Imatinib induces mitochondria-dependent ... - The FASEB Journal

Download PDF
1 downloads 0 Views 1MB Size Report
Comment
*INSERM U526, Physiopathologie de la Survie et de la Mort Cellulaires et Infections Virales Equipe. Labellisée par la Ligue Nationale contre le Cancer, #EPI ...
The FASEB Journal express article 10.1096/fj.03-0322fje. Published online September 4, 2003.

Imatinib induces mitochondria-dependent apoptosis of the Bcr-Abl positive K562 cell line and its differentiation towards the erythroid lineage Arnaud Jacquel,* Magali Herrant,* Laurence Legros,‡ Nathalie Belhacene,* Frederic Luciano,* Gilles Pages,‡ Paul Hofman,† and Patrick Auberger* *INSERM U526, Physiopathologie de la Survie et de la Mort Cellulaires et Infections Virales, Equipe Labellisée par la Ligue Nationale contre le Cancer, Faculté de Médecine, Avenue de Valombrose, 06107 Nice-Cedex 2, France; †EPI 0215, IFR50, Faculté de Médecine, Avenue de Valombrose, 06107 Nice-Cedex 2, France; and ‡UMR 6543 Centre Antoine Lacassagne, Avenue de Valombrose, 06107 Nice, France Corresponding author: Patrick Auberger, INSERM U526, Physiopathologie de la Survie et de la Mort Cellulaires et Infections Virales Equipe Labellisée par la Ligue Nationale contre le Cancer, 06107 Nice-Cedex 2, France. E-mail: [email protected] ABSTRACT Imatinib has emerged as the lead compound for clinical development against chronic myeloid leukemia. Imatinib inhibits the kinase activity of Bcr-Abl, which functions by enhancing the proliferation of hematopoietic precursors and protecting them against apoptosis. Imatinib induces apoptosis of Bcr-Abl positive cells, but how the drug effectively kills these cells remains partially understood. We show here that in K562 cells imatinib i) abolished Bcr-Abl phosphorylation and activity and as a consequence Erk1/2, JNK, and AKT activation; ii) induced mitochondrial transmembrane permeability dissipation; iii) activated caspases 3, 9, and 8, demonstrating that the effect of imatinib is integrated at the mitochondrial level; and iv) triggered caspase-dependent cleavage of Bcr-Abl. Interestingly, imatinib-mediated apoptosis was accompanied by erythroid differentiation of K562 cells. Moreover, phorbol esters inhibited imatinib-induced cell death and promoted differentiation toward the megakaryocytic lineage. Finally, we determined by c-DNA array analysis that more than 20 genes were modulated by imatinib. These genes are involved in both cell death and differentiation programs, and some of them have never been reported before to be expressed or involved in erythroid differentiation. Our results demonstrate that imatinib is responsible for a major modification of the genetic program resulting in death and/or differentiation of K562 cells. Key words: apoptosis • signal transduction • erythroid differentiation • c-DNA array

C

hronic myelogenous leukemia (CML) arises from the reciprocal t(9 ;22)(q34 ;11) chromosomal translocation in pluripotent hematopoietic stem cells (1–3). The Bcr-Abl oncogene generated from this translocation encodes a p210Bcr-Abl protein exhibiting elevated tyrosine kinase activity and abnormal localization. p210Bcr-Abl activates multiple signaling pathways, including among others PI3K/AKT, Stat5, and the Ras/MEK/Erk1/2 pathways, thus confering growth factor-independent proliferation and survival of myeloid progenitor cells.

The human CML cell line K562 has been used extensively as model for the study of leukemia differentiation. K562 cells behave as a pluripotent hematopoietic precursor, expressing in unstimulated conditions, markers for both erythroid, granulocytic, monocytic, and megakaryocytic lineages (4–6). It was established from the pleural extravasation of a patient with CML in blast crisis, and as such expresses the chimaeric Bcr-Abl tyrosine kinase whose high constitutive activity is thought to play a crucial role in the genesis of CML. K562 cells can undergo differentiation in both megakaryocytic and erythroid lineages depending on the stimulus. For example, phorbol esters stimulate megakaryocytic differentiation, whereas hemin or hydroxyurea induce erythroid differentiation of this cell line (7-9). Although MAPK activation is thought to be important for differentiation of K562 cells toward the megakaryocytic lineage (10), little is known about the molecular mechanisms underlying differentiation of this cell line toward the erythroid lineage, even though a recent study suggested that activation of the p38MAPK pathway may play a role in signal transduction mechanisms leading to erythroid differentiation (9). Imatinib was synthesized at Novartis and has emerged as the lead compound for clinical development against CML cells. Imatinib inhibits the kinase activity of Bcr-Abl (11, 12). BcrAbl functions by enhancing the proliferation of hematopoietic precursors or by protecting such progenitors against programmed cell death (13–15). Accordingly, it has been reported that imatinib induces apoptosis of Bcr-Abl positive cells in vitro and in vivo (16,17), but the mechanism by which the drug effectively kills Bcr-Abl positive cells remains only partially understood. K562 cells express the p210Bcr-Abl protein and can be induced by various stimuli to differentiate toward the megakaryocytic or erythroid lineage, and as such represent an appropriate cellular model to evaluate the relationships between apoptotic and differentiation programs in leukemia. In this context an interesting and still unexplored question concerns the influence that differentiation and apoptosis have on each other in CML cell lines. In the present study, using K562 cells as a cellular model of CML differentiation toward different lineages, we show that imatinib abolished Bcr-Abl phosphorylation and activity and as a consequence ERK1/2, JNK, and AKT activation—all events leading to mitochondria-mediated cell death. We also evidenced that imatinib-mediated apoptosis was accompanied by erythroid differentiation of K562 cells. Simultaneous addition of PMA and imatinib led to ERK1/2 and JNK activation, inhibition of imatinib-induced apoptosis, and megakaryocytic differentiation, demonstrating that phorbol esters can inhibit cell death induced by imatinib and can redirect differentiation toward the megakaryocytic lineage. Finally, c-DNA array analysis allowed us to characterize a panel of genes whose expression is modulated by imatinib. Some of them have never before been reported to be involved in erythroid differentiation. Their potential role in the regulation of the apoptotic and differentiation programs of K562 cells is discussed. MATERIALS AND METHODS Reagents and antibodies Imatinib (STI571, Gleevec) was provided by Novartis Pharma (Basel, Switzerland). A stock solution of 1 mM was prepared by dissolving the compound in DMSO and was stored at –20°C. RPMI and fetal calf serum (FCS) were purchased from GIBCO BRL (Paisley, U.K.). The fluorescent dye 3,3′-dihexyloxacarbocyanine iodide [DiOC6(3)] and bisindolylmaleimide-I (GF109203X) were obtained from Calbiochem (La Jolla, CA). Phorbol 12-myristate 13-acetate

(PMA), sodium fluoride, sodium orthovanadate, phenylmethylsulfonyl fluoride, aprotinin, and leupeptin were purchased from Sigma (St. Quentin Fallavier, France). RNase and proteinase K were from Roche Molecular Biochemicals (Meylan, France). RPMI and fetal calf serum (FCS) were from Life Technologies Inc. (Cergy Pontoise, France). Antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); anti-caspase 8 antibody was from Oncogene Research Products (La Jolla, CA) products; and anti-caspase 3 antibody was from Transduction Laboratories (Lexington, KY). Phospho-Erk1/2, phospho-p38, phospho-Akt antibodies were purchased from Cell Signaling Technology (Beverly, MA) and phospho-JNK from New England BioLabs (Beverly, MA). Peroxidase-conjugated anti-rabbit, anti-mouse, and anti-goat antibodies were from Dakopatts (Trappes, France). Enhanced chemiluminescent detection system was provided by Amersham (Les Ulis, France). Cells The human cell line K562 was cultured in RPMI 1640-glutamax supplemented with 5% FCS, 50 units/ml penicillin, 50 µg/ml streptomycin, and 1 mM pyruvate under 5% CO2/95% air in an humidified incubator (8). DNA fragmentation K562 cells exposed to the different effectors were collected and lysed in 200 µl of lysis buffer containing 10 mM Tris (pH 7.5), 1 mM EDTA, and 0.2% Triton X-100. Samples were treated with 100 µg/ml RNase for 30 min at 37°C and then treated with 100 µg/ml proteinase K for 30 min as described previously (20, 21). Cellular DNA was isopropanol-precipitated, dried, resuspended in Tris-EDTA buffer, and incubated for 30 min at 55°C. DNA was analyzed by electrophoresis on 1.2% agarose gels containing ethidium bromide. Caspase activity measurement Each assay (in triplicate) was performed with 50 µg of protein prepared from control cells or cells stimulated for different times with 10 ng/ml PMA, 1 µM imatinib, or the combination of both effectors. Briefly, cellular extracts were then incubated in a 96-well plate, with 0.2 mM of Ac-DEVD-pNA (Caspases 3, 6, and 7) or Ac-LEHD-pNa (Caspase 9) or Ac-IETD-pNa (Caspase 8) as substrates for various times at 37°C as described previously (22). Caspase activity was measured at 405 nm in the presence or the absence of either 1 µM of Ac-DEVD-CHO, AcLEHD-CHO, or Ac-IETD-CHO when necessary. The specific caspase activity was expressed in nanomoles of paranitroaniline released per minute and per milligram of protein. Western blot assays K562 cells were incubated with different effectors for the times indicated in the figure legends and then lysed in buffer B containing 50 mM HEPES (pH 7.4), 150 mM NaCl, 20 mM EDTA, 100 µM NaF, 10 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 1 mM leupeptin, 20 µg/ml aprotinin, and 1% Triton X-100. Protein (100 µg) was separated on 10% polyacrylamide gel, transferred to PVDF membrane (Immobilon, Millipore (St. Quentin en Yvelines, France; 22). After blocking non-specific binding sites, the membranes were incubated with specific antibodies. They were washed three times with TNA-1% NP-40 (Tris 50 mM, NaCl 150 mM, pH 7.5) incubated further with horseradish peroxidase-conjugated antibody for 60 min at room

temperature. Immunoblots were revealed chemiluminescence detection kit (Amersham).

by

autoradiography

using

the

enhanced

Mitochondrial membrane depolarization K562 cells were suspended at a concentration of 106/ml in fresh medium. The cells were exposed to the different effectors and then incubated with 50 nM DiOC6(3) and propidium iodide at 37°C for 15 min (19). The cells were resuspended in PBS containing 2.5 mM MgCl2, and DiOC6(3) and propidium iodide fluorescence were measured by using the FL1 and FL2 channels of a FACScan (Becton Dickinson, Cowley, U.K.). In vitro cleavage assay In vitro cleavage of Abl and Bcr-Abl proteins was performed in a volume of 25 µl of cleavage buffer (150 mM Nacl, 50 mM HEPES, 20 mM EDTA, 1 mM PMSF, 2 µg/ml aprotinin, 10 µg/ml leupeptin, and 0.2% NP-40) containing 100 µg of protein extract from K562 cells and 2.5 µl of recombinant caspase 3 (100 ng); PharMingen (San Diego, CA) with or without 100 µM Ac-DEVD-CHO. Samples were incubated with or without recombinant caspase at 37°C for 6 h, separated on an 8% SDS gel, and immunoblotted with an anti-Abl antibody (Oncogene Research, La Jolla, CA). Subcellular fractionnements After stimulation, K562 cells (4.106) were resuspended in hypotonic buffer containing 100 mM Tris-HCl, pH 7.4; 5 mM EGTA; 1 mM phenylmethylsulfonyl fluoride; 1 mM leupeptin; 20 µg/ml aprotinin; and rapidly sonicated at 4°C. Cell extracts were first centrifuged at 2000 g for 10 min. Supernatants were then centrifuged at 100,000 g for 45 min. Soluble proteins (cytosol) were collected. Pellets (microsomal fraction) were lysed in buffer B. In each lane the amount of total, cytosolic, and microsomal proteins loaded on the gel corresponds to 4.106 cells (21). Phase contrast microscopy K562 cells were treated for various times with imatinib, PMA, or the combination of both effectors or were left untreated. Morphologic changes characteristic of megakaryocytic or erythroid differentiation were visualized by using standard optics (Zeiss, Oberkochen, Germany). In some experiments, quantification of cells with megakaryocytic features was realized. To avoid potential errors in statistical sampling, fields were randomly selected and counts were performed by three different investigators in a blind manner. Cytospin, May-Grunwald–Giemsa staining, and benzidine staining Approximately 5.104 cells were spun onto a microscope slide for 10 min at 800 g under medium acceleration in a cytospin 3. After air drying, slides were stained with May-Grunwald-Giemsa stain (Sigma) according to the manufacturer’s instruction. Cell hemoglobinization was analyzed by benzidine staining (8). One thousand microliters of (0.5 to 1.106 cells/ml) was mixed with 200 µl benzidine reagent dihydrochloride (Sigma). The percentage of benzidine-positive cells (blue cells) was determined by light microscopic

examination of 100 cells per sample. Each experiment was performed in quadruplicate, and results were averaged. Expression array The human Apoptosis Expression Array (R&D Systems, Lille, France) represents a comprehensive collection of genes implicated in apoptosis, cell cycle regulation, adhesion, differentiation, and signal transduction. The array consists of 847 different cloned cDNAs, printed as PCR products, on a positively charged nylon membrane. Total RNA was isolated by using TriPure reagent (Boehringer Mannheim, Mannheim, Germany) from cells incubated for 24 h with the different effectors. PMA and imatinib were used at 10 ng/ml and 1 µM, respectively. After purification, the total RNA pellets were resuspended in water and quantified by using OD260 spectrophotometry (Perkin Elmer MBA2000). rRNA integrity was verified on a 1% agarose gel electrophoresis. Probe synthesis was performed as described previously (23). Probes were hybridized to each array membrane for ~15 h in the hybridization solution at 65°C. The array membranes were washed in decreasing concentrations of SSC. The damp arrays were exposed to a phosphor-imaging screen for 3–5 days. Exposed screens were scanned by using a phosphor-imager STORM 840 (Molecular Dynamics, Sunnyvale, CA). The images were analyzed by the Image Quant 5.0 software, as described previously (23). RT-PCR analysis Isolation of RNA and RT-PCR has been described in details elsewhere (23). To confirm differential mRNA expression, a panel of genes was quantified by RT-PCR by using the following primers. GATA-2-s: CGTCTTCTATCACCTCG / as : CGTCTTGGAGAAGGGC Glycophorin A-s: GGAATTCCAGCTCATGATCTCAGGATG Glycophorin A-as: TCCACATTTGGTTTGGTGAACAGATTC γ−Globin-s:ACTCGCTTCTGGAACGTCTGA / as : GTATCTGGAGGACAGGGCACT CD36-s: CTGGCTGTGTTTGGAGGTATTCT / as : AGCGTCCTGGGTTACATTTTCC KELL-s: GGCGGAAGCTTCAGATGGAAGGTGGGGACCAAAGT KELL-as: CGCGGGCGGCCGCAAGTTACCAGAGCTGGCAGCGGCT BCL-XL-s: ATGTCTCAGAGCAACCGGGAG / as : TCATTTCCGACTGAAGAGTGA MCL-1-s: CGGCGATCGCTGGAGATTAT / as : GTGGTGGTGGTTGGTTA BCL-2-s: ATGGCGCACGCTGGGAGAAGT / as : TCACTTGTGGCCCAGATAGGC BIM-s: ATGGCAAAGCAACCTTCTGA / as : CGCATATCTGCAGGTCTAGGC Reelin-s: GCCACAATGGAACAGGTCAT / as : CAATACTGCCACTGTAACTG

VEGF R1-s: GTAGCTGGCAAGCGGTCTTACCGGCTC VEGF R1-as: GGATTTGTCTGCTGCCCAGTGGGTAGAGA c-Fos-s: AAGGAGAATCCGAAGGGAAAGGAATAAGATGGCT c-Fos-as: AGACGAAGGAAGACGTGTAAGCAGTGCAGCT Gfi-1B-s: AACTTCGAGTGCCGCATGTGC / as: TGATGAGGTTGGAGCTCTGGC Fli-1-s: ATCCAGCTGTGGCAATTCC / as: AGGTCCAGTATTGTGATGCG TFR-C-s: TGCCACTGAATGGCTAGAGG / as: AATCACGAACTGACCAGCG Egr-1-s: ATACCAAGATCCACTTGCGG / as: TTGGTGACAGCTGAGGAAGG Alox-5s: GAAGACCTGATGTTTGGCTACC / as: AGGGTTCTCATCTCCCGG GAB1-s: CCTGTTGCTCATCAACTGTCAAAGC / as : CTACACTCGATGTCCCAGATGGG Integrin α 5-s: CCAGCAACAAAGTCTTCTGTGTCAT Integrin α 5-as: TGCTACCTCTCCACAGATAACTT Actin-s: ACCCACACTGTGCCCATCTTA / as: CTAGAAGCATTTGCGGTGGA RESULTS Molecular characterization of imatinib-mediated apoptosis and Bcr-Abl cleavage in K562 cells The K562 cell line is derived from a patient with CML in blast crisis and as such expresses the chimaeric non-receptor tyrosine kinase p210Bcr-Abl whose constitutive activity renders it refractory to numerous cytotoxic agents and proapoptotic stimuli (13, 24). Recent data from the literature indicate that apoptosis can be induced in these cells by imatinib mesylate (imatinib), a tyrosine kinase inhibitor now widely used in the treatment of CML (25,26). However, despite these well-documented effects, the mechanism of action of imatinib remains partially understood. A 36 h exposure of K562 cells to 1 µM imatinib induced DNA fragmentation (Fig. 1A), indicating that cells underwent an apoptotic program in the presence of the inhibitor. Imatinib treatment also induces caspase 3, 9, and 8 activity after 24–36 h, as judged by hydrolysis of AcDEVD-pNa, Ac-LEHD-pNa, and Ac-IETD-pNA, respectively (Fig. 1B, C). Apoptosis was also evidenced by the disappearance of the zymogenic forms of caspases 3, 9, and 8, reflecting their activation, and by the cleavage of poly-ADP-ribose polymerase (PARP) in its characteristic 85 kDa fragment (Fig. 1C). This observation strongly suggests that imatinib induced a mitochondrial-dependent apoptosis of K562 cells. This was confirmed by flow cytometric analysis of cells stained with DiOC6. DiOC6 was used to monitor the disruption of mitochondrial potential (∆Ψm), which constitutes an early and critical event in many apoptotic

processes (27). Imatinib induced a decrease of DiOC6 staining in more than 58% of K562 cells after 48 h of incubation, confirming that the imatinib effect is integrated at the mitochondrial level. Interestingly, expression of p210Bcr-Abl and p145Abl diminished after 36 h of incubation in the presence of imatinib (Fig. 1C), suggesting that both Bcr-Abl and Abl were degraded in cells treated with the therapeutic agent. Accordingly, Fig. 2A, B shows that Bcr-Abl and Abl were cleaved both in imatinib-treated K562 cells after 36 h and in vitro by recombinant caspase 3, generating in each case two main fragments at 55 and 85 kDa. It should be noted that recombinant caspase 3 also generated a 190 kDa fragment detected only in vitro. Cleavage of both proteins was abolished in cells pretreated with the pan-caspase inhibitors Ac-DEVD-CHO (Fig. 2B) and Z-VAD-fmk (not shown), confirming that both Bcr-Abl and Abl are substrates for caspases during imatinib-induced apoptosis of K562 cells. Imatinib alters Bcr-Abl and Abl tyrosine phosphorylation and induction of downstream signaling pathways To analyze the molecular events underlying the imatinib effect, we first evaluate its influence on the global tyrosine phosphorylation status of K562 cell proteins. For that purpose, we used 4G10, an anti-phosphotyrosine antibody (28). Fig. 2C showed that, in basal condition, a dozen proteins were constitutively phosphorylated on tyrosine residues. Phosphoproteins with molecular weight of 210, 145, and 110 kDa likely corresponded to Bcr-Abl, Abl, and Stat5, respectively. Imatinib rapidly inhibited constitutive tyrosine phosphorylation of these proteins and increased the tyrosine phosphorylation status of an unknown 60 kDa protein (Fig. 2C). PMA induced tyrosine phosphorylation of at least two proteins of 42 and 100 kDa. Finally, the use of an anti-phosphoStat5 antibody, which has also been reported to recognize phospho-Bcr-Abl and phospho-Abl proteins (29), showed that the effect of imatinib was long-lasting because it was still observed after 48 h of incubation, a time at which apoptosis is maximal as assessed by the almost complete cleavage of PARP in its characteristic 85 kDa fragment (Fig. 2A). To further characterize the mechanisms involved in the proapoptotic action of imatinib, we analyzed its effect on the main signaling pathways regulated by Bcr-Abl. Imatinib abolished ERK1/2 basal activation and, to a lesser extent, JNK activation, but failed to affect basal AKT and p38 phosphorylation (Fig. 3A). As a positive control of MAPK and AKT activation, we used the phorbol ester PMA. As expected, PMA increased ERK1/2 activation (30) but also enhanced p90RSK, JNK, and AKT activation (Fig. 3A). Interestingly, although imatinib was found to block ERK1/2 activation, it failed to affect PMA-mediated activation of these pathways (Fig. 3A). Conversely to PMA, which induced the relocalization of conventional and new PKC isoforms from the cytoplasm to the plasma membrane, imatinib had no effect on PKC redistribution (Fig. 3B). As shown on Fig. 4A, PMA had only a moderate effect on ∆Ψm loss by itself but strongly reduced imatinib-mediated ∆Ψm dissipation. Accordingly, PMA did not induce caspase activation but significantly reduced imatinib-mediated caspase activation from 24 to 72 h in K562 cells (Fig. 4B). Thus, PMA protects K562 cells from imatinib-induced apoptosis, which is likely by activating survival pathways such as PKCs and ERK1/2. At present, it is not known whether PKCs exert their action immediately upstream of these signaling pathways or at the level of Bcr-Abl itself.

Imatinib induces K562 cells to differentiate toward the erythroid lineage Morphological analysis of K562 cells by phase contrast microscopy confirmed that, in the presence of PMA, K562 cells underwent megakaryocytic differentiation. Indeed, large cells with prominent dense granules were visualized, reflecting megakaryocytic differentiation (Fig. 5A, b). The proapoptotic effect of imatinib was clearly visualized by the loss of viability of K562 cells, but careful examination of the cell culture at a higher magnification indicated the presence of a significant number of small viable cells (Fig. 5A, c). Interestingly, when cells were cultured with the combination of imatinib and PMA, imatinib-induced cell death was abolished and megakaryocytic differentiation occurred (Fig. 5A, d). The reduction in cell size upon imatinib treatment could be due to differentiation toward the erythroid lineage. The hypothesis that K562 cells underwent apoptosis and erythroid differentiation upon imatinib treatment was confirmed by a reduction in cell viability and an increase in benzidine staining, respectively (Fig. 5A, B). Indeed, after 48 h in the presence of imatinib, 77% of K562 cells die by apoptosis, whereas more than 80% of the remaining viable cells differentiate toward the erythroid lineage (Fig. 5A c, 5B). Both imatinib-induced apoptosis and differentiation were abolished by PMA. Differentiation of K562 cells was finally confirmed by RT-PCR analysis of different markers in cells incubated for 24 h with either PMA, imatinib, or the combination of both effectors. First, in the presence of imatinib, the mRNA encoding glycophorin A, the Kell blood group antigen (8), and CD36 clearly increased, indicating that K562 cells underwent erythroid differentiation (Fig. 5C). Moreover, imatinib increased the steady-state levels of Gfi-1B, a transcription factor involved in erythroid differentiation, and decreased the expression of c-fos, Egr-1, and Fli-1, which are thought to be involved in megakaroycytic differentiation and as such are up-regulated by PMA (Fig. 5C). Finally, imatinib down-regulated expression of antiapoptotic proteins, including Bclxl, Bcl-2, and Mcl-1 and increased that of the proapoptotic BH3-only member, Bim-L, in agreement with its ability to induce mitochondria-dependent apoptosis of K562 cells. Second, PMA induced GATA-2 transcripts and inhibited glycophorin A and CD36 expression, as cells differentiate toward the megakaryocytic lineage (Fig. 5C). Interestingly, in the presence of both effectors, the effects of imatinib were abolished and K562 cells proceeded along the megakaryocytic pathway of differentiation (Fig. 5A d, C). c-DNA array analysis of K562 cell differentiation and apoptosis Erythroid or megakaryocytic differentiation of K562 cells requires the activation of transcription factors that control the expression of specific genes expressed in each lineage (31, 32). To assess the effect of imatinib and PMA on gene expression, we used a cDNA array approach. We focalized our attention on a limited number of selected genes (847), mainly those involved in apoptosis, differentiation, angiogenesis, transcription, cell cycle, and signal transduction, all cellular processes involved in the regulation of cell fate. As a great number of genes were modulated by PMA (more than 100; Jacquel et al., in preparation), we decided to focus our attention only on those whose expression was concommitently regulated by PMA and imatinib. Imatinib increased the expression of reelin, PTX3 (pentraxin), GRB14, GAB1, transferin receptor, and alox5 and decreased the expression of VEGF-R1; IGF-R1; c-Fos; EGR1; cyclin D2; and α3, α5, and β7 integrins; CAD-12 and I-CAM (Table 1; Fig. 6A). Interestingly, most but not all of the genes that are comodulated by PMA and imatinib behave in the opposite way. Indeed, PMA drastically induced VEGF-R1; IGF-R1; c-fos; EGR1; integrins α3, α5, β7, CAD12, and ICAM-1; and decreased expression of PTX3, GAB1, transferin receptor, and alox5. Modulation of most of these genes upon imatinib and PMA treatment was confirmed by RT-PCR

(Fig. 6A, B). Finally, it is noteworthy that, in the presence of the PMA + imatinib combination, the profile of gene expression was found to be exactly superposable to that of PMA alone, in agreement with the observation that PMA protects cells against imatinib-induced apoptosis and redirects K562 cells toward megakaryocytic differentiation, even in the presence of imatinib (Fig. 5). DISCUSSION Imatinib-induced apoptosis of K562 cells The antiapoptotic activity of Bcr-Abl contributes significantly to the development of CML. BcrAbl may function either by enhancing the proliferation potential of hematopoietic progenitors or by protecting these progenitors from apoptosis (13–15). Imatinib has been developed at Novartis, and extensive profiling has shown that it inhibits Bcr-Abl, the PDGF-R tyrosine kinase, and cKit (11, 12). Pre-clinical and clinical studies have shown that imatinib specifically inhibits the proliferation of cells expressing Bcr-Abl in vivo and in vitro (16, 17). For these reasons, imatinib has emerged as the lead compound for the treatment of CML (25, 26). However, the mechanisms by which the drug effectively affects CML cells remain partially understood. We show here that imatinib-induced apoptosis of the Bcr-Abl positive cell line K562 is mitochondrion-dependent and requires caspase 9 and 3 activation. Moreover, direct involvement of caspase 8 in this cell death process is unlikely because K562 cells are insensitive to Fas-L or Trail killing (not shown). Interestingly, caspase activation upon imatinib treatment of K562 cells was accompanied by cleavage of Bcr-Abl, an effect abrogated by the pan-caspase inhibitor Z-VAD-fmk (not shown). Thus, imatinib may mediate its proapoptotic effect at two different levels: i) by a rapid and sustained inhibition of Bcr-Abl kinase activity leading to inactivation of survival pathways; and ii) by inducing long-term activation of caspases responsible for the degradation and inactivation of Bcr-Abl tyrosine kinase. The exact site(s) of cleavage of Bcr-Abl by caspases and the effect of their mutation on its kinase activity and localization are currently under investigation. It is well established that the constitutive tyrosine kinase activity of Bcr-Abl is essential for its leukemogenic function (15, 33, 34). Conversely to Abl, whose activity is strikingly regulated, Bcr-Abl activated signal transduction pathways by itself and thus interfered with various cellular physiological processes, such as gene transcription, proliferation, adhesion, and apoptosis (35, 36). These processes are thought to involve intracellular signaling pathways, including Ras/Raf/MEK/ERK, JNK/SAPK, p38MAPK, and PI3K/AKT (37–41). Nevertheless, the signal initiated by Bcr-Abl leads to the activation of the transcriptional machinery through the activation of numerous transcription factors, such as Elk-1, Jun, ATF-2, Myc, and Stat5. Here we show that the main effect of imatinib is to abolish ERK1/2, Stat5, and JNK constitutive activation in K562 cells. Thus the proapoptotic effect of imatinib could be explained by a rapid and sustained inhibition of Bcr-Abl, which leads to abrogation of survival pathways, such as Erk1/2, Stat5, and JNK. As previously mentioned, such an apoptotic effect of imatinib could be increased further by caspase-dependent degradation of Bcr-Abl. From the data described above, we can hypothesize that inhibition of Bcr-Abl by imatinib leads to down-regulation of important downstream signaling cascades involved in cell survival and, noticeably, Erk1/2, which ultimately results in apoptosis (Fig. 7). If our interpretation is correct, maintaining a high level of Erk1/2 activation should result in inhibition of imatinib-induced apoptosis. This is indeed the case since co-treatment of K562 cells with both imatinib and PMA abrogates imatinib-induced ∆Ψm dissipation and caspase activation. Interestingly PMA-induced protection against imatinib-

mediated apoptosis correlates with the restoration of Erk1/2 and AKT activation (Fig. 7). Such a PMA protective effect on apoptosis has been previously reported to occur in HL60 cells treated with chemotherapeutic agents (42) and Jurkat T cells stimulated with death ligands (23). Treatment with imatinib decreased the expression of Bcl-2, Bcl-xl, and Mcl-1 and increased that of Bim-L. This may represent part of the mechanism by which imatinib reverse the resistance of CML cells to apoptosis, thus favoring cytochrome c release from mitochondria. Accordingly in a previous report, Bcl-xl levels were also found to decrease following imatinib treatment (43). Imatinib-induced erythroid differentiation of K562 cells, an effect abrogated by PMA The K562 cell line has been widely used as a model for leukemia differentiation. It is known to be pluripotent and is inducible along either the megakaryocytic or erythroid lineages (8). Both morphologic and phenotypic analyses revealed that within 24–48 h in culture, a significant number of K562 cells presents erythroid-like futures (reduction in cell size, high hemoglobin level, and increased expression of erythroid markers, such as glycophorin-A, the kell blood group antigen, and CD36. The ability of early hematopoietic cells to undertake specific differentiation steps toward different lineages is a tightly regulated process that requires specific transcription factors (44–46). The observation that imatinib can increase Gfi-1B (47) and repress Fli-1 expression is in good agreement with its ability to induce erythroid differentiation. Indeed it has been recently shown that expression of Gfi-1B increased during erythropoiesis and that enforced expression Gfi-1B supports EPO-independent erythropoiesis (48). On the other hand, Fli-1 has been shown to repress erythroid differentiation of K562 cells (49), an observation that is in agreement with the imatinib-mediated repression of Fli-1 observed in our study. Thus, besides triggering K562 apoptosis, imatinib also mediated differentiation along the erythroid lineage, which is accompanied by an appropriate modification of the expression of specific transcription factors. The profile of expression of several markers and transcription factors specific of megakaryocytic differentiation in either PMA-treated or PMA + imatinib-treated cells is nearly indistinguishable (45). This may explain the fact that PMA can redirect differentiation of K562 cells, even in the presence of imatinib. Interestingly, expression of transcription factors required for the megakaryocytic differentiation program, including GATA-2, Spi-1, and c-Fos, is equally increased in both PMA-treated or PMA + imatinib-treated cells. c-DNA array analysis of imatinib and PMA effects on K562 cells In our study, we searched for genes that may participate in imatinib-induced apoptotic and differentiation programs. When comparing untreated and imatinib-treated K562 cells, 20 out of 847 genes were modulated. Most of these genes were regulated in the opposite way by PMA and imatinib, suggesting that they may be linked specifically to the differentiation programs, because erythroid and megakaryocytic differentiation are thought to be mutually exclusive (50). In each case we identified several genes that have never been shown before to be regulated or to play a role in K562 cell differentiation. Imatinib increased expression of the transferin receptor (51), 5lipooxygenase, GAB1 (52), GRB14, PREF-1, and the serine protease reelin. Except for GRB14, all the imatinib-induced genes were down-regulated by PMA. PMA enhanced the expression of several integrins in accordance with the propensity of K562 cells to adhere in the presence of the phorbol ester (53, 54). Of note, PMA increased the

expression of c-Fos and Egr-1, which are substrates of the Erk1/2 pathway, otherwise induced by PMA in K562 cells (Fig. 3). Finally, PMA was also found to increase expression of IGF-R1 in accordance with recent data from Aro et al. (6). We also reported for the first time that megakaryocytic differentiation of K562 cells by PMA is accompanied by induction of genes involved in angiogenesis, including VEGF, and its receptor VEGF-R1, VRAP, and the tyrosine kinase TIE-1. Although VEGF has been shown to be expressed in some hematopoietic malignancies (55, 56), platelets and megakaryocytes have been reported to secrete VEGF; the significance of the observed increase in angiogenic related genes during megakaryocytic differentiation is presently unknown. Recently, Ebos et al. reported that imatinib reduces Bcr-Abl-mediated VEGF secretion in K562 cells (57), in accordance with our own results (not shown). Experiments are currently in progress to determine whether the angiogenic cascade found to be affected by PMA and imatinib may affect K562 cell differentiation and apoptosis. Finally, concerning the imatinib modulated genes, increased expression of reelin is particularly intriguing. Reelin is a high-molecular-weight matrix serine protease that is secreted by specialized neurons during development (58). Reelin serves as a ligand for the ApoE2 and VLDL receptors, triggering a signaling cascade that guides neurons to their correct position within developing nervous system (59). Disruption of this pathway by mutation of the reelin gene produced the reeler phenotype, caused by severe malformation of the cerebellum (60). Increased expression of reelin in imatinib-treated cells has been confirmed by Western blotting experiments (not shown). To our knowledge this is the first observation that reelin may be expressed and secreted by hematopoietic cells. Expression of ApoE2R has been reported on both erythroleukemic and megakaryocytic cell lines, HEL and Meg-1 (61). However, whether the reelin/ApoE2R system participates to erythroid differentiation of K562 cells remains to be determined. In conclusion, we have established for the first time the requirements for imatinib-induced cell death and erythroid differentiation in CML cells and have identified new genes potentially involved in this processes. Further investigation of this novel imatinib-induced pattern of gene expression may offer insights into the mechanisms of hematopoietic precursor apoptosis erythroid differentiation and apoptosis and may have implications for the design of future antiBcr-Abl therapeutic strategies. ACKNOWLEDGMENTS This work was supported by INSERM, The Ligue Nationale Contre le Cancer (LNC, Equipe Labellisée). F.L is a recipient from a LNC fellowship. We are indebted to Bernard Mari for critical review of the manuscript, Patrice Berthaud (Novartis, France) for reading the manuscript, and Agnes Loubat for Facs analysis. REFERENCES 1.

Nowell, P., and Hungerford, D. (1960) A minute chromosome in human chronic granulocytic leukemia. Science 132, 1497

2.

Rowley, J. D. (1973) Letter: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature 243, 290–293

3.

Pane, F., Intrieri, M., Quintarelli, C., Izzo, B., Muccioli, G. C., and Salvatore, F. (2002) BCR/ABL genes and leukemic phenotype: from molecular mechanisms to clinical correlations. Oncogene 21, 8652–8667

4.

Yuksel, S., Saydam, G., Uslu, R., Sanli, U. A., Terzioglu, E., Buyukececi, F., and Omay, S. B. (2002) Arsenic trioxide and methylprednisolone use different signal transduction pathways in leukemic differentiation. Leuk. Res. 26, 391–398

5.

Gillet, R., Bobichon, H., and Trentesaux, C. (2002) Nuclear transcription factor GATA-1 is activated during aclacinomycin-induced erythroid differentiation. Biol. Cell. 94, 267–273

6.

Aro, A. L., Savikko, J., Pulkkinen, V., and von Willebrand, E. (2002) Expression of insulinlike growth factors IGF-I and IGF-II, and their receptors during the growth and megakaryocytic differentiation of K562 cells. Leuk. Res. 26, 831–837

7.

Kim, K. W., Kim, S. H., Lee, E. Y., Kim, N. D., Kang, H. S., Kim, H. D., Chung, B. S., and Kang, C. D. (2001) Extracellular signal-regulated kinase/90-KDA ribosomal S6 kinase/nuclear factor-kappa B pathway mediates phorbol 12-myristate 13-acetate-induced megakaryocytic differentiation of K562 cells. J. Biol. Chem. 276, 13186–13191

8.

Belhacene, N., Maulon, L., Guerin, S., Ricci, J. E., Mari, B., Colin, Y., Cartron, J. P., and Auberger, P. (1998) Differential expression of the Kell blood group and CD10 antigens: two related membrane metallopeptidases during differentiation of K562 cells by phorbol ester and hemin. FASEB J. 12, 531–539

9.

Park, J. I., Choi, H. S., Jeong, J. S., Han, J. Y., and Kim, I. H. (2001) Involvement of p38 kinase in hydroxyurea-induced differentiation of K562 cells. Cell Growth Differ. 12, 481– 486

10. Whalen, A. M., Galasinski, S. C., Shapiro, P. S., Nahreini, T. S., and Ahn, N. G. (1997) Megakaryocytic differentiation induced by constitutive activation of mitogen-activated protein kinase kinase. Mol. Cell. Biol. 17, 1947–1958 11. Buchdunger, E., Zimmermann, J., Mett, H., Meyer, T., Muller, M., Druker, B. J., and Lydon, N. B. (1996) Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2phenylaminopyrimidine derivative. Cancer Res. 56, 100–104 12. Druker, B. J., Tamura, S., Buchdunger, E., Ohno, S., Segal, G. M., Fanning, S., Zimmermann, J., and Lydon, N. B. (1996) Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat. Med. 2, 561–566 13. McGahon, A., Bissonnette, R., Schmitt, M., Cotter, K. M., Green, D. R., and Cotter, T. G. (1994) BCR-ABL maintains resistance of chronic myelogenous leukemia cells to apoptotic cell death. Blood 83, 1179–1187

14. Sawyers, C. L. (1993) Molecular consequences of the BCR-ABL translocation in chronic myelogenous leukemia. Leuk. Lymphoma 11, 101–103 15. Advani, A. S., and Pendergast, A. M. (2002) Bcr-Abl variants: biological and clinical aspects. Leuk. Res. 26, 713–720 16. le Coutre, P., Mologni, L., Cleris, L., Marchesi, E., Buchdunger, E., Giardini, R., Formelli, F., and Gambacorti-Passerini, C. (1999) In vivo eradication of human BCR/ABL-positive leukemia cells with an ABL kinase inhibitor. J. Natl. Cancer Inst. 91, 163–168 17. Deininger, M. W., Goldman, J. M., Lydon, N., and Melo, J. V. (1997) The tyrosine kinase inhibitor CGP57148B selectively inhibits the growth of BCR-ABL-positive cells. Blood 90, 3691–3698 18. Le'Negrate, G., Selva, E., Auberger, P., Rossi, B., and Hofman, P. (2000) Sustained polymorphonuclear leukocyte transmigration induces apoptosis in T84 intestinal epithelial cells. J. Cell Biol. 150, 1479–1488 19. Zamzami, N., Marchetti, P., Castedo, M., Zanin, C., Vayssiere, J. L., Petit, P. X., and Kroemer, G. (1995) Reduction in mitochondrial potential constitutes an early irreversible step of programmed lymphocyte death in vivo. J. Exp. Med. 181, 1661–1672 20. Luciano, F., Ricci, J. E., and Auberger, P. (2001) Cleavage of Fyn and Lyn in their Nterminal unique regions during induction of apoptosis: a new mechanism for Src kinase regulation. Oncogene 20, 4935–4941 21. Ricci, J. E., Maulon, L., Luciano, F., Guerin, S., Livolsi, A., Mari, B., Breittmayer, J. P., Peyron, J. F., and Auberger, P. (1999) Cleavage and relocation of the tyrosine kinase P59FYN during Fas-mediated apoptosis in T lymphocytes. Oncogene 18, 3963–3969 22. Ricci, J. E., Lang, V., Luciano, F., Belhacene, N., Giordanengo, V., Michel, F., Bismuth, G., and Auberger, P. (2001) An absolute requirement for Fyn in T cell receptor-induced caspase activation and apoptosis. FASEB J. 15, 1777–1779 23. Herrant, M., Luciano, F., Loubat, A., and Auberger, P. (2002) The protective effect of phorbol esters on Fas-mediated apoptosis in T cells. Transcriptional and postranscriptional regulation. Oncogene 21, 4957–4968 24. Amarante-Mendes, G. P., Naekyung Kim, C., Liu, L., Huang, Y., Perkins, C. L., Green, D. R., and Bhalla, K. (1998) Bcr-Abl exerts its antiapoptotic effect against diverse apoptotic stimuli through blockage of mitochondrial release of cytochrome C and activation of caspase-3. Blood 91, 1700–1705 25. Talpaz, M., Silver, R. T., Druker, B. J., Goldman, J. M., Gambacorti-Passerini, C., Guilhot, F., Schiffer, C. A., Fischer, T., Deininger, M. W., Lennard, A. L., et al. (2002) Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a phase 2 study. Blood 99, 1928–1937

26. O'Dwyer, M. E., Mauro, M. J., and Druker, B. J. (2002) Recent advancements in the treatment of chronic myelogenous leukemia. Annu. Rev. Med. 53, 369–381 27. Marchetti, P., Castedo, M., Susin, S. A., Zamzami, N., Hirsch, T., Macho, A., Haeffner, A., Hirsch, F., Geuskens, M., and Kroemer, G. (1996) Mitochondrial permeability transition is a central coordinating event of apoptosis. J. Exp. Med. 184, 1155–1160 28. Maulon, L., Guerin, S., Ricci, J. E., Breittmayer, D. F., and Auberger, P. (1998) T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood 91, 4232–4241 29. Donato, N. J., Wu, J. Y., Zhang, L., Kantarjian, H., and Talpaz, M. (2001) Down-regulation of interleukin-3/granulocyte-macrophage colony- stimulating factor receptor beta-chain in BCR-ABL(+) human leukemic cells: association with loss of cytokine-mediated Stat-5 activation and protection from apoptosis after BCR-ABL inhibition. Blood 97, 2846–2853 30. Gomez-Angelats, M., and Cidlowski, J. A. (2001) Protein kinase C regulates FADD recruitment and death-inducing signaling complex formation in Fas/CD95-induced apoptosis. J. Biol. Chem. 276, 44944–44952 31. Ikonomi, P., Rivera, C. E., Riordan, M., Washington, G., Schechter, A. N., and Noguchi, C. T. (2000) Overexpression of GATA-2 inhibits erythroid and promotes megakaryocyte differentiation. Exp. Hematol. 28, 1423–1431 32. Lam, L. T., Ronchini, C., Norton, J., Capobianco, A. J., and Bresnick, E. H. (2000) Suppression of erythroid but not megakaryocytic differentiation of human K562 erythroleukemic cells by notch-1. J. Biol. Chem. 275, 19676–19684 33. Lugo, T. G., Pendergast, A. M., Muller, A. J., and Witte, O. N. (1990) Tyrosine kinase activity and transformation potency of bcr-abl oncogene products. Science 247, 1079–1082 34. Pendergast, A. M., Muller, A. J., Havlik, M. H., Maru, Y., and Witte, O. N. (1991) BCR sequences essential for transformation by the BCR-ABL oncogene bind to the ABL SH2 regulatory domain in a non-phosphotyrosine-dependent manner. Cell 66, 161–171 35. Deininger, M. W., Goldman, J. M., and Melo, J. V. (2000) The molecular biology of chronic myeloid leukemia. Blood 96, 3343–3356 36. Shet, A. S., Jahagirdar, B. N., and Verfaillie, C. M. (2002) Chronic myelogenous leukemia: mechanisms underlying disease progression. Leukemia 16, 1402–1411 37. Cortez, D., Stoica, G., Pierce, J. H., and Pendergast, A. M. (1996) The BCR-ABL tyrosine kinase inhibits apoptosis by activating a Ras-dependent signaling pathway. Oncogene 13, 2589–2594 38. Jain, S. K., Susa, M., Keeler, M. L., Carlesso, N., Druker, B., and Varticovski, L. (1996) PI 3-kinase activation in BCR/abl-transformed hematopoietic cells does not require interaction of p85 SH2 domains with p210 BCR/abl. Blood 88, 1542–1550

39. Puil, L., Liu, J., Gish, G., Mbamalu, G., Bowtell, D., Pelicci, P. G., Arlinghaus, R., and Pawson, T. (1994) Bcr-Abl oncoproteins bind directly to activators of the Ras signalling pathway. EMBO J. 13, 764–773 40. Burgess, G. S., Williamson, E. A., Cripe, L. D., Litz-Jackson, S., Bhatt, J. A., Stanley, K., Stewart, M. J., Kraft, A. S., Nakshatri, H., and Boswell, H. S. (1998) Regulation of the c-jun gene in p210 BCR-ABL transformed cells corresponds with activity of JNK, the c-jun Nterminal kinase. Blood 92, 2450–2460 41. Yu, C., Krystal, G., Varticovksi, L., McKinstry, R., Rahmani, M., Dent, P., and Grant, S. (2002) Pharmacologic mitogen-activated protein/extracellular signal-regulated kinase kinase/mitogen-activated protein kinase inhibitors interact synergistically with STI571 to induce apoptosis in Bcr/Abl-expressing human leukemia cells. Cancer Res. 62, 188–199 42. Sordet, O., Bettaieb, A., Bruey, J. M., Eymin, B., Droin, N., Ivarsson, M., Garrido, C., and Solary, E. (1999) Selective inhibition of apoptosis by TPA-induced differentiation of U937 leukemic cells. Cell Death Differ. 6, 351–361 43. Fang, G., Kim, C. N., Perkins, C. L., Ramadevi, N., Winton, E., Wittmann, S., and Bhalla, K. N. (2000) CGP57148B (STI-571) induces differentiation and apoptosis and sensitizes Bcr-Abl-positive human leukemia cells to apoptosis due to antileukemic drugs. Blood 96, 2246–2253 44. Bartel, F. O., Higuchi, T., and Spyropoulos, D. D. (2000) Mouse models in the study of the Ets family of transcription factors. Oncogene 19, 6443–6454 45. Shivdasani, R. A. (2001) Molecular and transcriptional regulation of megakaryocyte differentiation. Stem Cells 19, 397–407 46. Zhu, J., and Emerson, S. G. (2002) Hematopoietic cytokines, transcription factors and lineage commitment. Oncogene 21, 3295–3313 47. Saleque, S., Cameron, S., and Orkin, S. H. (2002) The zinc-finger proto-oncogene Gfi-1b is essential for development of the erythroid and megakaryocytic lineages. Genes Dev. 16, 301–306 48. Osawa, M., Yamaguchi, T., Nakamura, Y., Kaneko, S., Onodera, M., Sawada, K., Jegalian, A., Wu, H., Nakauchi, H., and Iwama, A. (2002) Erythroid expansion mediated by the Gfi1B zinc finger protein: role in normal hematopoiesis. Blood 100, 2769–2777 49. Athanasiou, M., Mavrothalassitis, G., Sun-Hoffman, L., and Blair, D. G. (2000) FLI-1 is a suppressor of erythroid differentiation in human hematopoietic cells. Leukemia 14, 439–445 50. Hong, Y., Martin, J. F., Vainchenker, W., and Erusalimsky, J. D. (1996) Inhibition of protein kinase C suppresses megakaryocytic differentiation and stimulates erythroid differentiation in HEL cells. Blood 87, 123–131

51. Kawabata, H., Nakamaki, T., Ikonomi, P., Smith, R. D., Germain, R. S., and Koeffler, H. P. (2001) Expression of transferrin receptor 2 in normal and neoplastic hematopoietic cells. Blood 98, 2714–2719 52. Lecoq-Lafon, C., Verdier, F., Fichelson, S., Chretien, S., Gisselbrecht, S., Lacombe, C., and Mayeux, P. (1999) Erythropoietin induces the tyrosine phosphorylation of GAB1 and its association with SHC, SHP2, SHIP, and phosphatidylinositol 3-kinase. Blood 93, 2578– 2585 53. Burger, S. R., Zutter, M. M., Sturgill-Koszycki, S., and Santoro, S. A. (1992) Induced cell surface expression of functional alpha 2 beta 1 integrin during megakaryocytic differentiation of K562 leukemic cells. Exp. Cell Res. 202, 28–35 54. Zutter, M. M., Fong, A. M., Krigman, H. R., and Santoro, S. A. (1992) Differential regulation of the alpha 2 beta 1 and alpha IIb beta 3 integrin genes during megakaryocytic differentiation of pluripotential K562 cells. J. Biol. Chem. 267, 20233–20238 55. Bellamy, W. T., Richter, L., Frutiger, Y., and Grogan, T. M. (1999) Expression of vascular endothelial growth factor and its receptors in hematopoietic malignancies. Cancer Res. 59, 728–733 56. Bellamy, W. T. (2001) Expression of vascular endothelial growth factor and its receptors in multiple myeloma and other hematopoietic malignancies. Semin. Oncol. 28, 551–559 57. Ebos, J. M., Tran, J., Master, Z., Dumont, D., Melo, J. V., Buchdunger, E., and Kerbel, R. S. (2002) Imatinib mesylate (STI-571) reduces Bcr-Abl-mediated vascular endothelial growth factor secretion in chronic myelogenous leukemia. Mol. Cancer Res. 1, 89–95 58. D'Arcangelo, G., Miao, G. G., Chen, S. C., Soares, H. D., Morgan, J. I., and Curran, T. (1995) A protein related to extracellular matrix proteins deleted in the mouse mutant reeler. Nature 374, 719–723 59. D'Arcangelo, G., Homayouni, R., Keshvara, L., Rice, D. S., Sheldon, M., and Curran, T. (1999) Reelin is a ligand for lipoprotein receptors. Neuron 24, 471–479 60. Rakic, P., and Caviness, V. S., Jr. (1995) Cortical development: view from neurological mutants two decades later. Neuron 14, 1101–1104 61. Riddell, D. R., Vinogradov, D. V., Stannard, A. K., Chadwick, N., and Owen, J. S. (1999) Identification and characterization of LRP8 (apoER2) in human blood platelets. J. Lipid Res. 40, 1925–1930 Received April 14, 2003; accepted July 10, 2003.

Table 1 List of imatinib-modulated genes.

The list contains genes that showed more than twofold induction or repression in three different experiments compared with control conditions (ratio of one). The ratios of gene expression in cells treated for 24 h with 1 µM imatinib, 10 ng/ml PMA, or the combination of both effectors is shown.

Fig. 1

Figure 1. Molecular characterization of imatinib-mediated apoptosis in K562. A) K562 cells were incubated for different times at 37°C with 1 µM imatinib. Internucleosomal DNA fragmentation was visualized after agarose gel electrophoresis. B) Caspase activity was assessed on cell lysates prepared from cells stimulated for different times with 1 µM imatinib by using 0.2 mM Ac-DEVD-pNa, 0.2 mM Ac-LEHD-pNa, or 0.2 mM Ac-IETD-pNa as substrate. Substrate hydrolysis was determined in quadruplicate at 405 nm. To assess specific caspase activity, hydrolysis was followed at different times in the presence or absence of 10 µM of the appropriate caspase inhibitors. Results are expressed as nanomoles of substrates hydrolyzed per minute and per milligram of protein and represent the mean of at least three different determinations. C) Cells were lysed and proteins were separated by electrophoresis on 10% polyacrylamide gels. Proteins were then blotted on to PVDF membranes, which were incubated with either anti-Abl, anti-procaspase 3, antiprocaspase 8, anti-procaspase 9, or anti-PARP antibodies. D) Mitochondrial membrane depolarization (∆Ψm) was assessed by the loss of DiOC6(3) staining of mitochondria. Cells incubated 48 h with 1 µM imatinib were stained with DiOC6(3) (50 nM, 15 min, 37°C). The percentage of apoptotic cells in each condition is indicated.

Fig. 2

Figure 2. Imatinib induces Bcr-Abl cleavage and modulates the global and specific phosphorylation status of K562 cell proteins. A) K562 cells were incubated for different times at 37°C with 1 µM imatinib. They were then lyzed and the proteins were separated by electrophoresis on 10% polyacrylamide gels. Proteins were blotted on to PVDF membranes, which were incubated with either anti-Abl, anti-phospho-Stat5, anti-PARP, and anti-HSP60 antibodies. B) Protein extracts (100 µg) prepared from K562 cells were incubated for 6 h at 37°C in the presence or absence of 100 ng of recombinant caspase 3 with or without 10 µM Ac-DEVD-CHO. Abl and Bcr-Abl proteins levels were detected via immunoblot. C) K562 cells were incubated for different times at 37°C with 10 ng/ml PMA or 1 µM imatinib. They were then lyzed and the proteins were separated by electrophoresis on 10% polyacrylamide gels. Proteins were blotted on to PVDF membranes, which were next incubated with an anti-phosphotyrosine antibody (4G10).

Fig. 3

Figure 3. Effect of imatinib and PMA on the main survival pathways in K562 cells. K562 cells were incubated for different times at 37°C with 1 µM imatinib (Ima) and/or 10 ng/ml PMA. A) Cells were lyzed and proteins were separated by eletrophoresis on 10% polyacrylamide gels. Proteins were then blotted on to PVDF membranes with either antiphospho Erk1/2, anti-phospho p90 RSK, anti-phospho JNK, anti-phospho AKT, or anti-phospho p38 MAPK antibodies. B) Cells lysates were subfractionated in cytoplasmic and microsomal fractions, and proteins contained in each fraction were separated by electrophoresis on 10% polyacrylamide gels. Proteins were then blotted on to PVDF membranes with either anti-PKC α/β, γ, δ, ε, ι, or anti-pan phospho PKC antibodies.

Fig. 4

Figure 4. PMA inhibits imatinib-mediated apoptosis in K562 cells. A) Cells incubated 48 h with 1 µM imatinib (Ima) and/or 10 ng/ml PMA were stained with DiOC6(3) (50 nM, 15 min, 37°C). Mitochondrial membrane depolarization was assessed by the loss of DiOC6(3) staining of the mitochondria.The percentage of apoptotic cells in each condition is indicated. B) Caspase activity was assessed on cell lysates prepared from cells stimulated for different times with 1 µM imatinib and/or 10 ng/ml PMA by using 0.2 mM Ac-DEVD-pNa as substrate. To measure specific caspase activity, substrate hydrolysis was determined in quadruplicate, at different times in the presence or absence of 10 µM Ac-DEVDCHO. Results are expressed as nanomoles of substrates hydrolyzed per minute and per milligram of protein and represent the mean of at least three determinations.

Fig. 5

Figure 5. Imatinib induces K562 cells to differentiate toward the erythroid lineage. A) Light microscopic analysis: K562 cells were cultured for 48 h in the presence of 10 ng/ml PMA and/or 1 µM imatinib (Ima); then cells were photographed directly, after either staining with May-Grunwald-Giemsa stain (×400) or staining with benzidine stain (×100). Arrows indicate small viable cells. B) The percentage of benzidine-positive or viable cells was determined at 24 h and 48 h. C) RT-PCR analysis of genes modulated in cells treated with 1 µM imatinib (Ima), 10 ng/ml PMA, or the combination of both effectors. Amplification method was described in Materials and Methods. Actin was used as an invariant control in the experiment.

Fig. 6

Figure 6. RT-PCR analysis of genes modulated in response to imatinib, PMA, or the combination of both effectors. A) Genes induced or repressed by 1 µM imatinib. B) RNA were prepared from cells left untreated or treated for 24 h with 1 µM imatinib (Ima), 10 ng/ml PMA, or the combination of both effectors. Amplification method was described in Materials and Methods. Actin was used as an invariant control in the experiment.

Fig. 7

Figure 7. A model for imatinib-induced apoptosis and erythroid differentiation.