Immune system disturbances in Clouston syndrome

Report

Immune system disturbances in Clouston syndrome Aldona Pietrzak1, MD, PhD, Ewelina Grywalska2, MD, PhD, Agnieszka Gerkowicz1, MD, 1 1 PhD, Dorota Krasowska , MD, PhD, Gra_zyna Chodorowska , MD, PhD, Małgorzata 1 2 nski , MD, PhD, Bartłomiej Wawrzycki1, MD, Michalska-Jakubus , MD, PhD, Jacek Roli nski5, MD, PhD, Agnieszka Sebastian Radej3, PhD, Ewa Dybiec4, MD, PhD, Jacek Wro 6 7 Sobczy nska-Tomaszewska , PhD, Marcin Rudzki , MD, PhD, and Smail Hadj-Rabia8, MD, PhD

Departments of 1Dermatology, Venereology and Pediatric Dermatology, 2Clinical Immunology and Immunotherapy, 3Human Anatomy, 4Pediatric Radiology, 5Vascular Surgery and Angiology, Medical University of Lublin, Lublin, 6Health Care Centre MedGen, Warsaw, 7Department of Maxillofacial Orthopedics, Medical University of Lublin, Lublin, Poland, and 8 ^pital Department of Dermatology, Ho Universitaire Necker-Enfants Malades, Paris, France

Abstract Background Clouston syndrome belongs to the family of ectodermal dysplasias. So far, a defective immune response has not been reported in Clouston syndrome. We report, for the first time, immunological particularities of a large multigenerational Polish family with Clouston syndrome. Methods Five members of the same family with Clouston syndrome, aged 6–76 years, and 20 healthy volunteers, aged 19–73 years, were enrolled in the study. In all participants, the ability of neutrophils to phagocytize opsonized Escherichia coli was assessed. Granulocyte oxidative burst was determined quantitatively, and an isolation of peripheral blood mononuclear cells and the detection of lymphocyte subsets were performed. All patients with Clouston syndrome underwent microscopic assessment of hair shafts, x-rays of the skull and

Correspondence Ewelina Grywalska, MD, PHD Department of Immunology and Immunotherapy Medical University of Lublin, 4a Chodzki St. 20-093 Lublin Poland E-mail: [email protected] Conflicts of interest: none.

hand bones, extra- and intraoral examination, and panoramic x-rays. Results Compared to the controls, all patients with Clouston syndrome presented with significantly reduced phagocytic activities of granulocytes and monocytes (P < 0.05). The percentages of granulocytes and monocytes being positive for oxidative burst were also significantly reduced in all patients with Clouston syndrome (P < 0.05). No disturbances in the percentages and absolute counts of T CD3+, T CD3+/CD4+, T CD3+/CD8+, natural killer, and B CD19+ cells were found. Conclusion Although this study expands knowledge about Clouston syndrome, it also raises many questions. The results provide evidence of significantly reduced phagocytic

doi: 10.1111/ijd.13152

activity and oxidative bursts of cells playing crucial roles in a nonspecific immune response. Further studies are required to understand the underlying mechanism of the hereby described abnormalities.

Introduction Hidrotic ectodermal dysplasia type 2, also referred to as Clouston syndrome (OMIM 129500), is a rare autosomal dominant disorder characterized by concomitant nail dystrophy, partial to complete alopecia, and palmoplantar hyperkeratosis.1–4 Although the disease is more common in the French Canadian population,1 it has also been reported in other ethnic groups.4 Nail abnormalities are a crucial feature of Clouston syndrome. Usually the patients present with thickened, ridged, discolored, hyperconvex, brittle, or small nails. Nail deformities are frequently associated with paronychia.2,5–7 Scalp and body hair may be affected at birth or later.1,5,8 This results in various types of alopecia. In

most cases, the residual scalp hair is pale, fine, sparse, and grows very slowly. Furthermore, absent or sparse eyebrows and sparse and short eyelashes were reported.7,8 Palmoplantar hyperkeratosis occurs with varying degrees of severity.2,4 Additional findings include hyperpigmentation over large joints,2 clubbing of the fingers, or tufting of the terminal phalanges, as well as thickening of the skull bones.1,8 Sweating and teeth are normal.2,7,9 The disease results from mutation in the GJB6 gene (chromosome 13q11–q12.1),10 encoding connexin 30 (Cx30), which belongs to a family of cell membrane proteins and forms gap junctions between neighboring cells. Four GJB6 mutations, G11R, A88V, V37E, and D50N, have been reported in Clouston syndrome

ª 2015 The Authors. International Journal of Dermatology published by International Journal of Dermatology 2015 John Wiley & Sons Ltd on behalf of International Society of Dermatology. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

1

2

Report

Pietrzak et al.

Immune system disturbances in Clouston syndrome

Table 1 Clinical findings

Patient, no.

Proband (III 1)

Gender/age (years) M, 6 Nails anomalies Thickened (nail plate thickness, mm) Fi (1.2)/T Discolored Fi/T Hyperconvex Brittle T Subungual hyperkeratosis Small plate Sparse eyebrows/sparse eyelashes +/ (long) Scalp hair Trichorrhexis nodosa + Single hairs with 180 degree longitudinal twisting + Sparse, fine + (pale) Palmoplantar hyperkeratosis/hyperpigmentation over large joints /+ Radiologic findings Thickening of the cortex layer and periosteal proliferation in proximal phalanges Degenerative changes within metatarsal phalangeal joint Thickening of cranial bones/increased density of bone structure / Brachycephalic skull + Extra- and intraoral examination and evaluation of panoramic x-rays Full permanent dentition Normal dental and skeletal development Properly erupted third permanent molar

Father (II 1)

Aunt (II 2)

Uncle (II 3)

Grandfather (I 1)

M, 41

F, 43

M, 47

M, 76

Fi (2.3)/T Fi/T Fi Fi

Fi (1.4) Fi/T Fi Fi/T

Fi (2.4)/T Fi/T Fi T

Fi Fi/T Fi T

T +/+

+/+

+/+

+/uk

+ + + (pale, wiry) +/

+ + + (dark) +/+

+ + + (pale, wiry) +/

uk uk + (pale) +/

+

uk

+ +

+ +/+

+

+

+

+

+

+

+

/

/

uk uk

uk

The proband presented with recurrent upper respiratory tract infections. ( ), absent; (+), present; F, female; Fi, finger; M, male; T, toe; uk, unknown.

thus far.3,9–12 Cx30 is expressed in the epidermis, hair follicles, nails, cochlea, and brain.9,11,13 We report, for the first time, immunological particularities of a large multigenerational Polish family with Clouston syndrome.

to periodically occurring leukopenia (WBC 2800 9 103/ll, normal range: 4.10–5.30 9 103/ll), the patient was consulted by a hematologist. The cause of recurrent leukopenia was not identified. The levels of total IgG, IgM, IgA, IgG subclasses, and C3–C4 complement components were normal. Infections caused by cytomegalovirus (CMV) and Epstein–Barr virus

Materials and methods

(EBV) were excluded. Analysis of family history revealed four clinically affected

Five members of the same multigenerational Polish family presenting with Clouston syndrome were referred. The proband,

individuals with variable degree of skin involvement: a 76-yearold grandfather, two sons (47 and 41 years old), and one

a 6-year-old boy, was the first child of non-consanguineous

daughter (43 years old). None of the remaining four patients

parents. He was born at term with a 3.4 kg body weight. At

presented with infections. Clouston syndrome has not been

birth, his nail plates were slightly discolored and then became

previously diagnosed in any of the family members.

gradually dystrophic. Dark hairs were approximately 1 cm long,

The optical light microscopy analysis of the hair shaft,

resembling coils. They were dense in the frontoparietal area

ultrasound examination of the nail plate, x-ray examination of

and sparse in the occipital area. When hair loss occurred, new

the skull, hand, and foot bones, extra- and intraoral

hair was fair and sparse. From 3 years of age, the patient presented with atopic dermatitis and recurrent upper respiratory

examination, and panoramic x-rays were performed in all patients with Clouston syndrome. The oldest patient (86-year-

tract infections treated with amoxicillin, cefuroxime, and

old man) was not subjected to some of the diagnostic tests

cefaclor. At the age of 6 years, he developed right lobar

because he died before the end of the study. The results are

pneumonia, which was confirmed by chest x-ray and chest

presented in Table 1 and Figure 1.

computed tomography scan. The pneumonia was treated with systemic antibiotics: clarithromycin, cefuroxime, amikacin, and meropenem. High levels of antibodies against Mycoplasma pneumoniae and Chlamydia pneumoniae were detected. Owing International Journal of Dermatology 2015

Isolation of peripheral blood Peripheral blood was obtained from all five patients with Clouston syndrome and from 20 healthy volunteers (eight ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

Pietrzak et al.


(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

(i)

(j)

(k)

(l)

Report

Figure 1 Clinical findings: (a–d) fine sparse pale hairs; (e–h) thickened, discolored fingernail plates; and (i–l) thickened

discolored toenail plates women and 12 men, among them not affected relatives of the

thermostat at 37 °C for 10 minutes. Simultaneously, the control

patients with Clouston syndrome) aged between 19 and

samples were put into an ice bath to inhibit phagocytosis.

73 years (median age: 40.5 years; mean:

Afterwards, 100 ll of brilliant blue (quenching solution) was

44.82 31.12 years). None of the subjects in the study group and controls complained of ailments characteristic for the

added to suppress the fluorescence of bacteria connected to the leukocyte surface. After two washing steps (with 2 ml of washing

current infection. None was taking immunosuppressive or

solution, centrifuged at 700 9 g, supernatant was pumped out),

immunomodulatory treatments within the last 12 months. The

erythrocytes were lysed using a lysis fluid for 20 minutes at room

local ethical committee at the Medical University of Lublin

temperature. Finally, 50 ll propidium iodide was added to stain

approved the research, and all patients gave their written

leukocytes and bacterial DNA.

informed consent to participate in the study. Blood was collected in plastic testing tubes with EDTA, and the percentages and absolute numbers of lymphocytes and neutrophils were evaluated. For the evaluation of phagocytizing cells, phagocytic activity, percentages of bursting cells, and neutrophil oxygen metabolism, the blood was collected in lithium heparin plastic testing tubes.

Phagocytosis The assessment of phagocytosis was performed using a Phagotest Kit (ORPEGEN Pharma, Heidelberg, Germany) containing fluorescein-labeled opsonized Escherichia coli (E. coli– fluorescein isothiocyanate [FITC]). One hundred microliter blood samples with heparin were cooled in an ice bath for 15 minutes, mixed with 2 9 107 FITC-labeled E. coli and put in a chamber ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

Oxidative burst Granulocyte oxidative burst was determined quantitatively with Burst test kit (ORPEGEN Pharma). Fresh heparinized blood was put in a water bath for 15 minutes. Then, four testing tubes were filled with 100 ll of blood each, and 2 9 107 unlabeled opsonized E. coli, 20 ll of substrate solution (negative control), 20 ll peptide N-formyl-methionyl-leucylphenylalanine as chemotactic low physiological stimulus (low control) and 20 ll phorbol 12-myristate 13-acetate, a strong non-receptor activator (high control). All the samples were incubated for 10 minutes at 37 °C in a water bath, dihydrorhodamine 123 added as a fluorogenic substrate, and incubated again under the same conditions. The oxidative burst occurred with the production of reactive oxygen species International Journal of Dermatology 2015

3

4

Report

Pietrzak et al.


(superoxide anion, hydrogen peroxide) in granulocytes stimulated in vitro. In reactive oxygen species-stimulated granulocytes, non-fluorescent dihydrorhodamine underwent conversion to fluorescent rhodamine registered in a flow cytometer. Erythrocytes were removed with lysing solution for 20 minutes at room temperature, centrifuged (5 min, 700 9 g, 4 °C), and supernatant was discarded. The samples were

Antibodies against cytomegalovirus and Epstein–Barr virus In all subjects, serum levels of IgM and IgG antibodies against EBV-CA antigen (EBV capsid antigen), EBV-EA (EBV early antigen), and IgM and IgG antibodies against CMV were determined with the aid of commercial assays purchased from IBL International (Hamburg, Germany).

washed again (washing solution), centrifuged (5 min, 700 9 g, 4 °C), and the supernatant was decanted. Two hundred microliters of DNA staining solution (centrifuged and incubated for 10 min at 0 °C in a dark place) was added to discriminate and exclude aggregation artifacts of bacteria and/or cells in cytometric flow analysis.

Isolation of peripheral blood mononuclear cells and the detection of lymphocyte subsets Peripheral blood mononuclear cells were aseptically separated by a standard density gradient centrifugation (Gradisol L; Aqua d Medica, Ło z, Poland). The percentage of cells expressing surface markers was analyzed. The cells were phenotypically characterized by incubation (20 min in the dark at a room temperature) with the combination of a relevant FITC, phycoerythrin (PE), and CyChrome-labeled monoclonal antibodies. Immunofluorescence studies were performed using a combination of the following monoclonal antibodies: CD3 FITC, CD19 FITC, CD3 FITC/CD19 PE, CD4 PE, CD8 PE, CD8 FITC/CD4 PE, CD25 CyChrome, and CD69 CyChrome, purchased from BD Biosciences (San Jose, CA, USA). The percentages of natural killer (NK) cells were evaluated with flow cytometry using monoclonal antibodies anti-CD3 FITC/CD16+ CD56 PE/CD45 PerCP (BD Biosciences), which allowed for simultaneous assessment of T (CD3+) lymphocytes and NK (CD3–/CD16+CD56+) cells. Three-color immunofluorescence analyses were performed using a FACSCaliber flow cytometer (Becton Dickinson, San Jose, CA, USA) equipped with a 488 nm argon laser. A minimum of 10,000 events were acquired and analyzed using CellQuest Software (Becton Dickinson). The results were presented as percentage of CD45+ cells stained with antibody. The percentage of positive cells was calculated as a fraction of the control sample. Background fluorescence was determined using isotypematched directly conjugated mouse anti-IgG1/IgG2a monoclonal antibodies. The samples were gated on forward scatter vs. side scatter to exclude debris and cell aggregates. Serum levels of immunoglobulins and complement components C3 and C4 The serum levels of IgA, IgM, IgE, IgG, and IgG subclasses: IgG1, IgG2, IgG3, and IgG4, as well as C3 and C4 complement components, were measured in all the family members with a nephelometric technique, using a BN2 nephelometer (Dade Behring, Marburg, Germany), according to the manufacturer’s instructions. International Journal of Dermatology 2015

Mutation screening DNA was isolated from venous blood according to Miller et al.14 The GJB6 gene was analyzed by direct sequencing. Polymerase chain reaction (PCR) and sequencing primers were designed with Mutation Discovery software (GJB6-F1: AGACTAGCAGGGCAGGGAG and GJB6-R1: CAAATCACAGACGCAGAAA; GJB6-F2: GCAGAAGGTTCGGATAGAG and GJB6-R2: GTTGTGTATGAATGGAGCAA, Transgenomic, Inc., Omaha, NE, USA). Twenty microliters of the amplification reaction mix contained: 10 pmol of each forward and reverse primer, 2.5 mM dNTPs, 19 PCR buffer, 1 U Taq polymerase Fast Start (Roche, Berlin, Germany), 250 ng DNA water. PCR conditions were as follows: 95 °C for 5 min and 5 cycles: 96 °C for 15 s, 68 °C for 15 s, with touchdown 1° per cycle, 72 °C for 30 s, 25 cycles: 96 °C for 15 s, 63 °C for 15 s, 72 °C for 30 s, and 72 °C for 7 min. PCR products were purified using an EXOSAP-IT (Amersham Biosciences, Little Chalfont, Buckinghamshire, UK) according to the manufacturer’s protocol. Standard sequencing reaction and capillary electrophoresis with an ABI PRISM 3730 sequencer (Applied Biosystems, Waltham, MA, USA) were performed. Fluorochromatograms were analyzed using a Mutation SurveyorTM software (SoftGenetics, State College, PA, USA). Sequence NM_006783.4 and NP_006774.2 was used as a reference. The databases used in the study included NCBI (http://www.ncbi.nlm.nih.gov), Ensembl (http://www.ensembl.org/index.html), HGMD (http:// www.hgmd.cf.ac.uk/ac/index.php), and HGVS (http:// www.hgvs.org/). Statistical analysis Statistical analysis was conducted using Statistica 9.0 (StatSoft, Inc., Tulsa, OK, USA). Normal distribution of the analyzed variables was verified with the Kolmogorov–Smirnov test. The results were presented as means SD, medians, minimum, and maximum values. The significance of intergroup differences was verified with the Mann–Whitney U-test. P < 0.05 was considered statistically significant.

Results All patients enrolled in this study carried the pathogenic p.G11R mutation (c.31G>A, rs104894415) of GJB6 gene (mutation p.G11R reference sequences: NP_006774.2, NM_006783.4; Fig. 2). ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

Pietrzak et al.


Report

(a)

(b)

Figure 2 Pedigree of the Polish Clouston family (a) and genetic results of the exon 1 the GJB6 gene analysis (b). All numbered individuals were examined and their DNA samples collected and analyzed for mutation in the GJB6 gene. Analysis of G11R mutation of the GJB6 was performed using Mutation Surveyor software

Figure 3 Phagocytic activity of granulocytes in the Clouston family and healthy donors (%)

The ability of neutrophils to phagocytize opsonized E. coli was assessed. The analysis revealed a significantly reduced phagocytic activity of granulocytes, with median values of 75.6% granulocytes and 53.38% monocytes (reference ranges: 95–100% and 70–100%, respectively, healthy donors: 98.65%, P = 0.00014, and 91.95%, P = 0.00132, respectively; Figs. 3 and 4). The Bursttest was used to measure the ability of the peripheral blood monocytes and granulocytes to induce oxidative burst. We revealed that the percentages of granulocytes and monocytes being positive for oxidative burst were also significantly reduced, with median values of 72.46% granulocytes and 51.71% monocytes (reference ranges: 95–100% and 70–100%, respectively, healthy donors: 97.51%, P = 0.00215, and 93.95%, P = 0.00298, respectively; Figs. 5 and 6). No disturbances in the percentages and absolute counts of T CD3+, T CD3+/CD4+, T CD3+/CD8+, NK, and B CD19+ cells were found (Table 2). ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

Figure 4 Phagocytic activity of monocytes in the Clouston family and healthy donors (%)

The levels of all immunoglobulins (IgA, IgG, IgM, and IgG subclasses) and complement components C3 and C4 followed a normal distribution. Active infections caused by CMV and EBV were excluded. Discussion Our study included a large three-generation Polish family with genetically confirmed Clouston syndrome. Similar to previous reports,10 hair and nail abnormalities were entirely consistent throughout affected members of the family. Only the youngest patient had less sparse hair than adult members of this family. A small decrease in the severity of the condition from generation to generation was previously observed in Clouston syndrome.1 It has been suggested that the reduction of symptoms in successive generations may result from a younger age of patients, rather than from an improvement of the International Journal of Dermatology 2015

5

6

Report


Figure 5 Oxidative burst of granulocytes in the Clouston family and healthy donors (%)

Figure 6 Oxidative burst of monocytes in the Clouston family and healthy donors (%)

condition in the subsequent generation.1 Consistent with literature data,15 trichorrhexis nodosa was the main hair shaft defect observed in our four patients. However, this condition is not specific for Clouston syndrome and was observed in other ectodermal dysplasias.15 Additionally, our findings may expand the phenotype of Clouston syndrome. Bone abnormalities were previously reported.1 However, only one person presented with thickening of cranial bones and increased density of bone structure, typical for this syndrome. Contrary to previously reported changes in terminal phalanges,1 we observed thickening of the cortical layer and periosteal proliferation in proximal phalanges, as well as degenerative changes within the metatarsophalangeal joints. Defective immune response has not been reported in Clouston syndrome thus far. Interestingly, all affected patients partaking in our study showed reduced phagoInternational Journal of Dermatology 2015

Pietrzak et al.

cytic activity and reduced ability of the peripheral blood monocytes and granulocytes to induce oxidative burst. However, only the youngest patient suffered from recurrent infections. Therefore, the defective phagocytosis observed in all affected members of the hereby presented family seems to be more complex. This familiar attenuation of phagocyte response is not the result of general depletion of the immune system due to a chronic severe inflammatory process, as we did not record such a process in our family. Moreover, the levels of immunoglobulins and complement components C3 and C4 were normal. This suggests that the observed defect of phagocytosis was probably not associated with an immunoglobulin or complement defect. The healthy members of the hereby presented family did not show any immune abnormalities. It cannot be excluded that the immunological disturbances observed solely in patients with Clouston syndrome were associated with a mutation in Cx30. The data on a potential direct link between Cx30 and immune cells are sparse. However, a growing body of evidence points to the contribution of connexins to various aspects of immune response.16–19 To this date, several connexins (Cx43, Cx40, Cx37, Cx32, Cx30.3) were found expressed on various immune and hematopoietic cells.16–19 Cortez et al.20 demonstrated the expression of genes encoding Cx26 and Cx30 in human monocytes in response to conidia of Aspergillus fumigatus. This study is very interesting because it shows that the expression of genes encoding Cx26 and Cx30 may be involved in the monocyte-mediated host response to Aspergillus fumigatus.20 Currently, gap junctions composed of connexins are believed to modulate various biological processes, and some members of the connexin family form functional hemichannels play a role in cell defense.20–22 It has been demonstrated that G11R or A88V mutated forms of Cx30 retain the ability to form intercellular channels and may form hemichannels. Furthermore, it was observed that HeLa cells transfected with either G11R or A88V Cx30 had two- to threefold higher extracellular adenosine triphosphate (ATP) leakage than the control cells.21 The authors of the latter study concluded that excessive leakage of ATP via mutated Cx30 hemichannels to extracellular environment might be a molecular mechanism leading to clinical manifestations of Clouston syndrome.21 Based on current knowledge, aberrant hemichannels may have an impact on immune cells in patients with Clouston syndrome, releasing ATP, and possibly acting via other messengers. However, this hypothesis is based on the assumption that such leakage may exert a systemic effect. It was demonstrated that ATP inhibits neutrophil apoptosis23 but also enhanced neutrophil degranulation and ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

Pietrzak et al.


Report

(a)

(b)

Figure 2 Pedigree of the Polish Clouston family (a) and genetic results of the exon 1 the GJB6 gene analysis (b). All numbered individuals were examined and their DNA samples collected and analyzed for mutation in the GJB6 gene. Analysis of G11R mutation of the GJB6 was performed using Mutation Surveyor software

Figure 3 Phagocytic activity of granulocytes in the Clouston family and healthy donors (%)

The ability of neutrophils to phagocytize opsonized E. coli was assessed. The analysis revealed a significantly reduced phagocytic activity of granulocytes, with median values of 75.6% granulocytes and 53.38% monocytes (reference ranges: 95–100% and 70–100%, respectively, healthy donors: 98.65%, P = 0.00014, and 91.95%, P = 0.00132, respectively; Figs. 3 and 4). The Bursttest was used to measure the ability of the peripheral blood monocytes and granulocytes to induce oxidative burst. We revealed that the percentages of granulocytes and monocytes being positive for oxidative burst were also significantly reduced, with median values of 72.46% granulocytes and 51.71% monocytes (reference ranges: 95–100% and 70–100%, respectively, healthy donors: 97.51%, P = 0.00215, and 93.95%, P = 0.00298, respectively; Figs. 5 and 6). No disturbances in the percentages and absolute counts of T CD3+, T CD3+/CD4+, T CD3+/CD8+, NK, and B CD19+ cells were found (Table 2). ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

Figure 4 Phagocytic activity of monocytes in the Clouston family and healthy donors (%)

The levels of all immunoglobulins (IgA, IgG, IgM, and IgG subclasses) and complement components C3 and C4 followed a normal distribution. Active infections caused by CMV and EBV were excluded. Discussion Our study included a large three-generation Polish family with genetically confirmed Clouston syndrome. Similar to previous reports,10 hair and nail abnormalities were entirely consistent throughout affected members of the family. Only the youngest patient had less sparse hair than adult members of this family. A small decrease in the severity of the condition from generation to generation was previously observed in Clouston syndrome.1 It has been suggested that the reduction of symptoms in successive generations may result from a younger age of patients, rather than from an improvement of the International Journal of Dermatology 2015

5

6

Report


Figure 5 Oxidative burst of granulocytes in the Clouston family and healthy donors (%)

Figure 6 Oxidative burst of monocytes in the Clouston family and healthy donors (%)

condition in the subsequent generation.1 Consistent with literature data,15 trichorrhexis nodosa was the main hair shaft defect observed in our four patients. However, this condition is not specific for Clouston syndrome and was observed in other ectodermal dysplasias.15 Additionally, our findings may expand the phenotype of Clouston syndrome. Bone abnormalities were previously reported.1 However, only one person presented with thickening of cranial bones and increased density of bone structure, typical for this syndrome. Contrary to previously reported changes in terminal phalanges,1 we observed thickening of the cortical layer and periosteal proliferation in proximal phalanges, as well as degenerative changes within the metatarsophalangeal joints. Defective immune response has not been reported in Clouston syndrome thus far. Interestingly, all affected patients partaking in our study showed reduced phagoInternational Journal of Dermatology 2015

Pietrzak et al.

cytic activity and reduced ability of the peripheral blood monocytes and granulocytes to induce oxidative burst. However, only the youngest patient suffered from recurrent infections. Therefore, the defective phagocytosis observed in all affected members of the hereby presented family seems to be more complex. This familiar attenuation of phagocyte response is not the result of general depletion of the immune system due to a chronic severe inflammatory process, as we did not record such a process in our family. Moreover, the levels of immunoglobulins and complement components C3 and C4 were normal. This suggests that the observed defect of phagocytosis was probably not associated with an immunoglobulin or complement defect. The healthy members of the hereby presented family did not show any immune abnormalities. It cannot be excluded that the immunological disturbances observed solely in patients with Clouston syndrome were associated with a mutation in Cx30. The data on a potential direct link between Cx30 and immune cells are sparse. However, a growing body of evidence points to the contribution of connexins to various aspects of immune response.16–19 To this date, several connexins (Cx43, Cx40, Cx37, Cx32, Cx30.3) were found expressed on various immune and hematopoietic cells.16–19 Cortez et al.20 demonstrated the expression of genes encoding Cx26 and Cx30 in human monocytes in response to conidia of Aspergillus fumigatus. This study is very interesting because it shows that the expression of genes encoding Cx26 and Cx30 may be involved in the monocyte-mediated host response to Aspergillus fumigatus.20 Currently, gap junctions composed of connexins are believed to modulate various biological processes, and some members of the connexin family form functional hemichannels play a role in cell defense.20–22 It has been demonstrated that G11R or A88V mutated forms of Cx30 retain the ability to form intercellular channels and may form hemichannels. Furthermore, it was observed that HeLa cells transfected with either G11R or A88V Cx30 had two- to threefold higher extracellular adenosine triphosphate (ATP) leakage than the control cells.21 The authors of the latter study concluded that excessive leakage of ATP via mutated Cx30 hemichannels to extracellular environment might be a molecular mechanism leading to clinical manifestations of Clouston syndrome.21 Based on current knowledge, aberrant hemichannels may have an impact on immune cells in patients with Clouston syndrome, releasing ATP, and possibly acting via other messengers. However, this hypothesis is based on the assumption that such leakage may exert a systemic effect. It was demonstrated that ATP inhibits neutrophil apoptosis23 but also enhanced neutrophil degranulation and ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

Pietrzak et al.


Report

Table 2 Percentages and absolute counts of T CD3+, T CD3+/CD4+, T CD3+/CD8+, NK, and B CD19+ of patients with

Clouston syndrome Parameter

Group

Lymphocytosis (9103 cells/ll)

Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls Clouston Controls

T CD3+ cells (%) T CD3+ cells (9103 cells/ll) B CD19+ cells (%) B CD19+ cells (9103 cells/ll) T CD3+/CD4+ cells (%) T CD3+/CD4+ cells (9103 cells/ll) T CD3+/CD8+ cells (%) T CD3+/CD8+ cells (9103 cells/ll) CD4+/CD8+ ratio NK cells CD3–/CD16+/CD56+ (%) NK cells CD3–/CD16+/CD56+ (9103 cells/ll)

syndrome syndrome syndrome syndrome syndrome syndrome syndrome syndrome syndrome syndrome syndrome syndrome

Median

Minimum

Maximum

Mean

SD

P

1.61 1.62 68.86 67.79 1.62 1.68 13.45 12.71 0.18 0.19 46.11 45.02 1.08 1.09 30.95 31.91 0.82 0.80 1.45 1.46 18.38 18.05 0.45 0.43

1.26 1.29 61.88 61.49 0.97 0.96 6.93 7.17 0.11 0.13 41.52 40.16 0.59 0.63 29.17 28.56 0.38 0.41 1.13 1.19 12.32 12.42 0.26 0.24

3.16 3.27 81.41 79.63 2.99 3.03 16.24 15.92 0.26 0.24 49.57 48.88 1.94 1.97 40.38 41.52 1.64 1.76 2.01 1.97 20.12 21.61 1.96 1.98

1.72 1.70 69.11 68.19 2.84 2.88 13.59 12.99 0.17 0.18 45.76 44.68 1.09 1.07 30.92 31.77 0.83 0.86 1.52 1.54 18.81 17.87 0.47 0.49

0.51 0.44 7.88 7.97 0.67 0.70 4.83 4.67 0.03 0.05 5.34 5.68 0.41 0.42 3.67 4.36 0.34 0.33 0.15 0.17 2.25 2.99 0.51 0.55

NS NS NS NS NS NS NS NS NS NS NS NS

NS, not significant.

superoxide production.24–26 Further studies revealed that although ATP and adenosine diphosphate exert inhibitory effect on neutrophil phagocytosis under physiologic conditions, the phagocytic activity was completely restored after contact with lipopolysaccharide and N-formyl-methionyl-leucyl-phenylalanine.25 Based on these findings, the authors of this study concluded that adenosine nucleotides play a protective role under physiologic conditions, protecting tissues against self-destruction triggered by circulating neutrophils, until encounter with pathogens.25 This may explain the significantly reduced phagocytic activity of granulocytes demonstrated in all patients with ectodermal dysplasia included in our study. It should be emphasized that in contrast to their healthy relatives, all affected members of this family presented with significantly reduced phagocytic activity and oxidative burst of cells playing crucial roles in nonspecific immune response. However, only the youngest patient suffered from recurrent infections. Therefore, it cannot be excluded that clinical manifestation of this immune defect may result from combination of genetic, environmental, or other unknown factors. Interestingly, an increase in the prevalence of atopic symptoms and risk of immunodeficiency was demonstrated recently among patients with ectodermal dyspla-

sia.27 This large retrospective study also included patients with Clouston syndrome. The authors suggested that a combination of environmental and genetic factors causes disturbances of the skin and mucosal barrier in ectodermal dysplasia and resultant enhanced transmission and sensitization to irritants, allergens, and pathogens.27 It cannot be excluded that the coexistence of atopic dermatitis and Clouston syndrome in the youngest patient was responsible for recurrent infections. In addition and in view of our findings, innate immune deficiency may be responsible for inappropriate elimination of microorganisms and recurrent infections. However, only supportive treatment is nowadays available.28 We did not observe alterations in the percentages of lymphocyte subsets, which points to normal function of the acquired immune system. However, the ability for producing cytokines, proliferation after appropriate stimulus, should be assessed to confirm this assumption and other functional tests should be conducted.

ª 2015 The Authors. International Journal of Dermatology published by John Wiley & Sons Ltd on behalf of International Society of Dermatology.

International Journal of Dermatology 2015

Conclusions We believe that this very interesting case of Clouston syndrome adds to our knowledge about this disease; however, it raises many questions as well. For the first time,

7