent experiments. Western Blotting Cells were lysed with RIPA buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 100 ␮g/ml phenylmethylsulfonyl fluoride, aprotinin, and sodium orthovanadate in PBS). Total-cell lysates were quantified by the Bio-Rad (Hercules, CA) method. Fifty micrograms of whole lysates were separated on 10% sodium dodecyl sulfate denaturing polyacrylamide gels and transferred onto nylon membrane (Millipore, Billerica, MA) at 100 v for 1.5 h at room temperature. Blots were incubated with a mouse monoclonal antibody (4E9; kindly provided by K. Georgopoulos, Harvard University, Boston, MA) that recognizes the C-terminal fragments of Ik proteins (24), at 1:2000 dilution in PBS-5% nonfat milk with 0.1% Tween at 4 C overnight, followed by four 10-min washes with PBSTween 20 at room temperature. Blots were then incubated with secondary antibody of peroxidase-conjugated goat antimouse IgG (1:2000) for 1 h at room temperature with agitation. Protein bands were visualized using chemiluminescence (Amersham, Oakville, Ontario, Canada), and band intensities were quantified by Quantity One Software (Bio-Rad). Immunocytochemistry Ik expression by treated cells was also examined by immunocytochemistry on 4-␮m sections of cell pellets. Briefly, sections were treated with 2% hydrogen peroxide to quench endogenous peroxide for 30 min and exposed to 5 ␮g/ml of proteinase K for 15 min at room temperature. The sections were washed extensively and exposed to equilibration buffer

Zhu et al. • Epigenetic Control of Ikaros

Mol Endocrinol, May 2007, 21(5):1205–1215 1213

for 10 min. Each slide was then incubated with anti-Ik antibody (polyclonal antibody kindly provided by S. Smale (UCLA, Los Angeles, CA) at 1:10,000 dilution) at 4 C overnight. RNA Extraction and Hemiquantified RT-PCR Total RNA was isolated from 5-Aza-dC- or TSA-treated AtT20 cells and human pituitary normal and tumor tissue using TriZol reagents (Invitrogen Corp., Carlsbad, CA) according to the manufacturer’s instructions. Approximately 1.0 ␮g of total RNA from each sample was used to conduct the reverse transcription reaction in a 20-␮l vol using TaqMan reverse transcription reagents kit (Applied Biosystems, Inc., Branchburg, NJ). The reaction mixture was incubated at 25 C for 10 min, 42 C for 30 min, and 95 C for 5 min. The synthesized cDNA was used for PCR amplification or stored at ⫺20 C for further analysis. RTPCR primers were designed from the transcription exon 1 start site to the common translation region in exon 3 (Figs. 3A and 6A and Table 2). PCRs were carried out for 10 min at 95 C followed by 38 cycles of 30 sec at 95 C, 45 sec at annealing temperature, and 45 sec at 72 C, followed by a 10-min extension at 72 C. PCRs were performed in a 15-␮l vol containing 1.5 mM of MgCl2, 0.2 mM of dNTP, 0.2 mM of each primer, and 0.375 U of Taq polymerase (Applied Biosystems, Foster City, CA). RT-PCR examinations were independently performed in at least three independent experiments. 5ⴕ RACE First-strand cDNA was generated by reverse transcription from 1 ␮g of total RNA using PowerScript reverse tran-

scriptase and 5⬘-CDS polyadenylic acid and SMART II A primers (Clontech Laboratories Inc., Palo Alto, CA). Dilutions of each cDNA were used in primary PCR amplification reactions with the SMART RACE kit sense primer (Universal Primer Mix A) and the gene-specific antisense primer (“RACE outer”). PCR conditions were 94 C for 30 sec, 72 C for 2 min (five cycles), and 94 C for 30 sec, 70 C for 30 sec, 72 C for 2 min (five cycles), followed by 94 C for 30 sec, 68 C for 30 sec, 72 C for 2 min (28 cycles). Diluted primary PCR products were used in nested secondary PCR amplification with the SMART RACE kit sense primer (Nested Universal Primer A) and the gene-specific antisense primer (“RACE inner”). For secondary PCR, the conditions were 94 C for 30 sec, 68 C for 30 sec, and 72 C for 2 min (28 cycles). PCR products were cut from gels, extracted, and cloned into the TA cloning system (Invitrogen) for DNA sequencing. ChIP Assays The ChIP assay was performed in accordance with the manufacturer’s recommendations (Upstate Biotechnology, Lake Placid, NY) and as previously described (11). Briefly, histone was cross-linked to DNA by the direct addition of 37% formaldehyde in cells, and cells were washed with cold PBS containing protease inhibitors before lysing cells and the lysates were sonicated to shear DNA lengths between 200 and 1000 bp. After centrifugation, cell suspensions were further diluted and 20 ␮l of lysate from each sample was kept and used to quantitate the amount of DNA present (input DNA) for PCR detection. The rest of the lysate was cleared with salmon sperm DNA/protein G-

Table 2. List of Primers and PCR Conditions Primer

5⬘Rapid amplification of cDNA ends Mouse RACE out Mouse RACE inner Human RACE out Human RACE inner RT-PCR Mouse RT Mouse GAPDH Human RT Human PGK Bisulfite sequencing (BS) and COBRA Mouse exon1 BS (out) Mouse exon1 BS (inner) Mouse exon2 BS Human BS and COBRA (out) Human BS and COBRA (inner) MSP Human methylated (M) Human unmethylated (U) ChIP ChIP exon1 ChIP exon2

Forward (5⬘–3⬘)

Reverse (5⬘–3⬘)

Tm (C)

Product (bp)

ccccttcatctggagtgtcactgactgg cttgggacatgtcttgaccctcatcgac tcgccctcatctggagtatcgcttacag ggacatgtcttgaccctcatcagcatcc gatcattcttggcccccaaag atcactgccacccagaagact ggatcagtcttggccccaaag gctgacaagtttgatgagaat

gatcactcttggagttctgctgtg catgccagtgagcttcccgtt cactcttggagctttgctgtcctc aggactttaccttccaggagc

58 56 61 58

204 152 202 338

gagtgagtaatttgaggaagttattgtg agttattgtgaaagaaagttgggaattg

tccaccaattatcccaaatttttctac tccaccaattatcccaaatttttctac

58 58

301

tggtggagtttgtagttagagttgaagag aaacacaaaattcattctcttaactaatcc gagtgagtaattttaggaagttattgtg gagtgagtaattttaggaagttattgtg

58 56

280

agttattgtgaaagaaagttgggaagag

tcctattaaaattcaatttaaaaacactc

56

289

gtagggtagagggagtttcggtttc tagggtagagggagttttggttttga

cactcacgtaaatttatacgtcgcg acactcacataaatttatacatcacact

59 57

92 92

cattgtgaaagaaagctgggaattg ggacaaggacagagcgtgtattg

tccaccagttatcccaagtttttc cttcacatacttgctggggtatcag

55 58

298 450

RT, Reverse transcriptase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PGK, phosphoglycerate kinase; Tm, annealing temperature.

1214 Mol Endocrinol, May 2007, 21(5):1205–1215

agarose beads. Immunoprecipitation was performed using anti-AcH3, anti-AcH4, or anti-methyl-histone 3 (Lys9) antibodies (all from Upstate Biotechnology). Incubation with antibody was carried out overnight at 4 C with agitation. Negative controls included either omission of antibody or use of an anti-IgG antibody. For PCR analysis, the histoneDNA cross links of eluates were reversed at 65 C, the immunocomplexes were digested with proteinase K for 1 h at 50 C, and DNA was finally purified by phenol extraction and used for PCR amplification. PCRs were designed to amplify the corresponding CpG island region of exon 1 and the possible canonical promoter region upstream of exon 2 as indicated in Fig. 4A and Table 2. Experiments were performed on three independent occasions with product intensities quantified by scanning densitometry (Quantity One Software; Bio-Rad). Bisulfite Sequencing and MSP One microgram of genomic DNA was bisulfite-modified according to the manufacturer’s protocol (Chemicon International, Temecula, CA) diluted in 25 ␮l vol. One microliter of modified DNA was used for bisulfite sequencing and MSP. Nested PCR was performed to amplify mouse and human CpG island of exons 1 and the putative promoter region upstream of exon 2, as illustrated in Figs. 4A and 6A, which also corresponded to the regions examined by ChIP analyses in the mouse studies. Primer sequences and PCR conditions are indicated in Table 2. The first round of PCRs were carried out in a 10-␮l vol and the second round in a 50-␮l vol using 1 ␮l of the first product as template. All reactions contained 1.5 mM of MgCl2, 0.2 mM of dNTP, 0.2 mM of each primer, and 0.25 U and 1.25 U of AmpliTaq Gold polymerase (Applied Biosystems). Final PCR products were cut from gels, extracted, and cloned into the TA cloning system (Invitrogen) for automated sequencing. For MSP, unmethylated reactions were carried out as for bisulfite sequencing reactions but using different annealing temperatures (Table 2), but the methylated reaction used 5.0 mM of MgCl2. All reactions were performed on at least three independent occasions. Quantification of Degree of DNA Methylation The DNA methylation level was measured by COBRA. Briefly, bisulfite-treated DNA was PCR amplified to cover the 28 CpG sites where alternative methylation at sites 22 and 24 would be expected to generate multiple Taq1 products (Fig. 7D). Specifically, digestion by Taq1 could generate 197-, 92-, 216-, or 73-bp products (Fig. 7B). To this end, 10 ␮g of purified bisulfite PCR products were incubated in a 15-␮l vol reaction with 5 U of Taq1 (Roche, Penzberg, Germany) overnight at 65 C. Restriction digestion products were separated on 2.5% agarose gels, followed by UV exposure. Experiments were performed on three independent occasions after which product intensities were quantified by scanning densitometry (Quantity One Software; Bio-Rad). The digested bands (methylated) intensity divided by all products (methylated ⫹ unmethylated) yielded the methylation level (% ratio).

Acknowledgments We thank Drs. K. Georgopoulos and S. Smale for generously providing Ik antibodies.

Received January 26, 2007. Accepted February 26, 2007. Address all correspondence and requests for reprints to: Dr. Shereen Ezzat, Ontario Cancer Institute, 610 University

Zhu et al. • Epigenetic Control of Ikaros

Avenue, 8-327, Toronto, Ontario, Canada M5G 2M9. E-mail: [email protected]. This work was supported by the Canadian Institutes of Health Research. Disclosure Summary: The authors have nothing to disclose.

REFERENCES 1. Georgopoulos K 2002 Haematopoietic cell-fate decisions, chromatin regulation and ikaros. Nat Rev Immunol 2:162–174 2. Gomez-del Arco P, Koipally J, Georgopoulos K 2005 Ikaros SUMOylation: switching out of repression. Mol Cell Biol 25:2688–2697 3. Ezzat S, Mader R, Yu S, Ning T, Poussier P, Asa SL 2005 Ikaros integrates endocrine and immune system development. J Clin Invest 115:1021–1029 4. Ezzat S, Mader R, Fischer S, Yu S, Ackerley C, Asa SL 2006 An essential role for the hematopoietic transcription factor Ikaros in hypothalamic-pituitary-mediated somatic growth. Proc Natl Acad Sci USA 103: 2214–2219 5. Nichogiannopoulou A, Trevisan M, Neben S, Friedrich C, Georgopoulos K 1999 Defects in hemopoietic stem cell activity in Ikaros mutant mice. J Exp Med 190: 1201–1214 6. Winandy S, Wu P, Georgopoulos K 1995 A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell 83:289–299 7. Winandy S, Wu L, Wang JH, Georgopoulos K 1999 Pre-T cell receptor (TCR) and TCR-controlled checkpoints in T cell differentiation are set by Ikaros. J Exp Med 190: 1039–1048 8. Avitahl N, Winandy S, Friedrich C, Jones B, Ge Y, Georgopoulos K 1999 Ikaros sets thresholds for T cell activation and regulates chromosome propagation. Immunity 10:333–343 9. Koipally J, Georgopoulos K 2000 Ikaros interactions with CtBP reveal a repression mechanism that is independent of histone deacetylase activity. J Biol Chem 275:19594–19602 10. Ezzat S, Yu S, Asa SL 2005 The zinc finger Ikaros transcription factor regulates pituitary growth hormone and prolactin gene expression through distinct effects on chromatin accessibility. Mol Endocrinol 19: 1004–1011 11. Ezzat S, Yu S, Asa SL 2003 Ikaros isoforms in human pituitary tumors: distinct localization, histone acetylation, and activation of the 5⬘ fibroblast growth factor receptor-4 promoter. Am J Pathol 163:1177–1184 12. Kaufmann C, Yoshida T, Perotti EA, Landhuis E, Wu P, Georgopoulos K 2003 A complex network of regulatory elements in Ikaros and their activity during hemo-lymphopoiesis. EMBO J 22:2211–2223 13. Li E 2002 Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3:662–673 14. Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A 1998 Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393:386–389 15. Jackson JP, Lindroth AM, Cao X, Jacobsen SE 2002 Control of CpNpG DNA methylation by the KRYPTONITE histone H3 methyltransferase. Nature 416: 556–560 16. Espada J, Ballestar E, Fraga MF, Villar-Garea A, Juarranz A, Stockert JC, Robertson KD, Fuks F, Esteller M 2004 Human DNA methyltransferase 1 is required for maintenance of the histone H3 modification pattern. J Biol Chem 279:37175–37184

Zhu et al. • Epigenetic Control of Ikaros

17. Koipally J, Renold A, Kim J, Georgopoulos K 1999 Repression by Ikaros and Aiolos is mediated through histone deacetylase complexes. EMBO J 18:3090–3100 18. Kim J, Sif S, Jones B, Jackson A, Koipally J, Heller E, Winandy S, Viel A, Sawyer A, Ikeda T, Kingston R, Georgopoulos K 1999 Ikaros DNA-binding proteins direct formation of chromatin remodeling complexes in lymphocytes. Immunity 10:345–355 19. Ezzat S, Zhu X, Loeper S, Fischer S, Asa SL 2006 Tumorderived Ikaros 6 acetylates the Bcl-XL promoter to upregulate a survival signal in pituitary cells. Mol Endocrinol 20:2976–2986 20. Yagi T, Hibi S, Takanashi M, Kano G, Tabata Y, Imamura T, Inaba T, Morimoto A, Todo S, Imashuku S 2002 High frequency of Ikaros isoform 6 expression in acute my-

Mol Endocrinol, May 2007, 21(5):1205–1215 1215

21.

22. 23. 24.

elomonocytic and monocytic leukemias: implications for up-regulation of the antiapoptotic protein Bcl-XL in leukemogenesis. Blood 99:1350–1355 Koipally J, Georgopoulos K 2002 Ikaros-CtIP interactions do not require C-terminal binding protein and participate in a deacetylase-independent mode of repression. J Biol Chem 277:23143–23149 Alexander JM 2001 Tumor suppressor loss in pituitary tumors. Brain Pathol 11:342–355 Asa SL, Ezzat S 2002 The pathogenesis of pituitary tumours. Nat Rev Cancer 2:836–849 Sun L, Liu A, Georgopoulos K 1996 Zinc finger-mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development. EMBO J 15:5358–5369

Molecular Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.