Immunosurveillance from Pluripotent Stem Cells to ...

Published OnlineFirst May 31, 2011; DOI:10.1158/0008-5472.CAN-11-0359

In Vivo Programming of Tumor Antigen-Specific T Lymphocytes from Pluripotent Stem Cells to Promote Cancer Immunosurveillance Fengyang Lei, Baohua Zhao, Rizwanul Haque, et al. Cancer Res 2011;71:4742-4747. Published OnlineFirst May 31, 2011.

Updated Version Supplementary Material

Cited Articles

E-mail alerts Reprints and Subscriptions Permissions

Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-11-0359 Access the most recent supplemental material at: http://cancerres.aacrjournals.org/content/suppl/2011/05/31/0008-5472.CAN-11-0359.DC1.html

This article cites 20 articles, 10 of which you can access for free at: http://cancerres.aacrjournals.org/content/71/14/4742.full.html#ref-list-1

Sign up to receive free email-alerts related to this article or journal. To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at [email protected]. To request permission to re-use all or part of this article, contact the AACR Publications Department at [email protected].

Downloaded from cancerres.aacrjournals.org on September 27, 2011 Copyright © 2011 American Association for Cancer Research


Cancer Research

Priority Report

In Vivo Programming of Tumor Antigen-Specific T Lymphocytes from Pluripotent Stem Cells to Promote Cancer Immunosurveillance Fengyang Lei1, Baohua Zhao3, Rizwanul Haque1, Xiaofang Xiong1, Lynn Budgeon2, Neil D. Christensen2, Yuzhang Wu4, and Jianxun Song1

Abstract Adoptive T-cell immunotherapy has garnered wide attention, but its effective use is limited by the need of multiple ex vivo manipulations and infusions that are complex and expensive. In this study, we show how highly reactive antigen (Ag)-specific CTLs can be generated from induced pluripotent stem (iPS) cells to provide an unlimited source of functional CTLs for adoptive immunotherapy. iPS cell–derived T cells can offer the advantages of avoiding possible immune rejection and circumventing ethical and practical issues associated with other stem cell types. iPS cells can be differentiated into progenitor T cells in vitro by stimulation with the Notch ligand Deltalike 1 (DL1) overexpressed on bone marrow stromal cells, with complete maturation occurring upon adoptive transfer into Rag1-deficient mice. Here, we report that these iPS cells can be differentiated in vivo into functional CTLs after overexpression of MHC I-restricted Ag-specific T-cell receptors (TCR). In this study, we generated murine iPS cells genetically modified with ovalbumin (OVA)-specific and MHC-I restricted TCR (OT-I) by retrovirus-mediated transduction. After their adoptive transfer into recipient mice, the majority of OT-I/iPS cells underwent differentiation into CD8þ CTLs. TCR-transduced iPS cells developed in vivo responded in vitro to peptide stimulation by secreting interleukin 2 and IFN-g. Most importantly, adoptive transfer of TCR-transduced iPS cells triggered infiltration of OVA-reactive CTLs into tumor tissues and protected animals from tumor challenge. Taken together, our findings offer proof of concept for a potentially more efficient approach to generate Ag-specific T lymphocytes for adoptive immunotherapy. Cancer Res; 71(14); 4742–7. ’2011 AACR.

Introduction Adoptive cell transfer (ACT) of antigen (Ag)-specific CTLs is a promising treatment for a variety of malignancies (1). CTLs can target malignant tumors by T-cell receptor (TCR) and release cytotoxins as well as cytokines to kill tumor cells. However, ACT with these CTLs is often not feasible due to difficulties in obtaining such CTLs from patients. There is an urgent need to find a new approach to generate tumorreactive CTLs for successful ACT-based therapies. Several groups have generated induced pluripotent stem (iPS) cells from somatic cells by transduction of 1 to 4 Authors' Affiliations: Departments of 1Microbiology and Immunology and 2 Pathology, The Pennsylvania State University College of Medicine, Hershey, Pennsylvania; 3College of Life Science, Hebei Normal University, Shijiazhuang; and 4Institute of Immunology, The Third Military Medical University, Chongqing, China Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). F. Lei and B. Zhao contributed equally to this work. Corresponding Author: Jianxun Song, Department of Microbiology and Immunology, The Pennsylvania State University College of Medicine, 500 University Dr, Hershey, PA 17033. Phone: 717-531-0003, ext. 287768; Fax: 717-531-4600; E-mail: [email protected] doi: 10.1158/0008-5472.CAN-11-0359 ’2011 American Association for Cancer Research.

4742

transcription factors (2, 3). This approach provides an opportunity to generate patient- or disease-specific pluripotent stem cells (4). In addition, researchers have produced iPS cells that are safe for transplantation into patients (5, 6). Moreover, it has been reported that the combined iPS–gene therapy approach cures certain human genetic diseases in vitro (7). Because of the plasticity and potentially unlimited capacity for self-renewal, iPS cell-based therapies may have great potential in the treatment of diseases. Previous studies have shown successful T-cell development from pluripotent stem cells (8, 9), and we have shown T lineage differentiation from iPS cells (10). However, it remains unclear whether iPS cells can differentiate into functional, Agspecific CTLs. In this study, we adoptively transferred into mice iPS cells that were transduced with Ag-specific TCR genes. We found that these iPS cells differentiated into functional Ag-specific CTLs in vivo and significantly protected the hosts from a tumor challenge.

Materials and Methods Cells and mice The mouse iPS-MEF-Ng-20D-17 cell line was obtained from RIKEN Cell Bank on September 1, 2008. iPS-MEF-Ng-20D-17 cell generated from male C57BL/6 mouse embryonic fibroblasts by introducing the 4 factors (Oct3/4, Sox2, Klf4, and

Cancer Res; 71(14) July 15, 2011



Generation of Antigen-Specific T Lymphocytes from iPS Cells

Cell culture iPS cells were maintained on feeder layers of irradiated SNL76/7 cells as previously described (10). Retroviral transduction Retroviral transduction was performed as described previously (12). Expression of DsRed was determined by flow cytometry gating on GFPþ cells. DsRedþ GFPþ cells were purified by cell sorting using a MoFlo high-performance cell sorter (Dako Cytomation). ACT and tumor challenge A total of 3 106 GFPþ DsRedþ iPS cells or bone marrow– derived CD117þ Lin hematopoietic stem cells (HSC) from OT-I TCR transgenic mice in PBS were injected i.v. into 4week-old C57BL/6 mice. After 6 to 10 weeks, OVA-specific Vb5þ CD8þ T-cell development in lymph nodes and spleen was determined by flow cytometry. For tumor challenge, 6 weeks after adoptive transfer, mice were challenged intraperitoneally with E.G7-OVA tumor cells as previously described (12). In some experiments, mice were challenged with tumor cells 1 day following i.v. injection with CD8þ T cells isolated from OT-I TCR transgenic mice. Flow cytometric analysis On day 50 of tumor challenge, CD8þ T cells from spleens were stimulated with irradiated T-depleted splenocytes pulsed with 0.5 mmol/L OVA257–264 peptide (GenScript) for 7 hours. IL-2 and IFN-g were analyzed by intracellular cytokine staining. Tumor tissue from the peritoneal cavity was prepared for a single-cell suspension and analyzed expression of Va2 and Vb5 by flow cytometry, after gating on CD8þ cells.

www.aacrjournals.org

Histology and immunofluorescence H&E staining. Routine hematoxylin & eosin (H&E) staining was performed at an interval of every 5 serial sections. Immunologic staining. Tissue sections were fixed with acetone and incubated with 3% bovine serum albumen to

A ψ LTR

α chain P2A

β chain

IRES DsRed LTR

B

GFP channel DsRed channel

Brightfield

C

0.58%

3.32%

Overlay 100%

DsRed

Antibodies Fluorescein isothiocyanate (FITC) anti-mouse Vb5 TCR (MR9-4), R-Phycoerythrin (PE) or adenomatous polyposis coli (APC) anti-mouse Va2 TCR (B20.1) or interleukin (IL)-2 (JES6-5H4), and APC anti-mouse IFN-g (XMG1.2) were obtained from BD PharMingen. PE/Cy7 or APC anti-mouse CD25 and APC/Cy7 or PerCP anti-mouse CD69 were obtained from Biolegend. FITC or PE anti-mouse CD8 (6A242) were obtained from Santa Cruz Biotech. FITC-OVA (200-4233) was purchased from Rockland Immunochemicals.

In vivo proliferation/cytotoxicity assay Splenocytes from naïve C57BL/6 mice labeled with Carboxyfluorescein succinimidyl ester (CFSE; Invitrogen) were used as targets. Cells labeled with 5 mmol/L CFSE (CFSEhi cells) were pulsed with 10 mg/mL OVA257–264 peptide, and cells labeled with 0.5 mmol/L CFSE (CFSElo cells) were not pulsed. A mixture of 2.5 106 CFSEhi plus 2.5 106 CFSElo cells were transferred by i.v. injection into indicated recipients. After 16 hours, splenocytes were collected and analyzed as described previously (13).

GFP No transduction Post transduction

D

RT-PCR

Post cell sorting

PCR

D N A iP m S a iP ce rke S lls r T cel /M ce ls iD T lls /Mi R-T ce fr D C lls om R R fro O m TC Im 57 ic BL e /6 m ic D e N A T m ce ar T lls ker ce fr iP lls om S f C iP ce rom 57 S lls O B ce /M T L/6 lls iD -I m m /M R i ic ce e iD R -T C R

c-Myc) is carrying Nanog promoter-driven green fluorescent protein (GFP)/internal ribosome entry site (IRES)/puromycinresistant gene (11). Expression of Oct3/4, Sox2, Klf4, and c-Myc was confirmed by reverse-transcriptase PCR (RT-PCR), and GFP expression was confirmed by flow cytometry during the course of this study. The OVA-expressing E.G7 lymphoma cell line (E.G7-OVA) was purchased from American Type Culture Collection and was authenticated by flow cytometry before use. OT-I TCR-transgenic mice were purchased from The Jackson Laboratory. All experiments were approved by the Pennsylvania State University College of Medicine Animal Care and Use Committee, Hershey, Pennsylvania, and were in accordance with the guidelines of the Association for the Assessment and Accreditation of Laboratory Animal Care.

Figure 1. Retrovirus-mediated TCR transduction in iPS cells. iPS cells were transduced with the following retroviral constructs: vector control (MiDR) or OVA 257–264-specific TCR (MiDR-TCR). A, schematic representation of the retroviral construct. LTR, long terminal repeats. B, TCR-transduced iPS cells were visualized by fluorescence microscopy. C, GFPþ iPS cells (left) were transduced with the retroviral construct MiDRTCR, and GFPþ DsRedþ iPS cells (middle) were analyzed by flow cytometry and sorted by a high-speed cell sorter (right). D, GFPþ DsRedþ iPS cells were sorted and total mRNA and DNA were analyzed for Vb5 gene expression by RT-PCR (left) and for the Vb5 gene by PCR (right). The forward primer is ACGTGTATTCCCATCTCTGGACAT and the reverse primer is TGTTCATAATTGGCCCGAGAGCTG.



4743


Lei et al.

A

MiDR-TCR/iPS cells 49.6%

HSCs 48.8%

CD8

MiDR vector/iPS cells 1.85%

Vβ5 MiDR vector/iPS cells

MiDR-TCR/iPS cells

HSCs

75.0%

74.1%

72.4%

73.2%

76.7%

72.3%

CD25

% of max

B

MiDR vector/iPS cells

MiDR-TCR/iPS cells

HSCs

39.5%

73.7%

74.6%

45.2%

51.2%

49.9%

IL-2

% of max

C

CD69

D

MiDR vector/iPS cells 1± 2.5

49.5%

MiDR-TCR/iPS cells 94.3± 2.9

5.37%

IFN-γ

Figure 2. Ag-specific CD8þ T-cell development from iPS cells in vivo. GFPþ DsRedþ iPS cells were injected i.v. into C57BL/6 mice. After 6 to 10 weeks, OVA-specific Vb5þ CD8þ T-cell development was determined. A, CD8þ Vb5þ T cells from pooled lymph nodes and spleen were analyzed by flow cytometry. B, CD25 and CD69 expression was analyzed by flow cytometry, after gating on CD8þ Vb5þ T cells (dark lines; shaded areas indicate isotype controls). C, IL-2 and IFN-g production from the CD8þVb5þ population (dark lines; shaded areas indicate isotype controls) was determined by intracellular cytokine staining. D, in vivo proliferation/cytotoxicity assay. CFSEhi (right peaks) and CFSElo (left peaks) target cells were pulsed with OVA257–264 peptide and the control, respectively, and were injected into mice 10 weeks after iPS cell transfer or 1 day after OT-I CTL transfer. Data are representative of 2 or 3 independent experiments.

OT-I CTLs 91.8± 3.8

7.52%

CFSE

4744



Cancer Research



A

13.9%

Statistics One-way ANOVA was used for the statistical analysis between groups and significance was set at 5%. Kaplan–Meier analyses were used to determine percentage of survival based on death of the animals due to tumor growth in the peritoneal cavity.

6.02%

In vivo persistence of Ag-specific T cells derived from TCR gene-transduced iPS cells After 50 days, we visualized an increased number of OVAspecific CD8þ T cells in the pooled lymph nodes and spleen cells in mice receiving TCR gene–transduced iPS cells than in mice receiving CD8þ T cells from OT-I TCR transgenic mice (52.7% versus 12.8%; Fig. 3A). Adoptive transfer of TCR gene-transduced iPS cells prevents tumor growth On day 30 after tumor challenge, we found fewer tumor cells in the peritoneal cavity of mice receiving TCR gene–transduced iPS cells than in mice receiving either CD8þ T cells from OT-I TCR transgenic mice or control gene-transduced iPS cells (Fig. 3B and Supplementary Fig. S2). On day 50, we observed 100% survival of mice receiving TCR gene–transduced iPS cells, compared with 55% survival of mice receiving CD8þ T cells from OT-I TCR transgenic mice (Fig. 3C). Moreover, we observed tumor-infiltrating OVA–specific CD8þ T cells in mice receiving TCR gene–transduced iPS cells (Fig. 4).


CD8

Vβ5

B # tumor cells (× 106 )

100

*

80 60

*

40 20

R C

s

-T

TL

R

C

/M

iD

TI

ce

lls

S

ce S

N

iP

o

ce

ll

lls

tra

/M

ns

iD

fe

R

r

0

iP

C 100

Percent survival

TCR gene-transduced iPS cells differentiated into CTLs in vivo We observed approximately 49% of CD8þ Vb5þ cells in mice receiving TCR gene–transduced iPS cells or HSCs. In contrast, the CD8þ Vb5þ cells were less than 2% in mice receiving control gene–transduced iPS cells (Fig. 2A and Supplementary Fig. S1). In addition, we observed that most CD8þ Vb5þ cells expressed CD25 and CD69 (Fig. 2B) and produced IL-2 and IFN-g (Fig. 2C). Furthermore, we found that target cell lysis was approximately 90 times greater in mice receiving TCR gene–transduced iPS cells than in those receiving control gene-transduced iPS cells (94% versus 1%; Fig. 2D).

iPS cells/MiDR-TCR - Tumor 47.5%

OT-I CTLs - Tumor

Results and Discussion Generation of Ag-specific TCR gene–transduced iPS cells We used the retroviral vector pMig in which MHC-Irestricted OVA–specific TCR a and b chain genes were linked with a 2A peptide (14). We replaced GFP with DsRed for monitoring gene integration and named the new vector as MiDR (Fig. 1A). After transduction, DsRed expression was visualized by fluorescent microscopy (Fig. 1B). Although the transduction efficiency was low, we could sort for DsRedþ GFPþ cells (Fig. 1C). Moreover, we confirmed the expression of TCR Vb5 mRNA and DNA integration in the sorted cells by RTPCR and PCR (Fig. 1D).

iPS cells/MiDR-TCR + Tumor 49.8%

OT-I CTLs + Tumor

O

block nonspecific protein binding. Sections were stained with PE anti-mouse TCR Va2 and FITC-OVA.

75

* No cell transfer

50

**

iPS cells/MiDR OT-I CTLs

25

*

iPS cells/MiDR-TCR 0 0

10

20

30

40

50

Days

Figure 3. Adoptive transfer of TCR-transduced iPS cells suppresses tumor growth and sustains mouse survival. GFPþ DsRedþ cells were adoptively transferred into C57BL/6 mice. One group of mice was injected with OVA-reactive CD8þ T cells from OT-I TCR transgenic mice, and 1 group of mice had no cell transfer. After either 6 weeks or on the following day after the cell transfer, mice were subjected to challenge with E. G7 tumor cells. A, Ag-specific T-cell persistence. Seven weeks post tumor challenge or 13 weeks without tumor challenge, CD8þ Vb5þ T cells from the pooled lymph nodes and spleen were analyzed by flow cytometry. B, on day 20, tumor cells in the peritoneal cavity were enumerated. Data represent mean (SEM) tumor cell counts from 6 individual mice. One-way ANOVA test was used for statistical analyses between 2 groups (*, P < 0.05). C, mouse survival on day 50. Kaplan–Meier survival curves are shown (n ¼ 6). *, P < 0.05; **, P < 0.001, 1-way ANOVA with Newman–Keuls multiple comparison test. Data are representative of 3 independent experiments.



4745


Lei et al.

A

B

C

No cell transfer

iPS cells/MiDR-TCR

iPS cells/MiDR

OT-I CTLs

No cell transfer

iPS cells/MiDR-TCR

iPS cells/MiDR

OT-I CTLs

No cell transfer

iPS cells/MiDR -TCR 72.5%

iPS cells/MiDR

OT-I CTLs

Vα2

35.8%

a number of HSCs or ESCs from cancer patients is often not feasible. Recent iPS cell technology can generate iPS cells from patients without any surgical approach. Thus, iPS cells have greater potential to be used in ACT-based therapies. Our study significantly facilitates this application. Although TCR-transduced iPS cells need up to 6 to 8 weeks to develop into fully differentiated T cells, there are possibilities to enhance this development. Researchers have evaluated the efficacy of ACT therapy by transferring tumor-specific CD8þ T cells at various stages of differentiation into tumorbearing mice. These studies concluded that administration of naïve and early effector T cells, in combination with a lymphodepleting pretreatment regimen, g c cytokine administration, and vaccination, resulted in the eradication of established tumors (18–20). A conditioning treatment of mice (e.g., sublethal irradiation) prior to iPS cell transfer or cytokine treatment (IL-2 or IL-15) may benefit iPS cell-based therapies. This will be helpful for the translation of the studies for treatment of cancer patients. Despite the observed control of tumor growth, we identified some limitations of ACT with TCR gene-transduced iPS cells. First, at least 6 weeks of in vivo development are essential for T-cell differentiation to occur from the transferred iPS cells. Although there are Ag-specific CD8þ T cells presenting in lymph nodes and spleen 4 weeks after cell transfer, these cells are less than 3.55% of the total CD3þVb5þ population, which is not sufficient to generate efficient antitumor immunity. From weeks 6 to 10 after cell transfer, approximately 24% of the CD3þVb5þ population are in lymph nodes and spleen, and more than 80% of these cells are CD8þ CD4 (Supplementary Fig. S1). Second, we noted hair loss and bone softening in mice receiving TCR– transduced iPS cells. These effects may be caused by the generation of other immune cells from the transferred iPS cells. How such cells may be generated in vivo currently remains unknown. Nevertheless, we did not observe that immunosuppressive cell subsets such as CD4þ CD25þ Foxp3þ cells develop from genetically engineered iPS cells (Supplementary Fig. S3). Disclosure of Potential Conflicts of Interest

Vβ5

No potential conflicts of interest were disclosed.

Acknowledgments Figure 4. iPS cell-derived Ag–specific CTLs infiltrate into tumor tissues. On day 30 to 35 after tumor challenge, tumor tissues were examined for tumor-reactive T-cell infiltration. A, H&E staining. Inflammatory cells infiltrated in tumor tissues (#). B, immunohistologic staining. OVA-specific Va2þ CTLs (red) infiltrated in OVA-expressing tumor tissues (green). C, single-cell suspensions from tumor tissues were analyzed for expression of Va2þ and Vb5þ by flow cytometry, after gating on the CD8þ population. Data are representative of 3 independent experiments.

It has been previously shown that TCR-transduced bone marrow cells controlled the growth of human tumors in severe combined immunodeficiency mice (15). It has also been shown that TCR transduction of HSCs could mediate antitumor immunity (16, 17). However, the approach to obtain

4746

We thank Dr. S. Yamanaka (Kyoto University) for providing iPS-MEF-Ng20D-17 cell line, and Dr. D. Vignali (St. Jude Children's Research Hospital) for supporting the OT1–2ApMig II construct.

Grant Support This project is funded, in part, under grants with the Pennsylvania Department of Health using Tobacco Settlement Funds, the W.W. Smith Charitable Trust, and the Melanoma Research Foundation (J. Song). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received January 31, 2011; revised May 3, 2011; accepted May 19, 2011; published OnlineFirst May 31, 2011.



Cancer Research



References 1.

Brenner MK, Heslop HE. Adoptive T cell therapy of cancer. Curr Opin Immunol 2010;22:251–7. 2. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861–72. 3. Kim JB, Sebastiano V, Wu G, Araúzo-Bravo MJ, Sasse P, Gentile L, et al. Oct4-induced pluripotency in adult neural stem cells. Cell 2009;136:411–9. 4. Soldner F, Hockemeyer D, Beard C, Gao Q, Bell GW, Cook EG, et al. Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogramming factors. Cell 2009;136:964–77. 5. Yu J, Hu K, Smuga-Otto K, Tian S, Stewart R, Slukvin II, et al. Human induced pluripotent stem cells free of vector and transgene sequences. Science 2009;324:797–801. 6. Jia F, Wilson KD, Sun N, Gupta DM, Huang M, Li Z, et al. A nonviral minicircle vector for deriving human iPS cells. Nat Methods 2010;7: 197–9. I, Guenechea G, Vassena R, Navarro S, 7. Raya A, Rodríguez-Piza Barrero MJ, et al. Disease-corrected haematopoietic progenitors from Fanconi anaemia induced pluripotent stem cells. Nature 2009;460: 53–9. 8. Schmitt TM, de Pooter RF, Gronski MA, Cho SK, Ohashi PS, ZunigaPflucker JC. Induction of T cell development and establishment of T cell competence from embryonic stem cells differentiated in vitro. Nat Immunol 2004;5:410–7. 9. La Motte-Mohs RN, Herer E, Zuniga-Pflucker JC. Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro. Blood 2005;105:1431–9. 10. Lei F, Haque R, Weiler L, Vrana KE, Song J. T lineage differentiation from induced pluripotent stem cells. Cell Immunol 2009;260:1–5. 11. Okita K, Ichisaka T, Yamanaka S. Generation of germline-competent induced pluripotent stem cells. Nature 2007;448:313–7.


12. Zhao B, Song A, Haque R, Lei F, Weiler L, Xiong X, et al. Cooperation between molecular targets of costimulation in promoting T cell persistence and tumor regression. J Immunol 2009;182:6744–52. 13. Keller AM, Schildknecht A, Xiao Y, van den Broek M, Borst J. Expression of costimulatory ligand CD70 on steady-state dendritic cells breaks CD8þ T cell tolerance and permits effective immunity. Immunity 2008;29:934–46. 14. Morgan RA, Dudley ME, Wunderlich JR, Hughes MS, Yang JC, Sherry RM, et al. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 2006;314:126–9. 15. Alajez NM, Schmielau J, Alter MD, Cascio M, Finn OJ. Therapeutic potential of a tumor-specific, MHC-unrestricted T-cell receptor expressed on effector cells of the innate and the adaptive immune system through bone marrow transduction and immune reconstitution. Blood 2005;105:4583–9. 16. Yang L, Baltimore D. Long-term in vivo provision of antigen-specific T cell immunity by programming hematopoietic stem cells. Proc Natl Acad Sci U S A 2005;102:4518–23. 17. Zhao Y, Parkhurst MR, Zheng Z, Cohen CJ, Riley JP, Gattinoni L, et al. Extrathymic generation of tumor-specific T cells from genetically engineered human hematopoietic stem cells via Notch signaling. Cancer Res 2007;67:2425–9. 18. Kim HS, Kim-Schulze S, Kim DW, Kaufman HL. Host lymphodepletion enhances the therapeutic activity of an oncolytic vaccinia virus expressing 4–1BB ligand. Cancer Res 2009;69:8516–25. 19. Frankel TL, Burns WR, Peng PD, Yu Z, Chinnasamy D, Wargo JA, et al. Both CD4 and CD8 T cells mediate equally effective in vivo tumor treatment when engineered with a highly avid TCR targeting tyrosinase. J Immunol 2010;184:5988–98. 20. Colombetti S, Levy F, Chapatte L. IL-7 adjuvant treatment enhances long-term tumor-antigen-specific CD8þ T-cell responses after immunization with recombinant lentivector. Blood 2009;113:6629–37.



4747

Ali et al. Proteome Science 2010, 8:34 http://www.proteomesci.com/content/8/1/34

Open Access

RESEARCH

Differences in the BAL proteome after Klebsiella pneumoniae infection in wild type and SP-A-/- mice Research

Mehboob Ali†1,2, Todd M Umstead†1,2, Rizwanul Haque1,2, Anatoly N Mikerov1,2, Willard M Freeman3, Joanna Floros1,2,4 and David S Phelps*1,2

Abstract Background: Surfactant protein-A (SP-A) has been shown to play a variety of roles related to lung host defense function. Mice lacking SP-A are more susceptible to infection than wild type C57BL/6 mice. We studied bronchoalveolar lavage (BAL) protein expression in wild type and SP-A-/- mice infected with Klebsiella pneumoniae by 2D-DIGE. Methods: Mice were infected intratracheally with K. pneumoniae and after 4 and 24 hours they were subject to BAL. Cell-free BAL was analyzed by 2D-DIGE on two-dimensional gels with pH ranges of 4-7 and 7-11. Under baseline conditions and at 4 and 24 hr post-infection BAL was compared between untreated and infected wild type and SP-A-/ - mice. Sixty proteins identified by mass spectrometry were categorized as host defense, redox regulation, and protein metabolism/modification. Results: We found: 1) ~75% of 32 host defense proteins were lower in uninfected SP-A-/- vs wild type, suggesting increased susceptibility to infection or oxidative injury; 2) At 4 hr post-infection > 2/3 of identified proteins were higher in SP-A-/- than wild type mice, almost the exact opposite of untreated mice; 3) At 24 hr post-infection some proteins continued increasing, but many returned to baseline; 4) In infected wild type mice significant changes occurred in 13 of 60 proteins, with 12 of 13 increasing, vs on 4 significant changes in SP-A-/- mice. Infection response patterns between strains demonstrated both commonalities and differences. In several cases changes between 4 and 24 hr followed different patterns between strains. Conclusions: These indicate that SP-A plays a key role in regulating the BAL proteome, functioning indirectly to regulate lung host defense function, possibly via the macrophage. In the absence of SP-A baseline levels of many host defense molecules are lower. However, many of these indirect deficits in SP-A-/- mice are rapidly compensated for during infection, indicating that SP-A also has a direct role on host defense against K. pneumoniae that may be instrumental in determining clinical course. Introduction Pulmonary surfactant is a lipoprotein complex essential for normal lung function. The protein component of pulmonary surfactant consists of hydrophobic and hydrophilic proteins including surfactant protein A (SP-A). SPA has been shown to play a crucial role in innate immune function in the lung. Among the reported functions of SP-A in this regard are: enhancing the clearance of pathogens by acting as an opsonin [1,2], regulating the produc* Correspondence: [email protected] 1

Penn State Center for Host defense, Inflammation, and Lung Disease (CHILD) Research, Hershey, PA 17033, USA † Contributed equally

tion of cell surface antigens and inflammatory mediator expression by immune cells [3,4], participating in the development of dendritic cells [5], regulating reactive oxidant production [6,7], and others [1,8]. Mice lacking SP-A have been shown to have increased susceptibility to a variety of infectious agents [9-11] and were found to have increased mortality after infection with Klebsiella pneumoniae as compared to wild-type mice [12]. The mechanism(s) by which SP-A exerts these effects are not well understood. In some cases the observed function appears to be directly attributable to SP-A via its well-documented ability to enhance phagocytosis of some pathogens [1,2], but because SP-A can regulate expression of

Full list of author information is available at the end of the article © 2010 Ali et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


various regulatory molecules, including some cytokines, it is also likely that at least some of these functions are indirect effects of SP-A. Comparing the bronchoalveolar lavages (BAL) from C57BL/6 wild type (WT) and SP-A-/mice on the same genetic background [13] demonstrated that SP-A had the ability to influence a diverse collection of proteins and also demonstrated an exaggerated response to oxidative stress (following an acute ozone exposure) in SP-A-/- mice, suggesting altered regulation in the absence of SP-A. K. pneumoniae, a gram-negative bacteria and a member of the Enterobacteriaceae family has long been recognized as a possible cause of community-acquired pneumonia in individuals with impaired pulmonary defenses [14]. We [12,15] and others [16,17] have employed a mouse model of K. pneumoniae pneumonia to study the mechanisms responsible for host defense against this pathogen and the implications of infection. These studies have demonstrated increased severity when infection follows an acute oxidative stress, as a consequence of hyperoxia or ozone exposure [12,15,16]. Furthermore, reports of increased susceptibility to K. pneumoniae infection in mice lacking SP-A [12], lysozyme [18], and β 2-microglobulin [19] indicate that the host defense against this pathogen may be multifactorial. In order to explore the impact of K. pneumoniae infection on the BAL proteome in WT and SP-A-/- mice we employed two-dimensional difference gel electrophoresis (2D-DIGE), an unbiased discovery proteomics technique [20-22] for quantitation of proteins, coupled with Matrix Assisted Laser Desorption Ionization-Time-ofFlight/Time-of-Flight (MALDI-ToF/ToF) tandem mass spectrometry for identification of proteins. Using these techniques we can simultaneously analyze large numbers of proteins in the BAL. Two-dimensional gel-based techniques, including 2D-DIGE, have been used to study the BAL proteome in lung disease [23-25] and in various experimental systems [13,26-29]. These techniques may also have the potential to implicate pathways that may not have been previously suspected to play a role in these systems. We recently employed a similar approach to examine age-related changes in the rat BAL proteome [29] and to characterize ozone-induced changes in the mouse BAL proteome [13]. As in our previous studies [13,29] we used the PANTHER database and the published literature to assign many of the proteins identified to three major categories: host defense function (DEF); redox regulation (RED); and protein metabolism and modification (PMM). The rationale for the present study is based on the two following hypotheses: 1) The absence of SP-A compromises host defense against K. pneumoniae increasing susceptibility to infection and the severity of disease. 2) SP-A

Page 2 of 18

influences the levels of expression of other proteins with host defense function, thereby predisposing SP-A-/- mice to infection. To test these hypotheses we investigated differences in BAL protein expression between C57BL/6 WT and SP-A-/- mice before infection and in response to K. pneumoniae infection with a discovery proteomics approach. Simultaneous analyses of dozens of proteins and their isoforms in biological samples can help in the identification of pathways and proteins involved in the host response to K. pneumoniae infection. The type of unbiased approach used in this study does not depend on previously published studies and may be instrumental in generating specific novel hypotheses involving proteins and pathways that may not have been previously implicated in the processes being studied. In this study we compared the BAL proteomes of untreated WT and SP-A-/- mice infected with K. pneumoniae for 4 and 24 hr and studied the resulting changes in the BAL proteome using 2D-DIGE, coupled with MALDI-ToF/ToF for protein identification.

Materials and methods Animals

This study was conducted with pathogen-free male WT and SP-A-/- male mice on the C57BL/6 genetic background. WT mice were obtained from Jackson Laboratories (Bar Harbor, ME) and housed under standard environmental conditions prior to the experiment. Breeder pairs of SP-A-/- mice were obtained from Dr. Samuel Hawgood at the University of California, San Francisco and were bred and raised under specific pathogen-free conditions in a barrier facility at the Penn State College of Medicine. The SP-A-/- mice and sentinel mice housed in the same room showed no evidence of respiratory pathogens. The Institutional Animal Care and Use Committee at the Penn State College of Medicine approved this study. A total of 24, 11-12 week old (20-25 g) C57BL/6 WT and SP-A-/- mice were used in the present study. These were divided into six groups with 4 animals per group: 1) WT control that did not receive any treatment; 2) WT exposed to K. pneumoniae for 4 hr; 3) WT exposed to K. pneumoniae for 24 hr; 4) SP-A-/- control that did not receive any treatment; 5) SP-A-/- exposed to K. pneumoniae for 4 hr; 6) SP-A-/- exposed to K. pneumoniae for 24 hr. Bacteria

K. pneumoniae bacteria (ATCC 43816) were obtained from the American Tissue Culture Collection (Rockville, MD). Bacteria were inoculated into 50 ml of tryptic soy broth (TSB) in 250 ml flasks for 18 hr at 37°C (stationary phase), with shaking at 120 rpm (Incubator Series 25, New Brunswick Scientific Co., Edison, NJ). The bacterial


suspension was diluted in TSB to obtain an OD660 of 0.4 and then 200 μl of this diluted bacterial suspension was added to 50 ml of TSB for 3 hr to reach mid-log phase of growth (OD660 ~0.4, corresponding to ~2 × 108 CFU/ml), where bacteria are most virulent. Bacteria were placed on ice to stop their growth and then serially diluted in PBS to obtain ~9 × 103 CFU/ml. For infection, 50 μl of this suspension (~450 CFU/mouse) were used as in our previous studies [12,15]. Infection of mice with K. pneumoniae

Animals were anesthetized with an intramuscular injection of a mixture of Ketamine HCl (Ketaject, Phoenix Pharmaceuticals Inc., St. Joseph, MO) and Xylazine (XYLA-JECT, Phoenix Pharmaceuticals Inc., St. Joseph, MO). The trachea was surgically exposed and ~450 CFU/ mouse were inoculated intratracheally in 50 μl of PBS. Skin incisions were closed with 7 mm wound clips. Mice infected in this way are not in apparent respiratory distress and mortality during the first 48 hours is rare. As described in our previous studies, the dose administered was an LD50 for WT male mice in survival studies, with most mortality occurring between 3 and 5 days [15]. BAL fluid

The lungs of the anesthetized mice were subjected to BAL at intervals of 4 and 24 hr following infection. BAL fluid was obtained by instilling saline into the lungs through a tracheal cannula using a volume equal to 80% of lung vital capacity (3 × with 0.5 ml of 0.9% NaCl) for a total of 1.5 ml. Total BAL fluid recovery was approximately 90% of the instilled volume and did not differ significantly between the experimental groups and controls. The BAL fluid was centrifuged (150 × g, 10 min, 4°C) and cell-free supernatant was frozen at -80°C for subsequent proteomic studies. BAL protein assessment

Protein concentrations were determined using the BioRad Protein Assay (Bio-Rad, Hercules, CA) before and after protein precipitation. For precipitation one volume of ice cold 100% TCA was added to four volumes of protein sample, which were mixed and incubated overnight at 4°C. Following overnight incubation, samples were centrifuged (15,000 × g, 15 min, 4°C) and the protein pellets washed with 250 μl of chilled acetone (-20°C), centrifuged again, resuspended in a minimum volume of standard cell lysis buffer (30 mM Tris HCl, 2 M thiourea, 7 M urea, 4% CHAPS, 8.5). The concentration of protein was brought to 1 mg/ml for CyDye labeling. One-dimensional gel electrophoresis

Protein (12.5 μg) from each sample was subjected to gel electrophoresis using ExcelGel 12.5% SDS-PAGE separat-

Page 3 of 18

ing gels with a 5% stacking gel. Gels were run at 20 mA for 30 min and then for 1 hour at 50 mA and then silver stained (SilverQuest™ Silver Staining Kit, Invitrogen, Carlsbad, CA). Protein identification from one-dimensional gel electrophoresis

Bands of interest were excised from 1D-gels after silver staining and processed for MALDI-ToF/ToF mass spectrometry (4800 Proteomic Analyzer Applied Biosystems, Foster City, CA) as described below. 2D-DIGE labeling (minimal labeling) and electrophoresis for 2D-DIGE

Information about the 2D-DIGE study is provided in a form that complies with the most recent version. http:// www.psidev.info/miape/MIAPE_GE_1_4.pdf of Minimum Information About a Proteomics Experiment-Gel Electrophoresis (MIAPE-GE) standards currently under development by the Human Proteome Organization Proteomics Standards Initiative (see Additional File 1). Two sets of samples from each group were prepared for minimal labeling with CyDyes. Samples from each group were randomly assigned to Cy3 or Cy5 to ensure no dye-based artifacts in quantitation. A 25 μg aliquot of BAL protein from each sample was labeled with either Cy3 or Cy5 (200 picomoles). A normalization pool was created by combining equal amounts of protein from every sample (24 samples) and an aliquot of the pool was labeled with Cy2 (200 picomoles/25 μg). Equal amounts (25 μg) of Cy3labeled sample, Cy5-labeled sample, and Cy2-labeled pool samples were mixed and applied to each gel. The use of a normalization pool is advantageous as this serves as an internal standardization tool for all gels/samples under study, and thus normalizes any quantitative differences due to gel-to-gel variability. An equal volume of 2 × sample buffer (2 M thiourea, 7 M urea, 2% IPG buffer (pH 4-7 or pH 7-11 nonlinear (NL)) and 1.2% DeStreak reagent) was added to all samples to give a final volume of 150 μl. The 24 cm pH 4-7 and pH 7-11NL gradient Immobiline DryStrips (GE Healthcare) were rehydrated for 16 hr with 450 μl of rehydration buffer (DeStreak™ Rehydration Solution containing 0.5% IPG buffer (pH 4-7 or pH 7-11). Proteins were subjected to isoelectric focusing on rehydrated strips using the Ettan IPGphor 3 cup loading manifold (GE Healthcare) following manufacturer's instruction at 20°C and under mineral oil to prevent evaporation. Proteins were focused by using the following voltages and times: 3 hr at 300 V (step and hold); 7 hr at 1000 V (gradient); 4 hr at 8000 V (gradient); 4 hr at 8000 V (step and hold). After isoelectric focusing the IEF strips were equilibrated in equilibration solution-1 (50 mM Tris HCl, 6 M urea, 30% glycerol, 2% sodium dodecyl sulphate (SDS), 0.5% dithiothreitol) and equilibration solution-2


(50 mM Tris HCl, 6 M urea, 30% glycerol, 2% SDS, 4.5% iodoacetamide) for 15 min, respectively, and then applied to 10-14% gradient polyacrylamide gels (26 cm-w × 20 cm-h × 1 mm thick), sealed with 0.5% low melting point agarose containing bromophenol blue in a buffer of 1 × Tris/glycine/SDS buffer (25 mM Tris, 192 mM glycine, 0.1% (W/V) SDS, pH 8.3) and run for 30 min at 5 W/gel and then for 6-7 hr at 14 W/gel at 20°C using the Ettan DALTtwelve system (GE Healthcare) for separation of proteins on the basis of molecular weight. For preparative (picking) gels an aliquot of 350 μg of sample was diluted with an equal volume of 2 × sample buffer (2 M thiourea, 7 M urea, 2% IPG buffer (pH 4-7 or pH 7-11) and 1.2% DeStreak reagent) and then brought up to a volume of 450 μl with rehydration buffer (DeStreak™ Rehydration Solution and 0.5% IPG buffer (pH 4-7 or pH 7-11)). Proteins were focused using the following voltages and times: 14 hr at 0 V (passive rehydration); 6 hr at 30 V (active rehydration); 3 hr at 300 V (step and hold); 3 hr at 600 V (gradient); 3 hr at 1000 V (gradient); 3 hr at 8000 V (gradient); 4 hr at 8000 V (step and hold). Each of the strips was equilibrated as described above and applied to a 10-14% gradient polyacrylamide gels (26 cm-w × 20 cm-h × 1 mm thick). For the preparative picking gel a single plate for each gel plate sandwich was treated with Bind-Silane solution (80% ethanol, 0.02% glacial acetic acid, 0.001% Bind-Silane) and had reference marker stickers placed on them. After the completion of electrophoresis, the plates that had not been silane-treated were removed from the sandwich and the gels were fixed overnight with 30% ethanol, 7.5% glacial acetic acid. The preparative picking gels were then stained with Deep Purple Total Protein Stain (GE, Healthcare) for 2 hr. Gel scanning, image analysis, and statistics

Information about the acquisition and processing of data from the 2D-DIGE studies are provided in the form that complies with the most recent version of the guidelines established for Minimum Information about a Proteomics Experiment - Gel Informatics (MIAPE-GI) currently under development by the Human Proteome Organization Proteomics Standards Initiative. http://www. psidev.info/files/miape-gi-v1.pdf (see Additional File 2). All two-dimensional gels were imaged on a Typhoon 9400 fluorescent imager (GE Healthcare) at a resolution of 100 μm. Photomultiplier tube voltages were individually set for each of the three colored lasers to ensure maximum, linear signals. The same voltages were used for all the gels. The DIGE gels were imaged at three different wavelengths (Cy2: 520 nm; Cy3: 580 nm; Cy5: 670 nm) and the Deep Purple Total Protein Stain-stained gels were imaged at 100 μm with a separate filter (610 nm).

Page 4 of 18

Gel images were imported into the Progenesis SameSpots v2.0 program (Nonlinear Dynamics) for analysis and their quality assessed by the program. Image quality control with Progenesis SameSpots v2.0 involves checking images for bit depth, color, manipulation prior to analysis, proper file type, saturation, low dynamic range, and stretched contrast. A reference gel with minimum distortion and streaks was selected from the Cy 2 gels. Gel alignment was conducted automatically and then checked manually to ensure correct alignment. Spot detection and spot matching across all the gels were conducted automatically, and then spot matching was checked and manually edited to ensure correct matching. Data from all the spots included in analysis were transported to Progenesis PG240 module of the Progenesis SameSpots v2.0 software for further analysis. Statistical analysis was performed by t-test to confirm the level of significance among various groups. For identified proteins having multiple isoforms, the normalized volumes of all isoforms of a given protein were added together and statistical analysis was performed on the totals using Microsoft Excel. Protein identification by mass spectrometry

For identification of spots, protein spots were picked from picking gels using a robot-directed spot picker (Ettan Spot Picker, GE Healthcare). The spots selected for picking were determined on the basis of differential expression from the 2D-DIGE analyses. The picker head was calibrated using the reference stickers placed on the preparative picking gel and the gels were picked and gel plugs placed in a bar-coded 96 well plate. All gel plugs were washed twice with 200 μl of 200 mM ammonium bicarbonate, 40% acetonitrile for 30 min at 37°C and dehydrated one time with 75% acetonitrile for 20 min followed by air drying. The protein was then digested with 20 μl of 0.02 μg/μl trypsin (Trypsin, proteomics grade, Sigma, St. Louis, MO) overnight at 37°C. Fifty μl 50% acetonitrile, 0.1% trifluoroacetic acid (TFA), was next added to each plug and incubated for 30 min at 37°C. Digested proteins/peptides were then transferred to 96-well extraction plates, dried by speed vac (Vaccufuge™ Concentrator, Eppendorf AG, Hamburg, Germany) and resuspended in 10 μl 0.5% TFA. Extracted proteins/peptides were desalted and concentrated using C18 ZipTips (Millipore Corporation, Billerica, MA). Tips were wetted with 10 μl of 100% acetonitrile and equilibrated with 10 μl 0.1% TFA pH < 4. Samples were then drawn into ZipTip columns by aspirating for 7 cycles and then washed twice with 10 μl 0.1% TFA. Peptides were then eluted from the column with 5 μl of 50% acetonitrile, 0.1% TFA. Peptides were then analyzed by MALDI-ToF/ToF mass spectrometry (4800 Proteomic Analyzer Applied Biosys-


tems, Foster City, CA) in the Mass Spectrometry Core at the Penn State University College of Medicine. A total of 3 μl of ZipTip cleaned samples (1 μl at a time) was applied onto a 384-well MALDI plate (Opti-TOF™ 384 Well Insert, Applied Biosystems) and then 0.7 μl of 2 mg/ml ACH cinnamic acid in 60:40 (acetonitrile: water) was then spotted on each well containing peptide. All 13-calibration wells on the MALDI plate were spotted with (1:12 diluted) 4700 calibrant. Autolytic trypsin peptides were also used to internally calibrate the spectra to an accuracy of 20 ppm. Using the GPS Explorer 3.0.software (Applied Biosystems), the MS and MS/MS data were submitted to the MASCOT search engine using the NCBI non-redundant and SwissProt databases and mouse taxonomy for identification. MASCOT confidence interval scores of > 95% were considered as positive protein identification. The PANTHER database and the scientific literature were used to assign molecular function and biological process to each identified protein. We assigned the identified proteins to several broad functional classes including: a) host defense proteins (DEF); b) proteins involved in regulating redox balance (RED); and c) proteins involved in protein metabolism and modification (PMM). It should be noted that some proteins are in more than one functional group. This classification scheme, which we have used in other studies [13,29] was more inclusive than relying solely on the biological function classification provided by PANTHER and similar gene ontology databases. We also used the Ingenuity Pathway Analysis program (Ingenuity Systems, Redwood City, CA) to gain additional insight into the functional significance of the observed changes.

Results and Discussion We investigated the hypothesis that SP-A plays a role in the host defense of mouse lungs at baseline conditions and following infection with K. pneumoniae. Towards this goal we used one-dimensional gels and 2D-DIGE to compare the BAL proteomes of C57BL/6 mice and SP-A/- mice on the same genetic background under baseline conditions. We then characterized changes in the BAL proteome at 4 and 24 hr after intratracheal infection with K. pneumoniae and compared the responses between the two strains of mice in order to gain insight into molecules and pathways involved in the presence and absence of SPA. 1-D gel analysis of BAL proteins from K. pneumoniaeinfected WT and SP-A-/- mice

Although there were no significant differences among groups in the amount of fluid recovered by BAL, significant (p < 0.05) increases in total protein concentration were observed in infected (4 hr and 24 hr) WT and SP-A/- mice when compared with the corresponding

Page 5 of 18

WT SP-A-/-

* #

*

#

Figure 1 BAL total protein concentration. The total protein concentration of cell-free BAL fluid was determined. The total amount of fluid recovered during BAL (~90% of instilled volume) did not differ significantly among groups. The histogram depicts mean protein concentration values (n = 4/group) and standard deviations are indicated by error bars. Values of WT mice that differ significantly (p < 0.05) from baseline by t-tests are indicated by an asterisk (*) and values of SP-A-/mice that differ from baseline values are indicated with a pound sign (#).

untreated mice (Figure 1). However, there were no significant differences in total BAL protein between WT and SP-A-/- mice under any of the experimental conditions. It should be noted that this increase, based on the results that will be described subsequently, does not appear to be due to increased permeability and an influx of serum proteins into the alveolar space. This is evident from the fact that abundant serum proteins (i.e. albumin, ceruloplasmin, haptoglobin, prothrombin, etc.) are not increasing in proportion to the changes in total protein concentration. One-dimensional gel analysis (data not shown) revealed a band of potential interest at ~14 kDa which appeared with higher intensity in SP-A-/- control mice compared to WT control mice. However, as infection progressed, the intensity of the 14 kDa band decreased in the SP-A-/mice and increased in the WT mice, indicating that this 14 kDa protein may play a role in host defense. MALDIToF/ToF mass spectrometry analysis of the 14 kDa protein band identified it as lysozyme, a protein known to have antibacterial properties [18,30]. 2D-DIGE analysis

To provide the broadest proteomic coverage, two different pH gradients were used in the first dimension gels. One employed a pH 4-7 gradient and the other used a pH 7-11 gradient. We chose the pH 7-11 gradient because the isoelectric point of lysozyme is ~pH 11 and the lysozyme content was seen to change between SP-A-/and WT mice in the presence and absence of infection in the 1-D analysis. This gradient allowed us to resolve some of the very basic proteins, such as lysozyme, that would not typically be resolved in pH 3-10 gels. The pH 4-7 gra-


dient gel was used because many proteins in this pH range are somewhat compressed when a pH 3-10 gradient is used. However, it is possible that there may have been some proteins in very acidic and more basic ranges that were not resolved. A 10-14% polyacrylamide gradient was used for the second dimension separation to allow a better resolution of lower molecular weight proteins, although the resolution of some proteins with higher molecular weights was slightly compromised. The 2D-DIGE analysis involved 715 protein spots of which 279 spots constituting 60 proteins were visualized in all samples and identified by MALDI-ToF/ToF (Table 1). The identified proteins accounted for 93% of the detectable protein on the pH 4-7 gels (Figure 2A) and 39% on the pH 7-11 gels (Figure 2B). Whole BAL supernatant samples (without serum protein depletion) were used for both pH ranges. Depletion of serum proteins results in substantial reductions in the amount of protein available and would have precluded us from performing the two first-dimensional separations with different pH ranges. Below we present and compare changes in the BAL proteome of WT and SP-A-/- mice. We studied: 1) the levels of expression of specific proteins under baseline conditions, 2) levels of expression at each of two time points after infection, and 3) comparisons between the two mouse strains, namely the patterns of changes in expression during the course of infection. 1) Baseline conditions

This is the first time that the BAL proteome of SP-A-/mice has been compared to their WT counterpart under baseline conditions. In this state the differences between the two strains are rather striking, although the responses to infection that will be described subsequently show many similarities. Of the 60 proteins studied (59 when SP-A is excluded), there were decreases in levels of expression of more than 40 proteins, 24 of these decreasing by more than 25%. Increases were seen in 19 proteins, 7 of these increasing by more than 25%. Out of all of these changes, there were significant differences in the levels of expression of 14 proteins, 11 of these significant changes being decreases (Table 2). In order to help elucidate the potential functional significance of these changes we assigned the identified proteins to several broad functional classes based on reviewing the published studies reporting the functions of these proteins (see Table 1). The classes were: a) host defense proteins (DEF); b) proteins involved in regulating redox balance (RED); and c) proteins involved in protein metabolism and modification (PMM). It should be noted that some proteins are in more than one functional group. This classification scheme, which we have used in other studies [13,29] was more inclusive than relying solely on the biological function classification provided by PANTHER and similar gene ontology databases.

Page 6 of 18

Other authors have focused on groups of proteins involved in host defense and oxidative stress in studies of the BAL proteome in response to exogenous glucocorticoid treatment or stress [26,27]. We analyzed the changes in these functional groups to determine whether we could gain insight into the basis for: a) the phenotype of the SP-A-/- mice, specifically their greater susceptibility to infection and increased mortality due to infection [12]; and b) the tendency of SP-A-/- mice (compared to WT mice) to experience an aggravated response to oxidative stress resulting from an acute ozone exposure that we have described previously [13,31]. More than half of the identified proteins (n = 31, excluding SP-A) were designated DEF proteins (Table 1). Roughly 2/3 of these proteins (n = 22) were expressed at lower levels in SP-A-/- mice than in WT animals, and 14 of these proteins showed at least a 25% reduction from WT levels. Of the 7 DEF proteins that differed significantly between strains, 5 of these were at lower levels in the SP-A-/- mice and 2 were at higher levels, as was lysozyme (although its increase did not achieve statistical significance). SP-A was not included in these comparisons because of its absence in the SP-A-/- mice. Proteins in the RED group exhibited a similar pattern. This group consisted of 26 proteins and 16 of them were at decreased levels in the SP-A-/- mice, with 12 of the 16 proteins showing at least a 25% reduction. Six of the 9 RED proteins differing significantly between strains were decreased in SP-A-/- mice. A similar trend was also noted in PMM proteins (n = 13) where 9 of the proteins showed reduced levels of expression in the SP-A-/- mice. Notable among the decreased proteins in the SP-A-/mice were annexins A1 and A5, apolipoprotein A-1, several complement components, several glutathione transferases, and peroxiredoxin 6. These proteins have all been attributed protective roles against infection, inflammation, and reactive oxidants, and their decreased levels in the SP-A-/- mice, together with the absence of SP-A, suggest that these mice could be vulnerable to a wide range of insults. SP-A-/- mice exhibit increased susceptibility to infection, reduced survival, reduced macrophage activation, inability to combat infection, and an exaggerated response to oxidative stress [9,10,12,31-33]. However, there are also some indications of possible compensatory measures to counter the host defense deficits resulting from the lack of SP-A. Lysozyme and β-2-microglobulin, both of which serve in pathogen defense in mice [18,19] were elevated in the SP-A-/- mice under baseline conditions. One could argue, based on the predominance of proteins exhibiting reduced levels of expression in the SP-A-/ - mice, that there was a non-specific reduction in the production and secretion of BAL proteins in this group. However, this possibility is refuted by the fact that the


Page 7 of 18

Table 1: List of identified proteins Gel No.

Protein

Accession No.

Functional Group

IPG

1

14-3-3-Zeta

P63101

DEF, RED, PMM

4-7

2

Adipsin (Complement factor D)

P03953

DEF, PMM

4-7

3

Albumin

P07724

RED

4-7

4

Aldehyde dehydrogenase AHD-M1

P47738

RED

4-7

5

Aldehyde dehydrogenase II

P24549

RED

7-11

6

Aldehyde dehydrogenase, Dimeric NADP-preferring (EC 1.2.1.5) (ALDH class 3)

P47739

RED

4-7

7

Alpha-1-antitrypsin 1-1 precursor (Serine protease inhibitor 1-1)

P07758

DEF, PMM

4-7

8

Alpha-1-antitrypsin 1-6 precursor (Serine protease inhibitor 1-6) (Alpha-1 protease inhibitor)

P81105

DEF, PMM

4-7

9

Alpha-fetoprotein

P02772

10

Annexin A1 (Annexin I) (Lipocortin I) (Calpactin II) (Chromobindin-9) (P35)

P10107

4-7

11

Annexin A3

O35639

12

Annexin A4

Q3UCL0

13

Annexin A5

P48036

DEF

14

Apolipoprotein A-1

Q58EV2

DEF, RED

4-7

15

Beta-2-microglobulin

Q91XJ8

DEF

7-11

16

Beta-actin

P60709

4-7

17

Beta-actin (putative, AA 27-375) (alpha-actin)

Q61275

4-7

18

Carbonyl reductase 2

P08074

RED

7-11

19

Cell specific 10K protein (uteroglobin - mouse) (Clara cell 10K protein) (CC10) (CC16)

Q06318

DEF, RED

7-11

20

Ceruloplasmin isoforms

Q61147

RED

4-7

21

Chain A, The Crystal structure of novel mammalian lectin Ym1suggests a saccharide binding site

O35744

DEF

4-7

22

Chain B, Chimeric human mouse carbonmonoxyhemoglobin (Human zeta, Mouse beta 2)

P02088

23

Chia protein

Q91XA9

24

Coiled-coil domain containing 122

Q8BVN0

25

Complement component 3

Q80XP1

DEF

4-7

26

Complement component C5

P06684

DEF

4-7

PMM

DEF

4-7 4-7 4-7 4-7

7-11 DEF

4-7 4-7

27

Contrapsin (Serine protease inhibitor A3K)

P07759

28

Creatine kinase M-type (EC.2.7.3.2) (Creatine kinase M chain) (M-CK)

P07310

4-7

29

Cytosolic malate dehydrogenase

P14152

RED

4-7

30

(Similar to) Ferritin light chain 1 (Ferritin L, subunit 1)

P29391

DEF, RED

4-7

31

Gamma-actin

P63260

32

Gelsolin precursor (Actin-depolymerizing factor) (ADF) (Brevin)

P13020

DEF, RED, PMM

4-7

33

Glutathione S-transferase, alpha 3

P30115

DEF, RED

7-11

34


P24472

DEF, RED

4-7

35

Glutathione S-transferase, mu 1

P10649

DEF, RED

7-11

36

Glutathione S-transferase, omega 1

O09131

DEF, RED

4-7

4-7

4-7

37

(Similar to) Glutathione S-transferase, Ya chain (GST class-alpha) (Ya1)

P13745

DEF, RED

4-7

38

Haptoglobin

Q60574

DEF, RED

4-7

39

Hemoglobin subunit alpha (Hemoglobin alpha chain)(Alpha-globin)

P01942

40

Isocitrate dehydrogenase [NADP] cytoplasmic (EC 1.1.1.42) (Cytosolic NADP-Isocitr)

O88844

7-11 RED

4-7


Page 8 of 18

Table 1: List of identified proteins (Continued) 41

Keratin complex 1, acidic, gene 10

P02535

7-11

42

(Similar to) Keratin, type I cytoskeletal 10 (Cytokeratin-10) (CK-10) (Keratin-10)

A2A513

4-7

43

Kpnb1 protein b

Q99KM9

44

Lactate dehydrogenase 2, B chain

P16125

45

Lysozyme 2

46

Murinoglobulin-1 precursor (MuG1)

47

Myosin heavy chain IIB

Q9JHR4

48

Peroxiredoxin 1

P35700

49

Peroxiredoxin 6

50

Pregnancy zone protein

51 52

4-7 DEF, RED

4-7

P08905

DEF, RED

7-11

P28665

DEF, PMM

4-7

RED

7-11

Q6GT24

DEF, RED

4-7

Q61838

DEF, PMM

4-7

Prothrombin precursor (Ec 3.4.21.5) (Coagulation factor II)

P19221

DEF, PMM

4-7

Pulmonary surfactant associated protein A precursor (SP-A) (PSP-A) (PSAP)

P35242

DEF, RED

4-7

53

Rho GDP dissociation inhibitor (GDI) alpha

Q99PT1

54

SEC14-like 3

Q5SQ27

PMM

4-7

55

Selenium binding protein 1

P17563

DEF, RED

4-7

56


Q63836

DEF, RED

4-7

57

Serine (or cysteine) proteinase inhibitor, clade A, member 1e

Q00898

PMM

4-7

58

Toll-like receptor 13 precursor

Q6R5N8

DEF

4-7

59

Transferrin

Q921I1

DEF, RED, PMM

4-7

60

Tyrosine-3-monooxygenase/tryptophan 5-monooxynase activation protein, Epsilon polypeptide

Q8BPH1

PMM

4-7

7-11

4-7

Proteins identified by 2D-DIGE. Gel numbers (see Fig. 2), protein names, SwissProt accession numbers, functional groups and pH gradients (IPG) of the gel where the proteins were identified are listed. Abbreviations for functional groups: DEF, host defense; PMM, protein modification and metabolism; RED, redox regulation.

protein content of BAL from both strains does not differ significantly (Figure 1) and there are a number of proteins whose levels of expression are higher in SP-A-/- mice. However, the fact that many DEF and RED proteins are reduced in the SP-A-/- mice under baseline conditions is consistent with prior reports that the alveolar macrophages of SP-A-/- mice are dysfunctional or hypoactive [12]. This finding leads us to speculate that the absence of SP-A results in reduced levels of regulatory molecules produced by these macrophages that may be responsible for these lower levels of expression of DEF and RED proteins. 2) Responses to K. pneumoniae infection

We compared the proteins expressed by WT and SP-A-/mice at each of the two time points following infection (Table 2), as well as the pattern of changes in protein expression between time points in each strain (Tables 3 and 4). a) Strain differences at 4 hr after infection As compared to uninfected animals, we observed a very different picture when we compared strains following infection with K. pneumoniae. Four hr after infection the levels of

more than two-thirds (n = 40) of the identified BAL proteins in SP-A-/- mice were increased as compared to WT mice. The proteins found to be increased in SP-A-/- mice after infection (Table 2) included many of the proteins that had been found to be decreased under baseline conditions in uninfected SP-A-/- mice as compared to WT mice. Our working hypotheses to explain these differences are: a) that expression of these proteins is stimulated by the induction of infection, probably as a consequence of increased levels of regulatory molecules such as cytokines; b) in order to compensate for the lower baseline levels of many proteins in SP-A-/- mice, expression of these proteins is strongly stimulated or overcompensated with infection in SP-A-/- mice; and c) the absence, or deficit, of some (as yet unidentified) regulatory molecules in the SP-A-/- mice (as postulated above) results in a poorly regulated, overexuberant response to infection so that levels of expression after infection often exceed those seen in WT mice. It is also of interest to note that several of the proteins (13 proteins out of 59) that were present in increased amounts in the uninfected SP-A-/- mice respond to infection by reducing their levels


A

Page 9 of 18

B

3

46

46

3

27 58

20

51

32

26

8

27 7

23

42

57 16 31

2 24

13

52

52 52

60 1

57 17

16 21 11 38 12

5

43

55 56

9 56

6

4 44

54

41 18

10

29

28 18

36

25 37

5

40

50

53 14

59

3

35

35

49 34

35

34

30

18

33

48

19 22

15

39

33

47

45

Figure 2 Reference gels. The reference gels for two-dimensional separations in pH 4-7 gels (A) and pH 7-11 gels (B) are shown. Protein spots that have been identified by MALDI-ToF/ToF are circled and numbered and all proteins are named in Table 1. Note that in cases where multiple isoforms are circled, the identity of all isoforms has been confirmed by MALDI-ToF/ToF.

below those seen in the corresponding infected WT mice, resulting in a regulatory pattern that is almost the inverse of that described above for most of the proteins. These proteins decreased in infected SP-A-/- mice include both lysozyme and β2-microglobulin. A number of the proteins mentioned above are included in the categories of positive and negative acute phase proteins and the patterns of expression we describe are consistent with this classification. Together, the observations made and the hypotheses stated earlier indicate that in the absence of SP-A there is a loss of regulatory control to appropriately modulate expression of DEF proteins in response to infection. Consistent with this postulate, a recent study with SP-A-/mice demonstrated that in response to low level intrapharyngeal LPS treatment (0.5 ng), significantly higher levels of MIP-2 were observed compared to the untreated control [34]. However, in this study similarly treated WT mice did not have increases in MIP-2 at low LPS doses, but required a higher LPS concentration to exhibit a similar increase [34]. Interestingly, a recent study in which LPS was administered into a lobe of healthy volunteers' lung found significant decreases in levels of SP-A [28]. Unfortunately, there was little overlap in the sets of identified proteins between our studies and therefore little basis for comparison. When the DEF and RED proteins are individually examined as subgroups of the identified proteins, the changes are similar to those noted for all proteins. In both of these groups of proteins, more proteins show increased levels of expression in infected SP-A-/- mice vs infected WT mice (18 DEF proteins; n = 17 RED proteins), a situa-

tion that is almost the exact opposite of what was seen in untreated mice and consistent with the loss of regulatory control we propose in the SP-A-/- mice. It is not yet known what causes these rapid changes. They may result from the presence of bacteria, the influx of immune cells to combat the bacteria, or the release of mediator(s) from immune cells or epithelium to deal with the insult. We speculate that the rapidity of the response (within 4 hr) is due to the release of stored mediators, such as chemokines, rather than due to the synthesis and secretion of new protein. As stated earlier, because many of the identified proteins were at lower levels in the untreated SP-A-/- mice, the post-infection response may be an effort to restore these proteins to levels that can reduce the threat posed by the instilled bacteria. Two proteins that may play important roles in host defense and have been shown to contribute specifically to host defense against K. pneumoniae, lysozyme and β-2-microglobulin, were of particular interest [18,19]. These proteins exhibited higher levels in the untreated SP-A-/mice, perhaps in an effort to bolster the compromised host defense status of these mice, but following infection their levels in the SP-A-/- mice dropped to below those seen in WT mice. A consistent finding was observed for lysozyme by 1-D gel analysis (data not shown). Whether this reduction in the levels of these proteins was a consequence of their involvement and elimination in the course of defense processes against the instilled bacteria or a reduction in their synthesis remains to be determined. b) Strain differences at 24 hr after infection Extending the analysis to mice infected 24 hr earlier we gained some additional insight into the response pattern. Three gen-


Page 10 of 18

Table 2: Changes in protein expression between wild-type and SP-A-/- mice for control, 4 hr post infection and 24 hr post infection: percent changes with significance for all identified proteins corresponding to reference gels in Fig. 2 Gel No.

Protein

Functional Group

% Δ WT to SP-A-/Baseline

% Δ WT to SP-A-/4 hr

% Δ WT to SP-A-/24 hr

DEF, RED, PMM

-34.97

16.24

-10.69

1

14-3-3-Zeta

2


DEF, PMM

-63.51

5.95

4.76

3

Albumin

RED

4.82

1.56

12.73

4


RED

-82.62

37.46

29.21

5


RED

135.85

14.63

31.75

6


RED

58.04

40.10

38.77

7


DEF, PMM

-30.98

15.12

16.63

8


DEF, PMM

-12.72

-9.38

-12.84

9

Alpha-fetoprotein

-16.1

24.43

-11.61

10


-201.08

72.45

4.89

11

Annexin A3

21.76

-7.73

1.22

12

Annexin A4

13.78

14.08

3.38

13

Annexin A5

14

Apolipoprotein A-1

15


16

Beta-actin

17


18


19

Cell specific 10K protein (uteroglobin mouse) (Clara cell 10K protein) (CC10) (CC16)

20 21

22


23

Chia protein

DEF

DEF

-381.16

-66.73

-130.01

DEF, RED

-23.3

-89.53

93.80

DEF

68.18

-59.79

-55.69

-14.27

32.95

13.93

4.84

52.39

9.19

RED

-184.18

29.93

0.81

DEF, RED

-73.76

12.90

64.31


RED

22.02

-9.13

-19.71

Chain A, Crystal structure of novel mammalian lectin Ym1-suggests a saccharide binding site

DEF

-2.98

28.89

13.35

-5.61

8.67

33.51

5.35

31.40

17.25

24


25


26 27 28


29


30


31

Gamma-actin

32


DEF

-183.85

21.31

-6.43

DEF

-12.5

40.66

8.39


DEF

-22.76

21.75

5.19


PMM

7.77

-8.52

-8.74

-57.22

28.34

-22.83

RED

-3.05

7.03

1.31

DEF, RED

-87.39

-14.84

-3.35

-20.73

31.85

20.75

30.02

-3.09

-2.90

DEF, RED, PMM


Page 11 of 18

Table 2: Changes in protein expression between wild-type and SP-A-/- mice for control, 4 hr post infection and 24 hr post infection: percent changes with significance for all identified proteins corresponding to reference gels in Fig. 2 (Continued) 33


DEF, RED

-193.11

21.05

19.07

34


DEF, RED

-339.42

64.33

38.47

35


DEF, RED

-101.12

45.92

35.09

36


DEF, RED

-132.89

48.91

15.84

37


DEF, RED

-318.76

56.63

44.05

38

Haptoglobin

DEF, RED

-14.69

16.92

2.41

39

Hemoglobin subunit alpha (Hemoglobin alpha chain)(Alpha-globin)

-6.6

-32.60

132.59

40


-21.59

17.31

1.14

41


16.11

20.63

-30.55

42


-43.31

26.68

-5.45

43

Kpnb1 protein b

-55.63

53.13

34.52

RED

44


DEF, RED

28.46

-4.34

-3.26

45

Lysozyme 2

DEF, RED

129.29

-63.56

-133.43

46

Murinoglobulin-1 precursor (MuG1)

DEF, PMM

-14.21

-16.51

-6.93

47


-21.97

6.81

-15.67

48

Peroxiredoxin 1

RED

-83.18

24.93

11.30

49

Peroxiredoxin 6

DEF, RED

-54.85

56.63

42.36

50


DEF, PMM

-1.56

2.46

-7.38

51


DEF, PMM

-59.43

6.39

5.13

52


DEF, RED

ND

ND

ND

53


-115.4

-22.62

-42.11

54

SEC14-like 3

PMM

-33.59

30.46

9.92

55


DEF, RED

9.26

-4.10

-3.32

56


DEF, RED

27.17

-2.40

-3.86

57


PMM

7.7

-18.15

-11.72

58


DEF

18.41

-17.04

-4.57

DEF, RED, PMM

8.65

-17.12

-0.37

PMM

-183.11

18.41

-7.70

59

Transferrin

60


Changes (% Δ) in BAL protein expression from wild-type (WT) to SP-A-/- mice are shown for untreated (baseline) animals, 4 hours postinfection and 24 hours post-infection. Gel numbers (see Fig. 2), protein names, functional groups and percent change (% Δ) are listed. Abbreviations for functional groups: DEF, host defense; PMM, protein modification and metabolism; RED, redox regulation. Bolded numbers indicate changes that were significant (p < 0.05 by t-test). Values for SP-A, which is absent in SP-A-/- mice, are listed as not determined (ND).

eral trends were seen. 1) In one set of proteins (n = 11) there was little change between 4 and 24 hr. 2) In another set (n = 36), at the 24 hr point there were proteins in which the levels of expression tended to revert back (?- or ~-shaped response pattern) toward the levels seen under baseline conditions, suggesting a peak response at 4 hr

(or at least earlier than 24 hr). 3) In a third set (n = 5), levels of some proteins at 24 hr were continuing to either increase or decrease from levels seen at 4 hr, suggesting slower and/or more sustained responses to infection. With respect to all identified proteins, the ratio of increased to decreased proteins (34/25 = 1.36) at 24 hr is


Page 12 of 18

Table 3: List of proteins with similar changes in both strains of mice between 4 hours and 24 hours post infection Gel No.

Protein

Accession No.

% Δ WT

% Δ SP-A-/-

1

14-3-3-Zeta

P63101

35.39

5.23

2


P03953

-3.11

-4.28

4


P47738

-0.68

-7.11

5


P24549

-25.89

-9.53

6


P47739

-4.45

-5.45

7


P07758

11.73

13.19

8


P81105

-1.97

-5.19

9

Alpha-fetoprotein

P02772

58.71

14.27

10


P10107

104.30

24.23

11

Annexin A3

O35639

-11.62

-2.36

15


Q91XJ8

-11.91

-9.04

17


Q61275

98.26

42.05

18


P08074

-14.63

-47.75

19

Cell specific 10K protein (uteroglobin - mouse) (Clara cell 10K protein) (CC10) (CC16)

Q06318

189.97

322.02

20


Q61147

9.88

0.00

21

Chain A, The Crystal structure of novel mammalian lectin Ym1-suggests a saccharide binding site

O35744

29.60

13.98

22


P02088

42.79

75.43

23

Chia protein

Q91XA9

27.11

13.42

24


Q8BVN0

55.69

20.59

27


P07759

8.67

8.44

28


P07310

103.29

28.96

30


P29391

-32.41

-19.16

32


P13020

-11.18

-10.99

33


P30115

33.97

9.01

34


P24472

28.76

8.61

35


P10649

-3.93

-12.25

36


O09131

32.86

3.36

37


P13745

17.64

8.19

39

Hemoglobin subunit alpha (Hemoglobin alpha chain) (Alpha-globin)

P01942

47.17

353.87

41


P02535

125.91

43.46

43

Kpnb1 protein b

Q99KM9

-0.48

-14.37

44


P16125

-9.56

-8.43

46

Murinoglobulin-1 presursor (MuG1)

P28665

-14.22

-4.83

47


Q9JHR4

59.33

28.97

48

Peroxiredoxin 1

P35700

20.27

7.45

51


P19221

8.81

7.52

52


P35242

37.49

ND

53


Q99PT1

48.73

28.33

55


P17563

-1.65

-0.89

56


Q63836

-2.42

-3.88


Page 13 of 18

Table 3: List of proteins with similar changes in both strains of mice between 4 hours and 24 hours post infection (Continued) 57


Q00898

-9.83

-3.86

60


Q8BPH1

33.02

4.31

Changes (% Δ) in BAL protein expression that were similar for wild-type (WT) and SP-A-/- mice between 4 and 24 hours post infection are shown. Gel numbers (see Fig. 2), protein names, SwissProt accession numbers and percent change (% Δ) for both WT and SP-A-/- are listed. Bolded numbers indicate changes that were significant (p < 0.05 by t-test) between 4 and 24 hours for a given group. Values for SP-A, which is absent in SP-A-/- mice are listed as not detectable (ND) in SP-A-/- mice.

lower than at 4 hr (40/19 = 2.1), although the increases continue to predominate. However, most of this change is due to the PMM group, which has reverted at the 24 hr point post-infection to having more than twice as many proteins (9 of 13) at reduced levels in the SP-A-/- mice, as was the case in control (baseline) SP-A-/- mice. The overall numbers of increased and decreased expression levels of DEF and RED proteins at the 24 hour point are quite similar to those seen at 4 hr after infection. However, there were a few notable exceptions. For example, apolipoprotein A-1, which is known to exhibit anti-inflammatory activity [35], was lower in SP-A-/- mice than WT mice both at baseline (-23.3%) and after 4 hr of infection (-89.53%), but by the 24 hour time point its levels were

markedly higher in the SP-A-/- mice (93.8%), indicating a delayed response in the SP-A-/- mice. c) Potential pathways affected by changes We also used the Ingenuity Systems Pathways Analysis program to better understand the functional implications of the absence of SP-A, both under baseline conditions and after infection with K. pneumoniae. These analyses are depicted in Figure 3 and provide a graphic demonstration of the trends we described from our statistical analysis. Roughly half of the identified proteins were included in a network with components of this network having roles in a variety of biological processes that are relevant to our experimental model. These include infection by bacteria, inflammatory response, complement activation, phagocytosis of macrophages, and others. Proteins that were

Table 4: List of proteins with different changes for strains of mice between 4 hours and 24 hours post infection Gel No.

Protein

Accession No.

% Δ WT

% Δ SP-A-/-

3

Albumin

P07724

-3.61

7.12

12

Annexin A4

Q3UCL0

3.05

-7.09

13

Annexin A5

P48036

23.19

-11.99

14

Apolipoprotein A-1

Q58EV2

-166.30

37.97

16

Beta-actin

P60709

11.33

-4.82

25


Q80XP1

5.47

-23.04

26


P06684

12.19

-3.16

29


P14152

2.02

-3.55

31

Gamma-actin

P63260

0.67

-8.47

38

Haptoglobin

Q60574

1.80

-12.16

40


O88844

10.70

-4.77

42


A2A513

24.80

-7.04

45

Lysozyme 2

P08905

4.36

-36.75

49

Peroxiredoxin 6

Q6GT24

4.30

-5.42

50


Q61838

5.37

-4.41

54

SEC14-like 3

Q5SQ27

8.92

-8.97

58


Q6R5N8

-4.87

6.73

59

Transferrin

Q921I1

-12.29

3.92

Changes (% Δ) in BAL protein expression that were different for wild-type (WT) and SP-A-/- mice between 4 and 24 hours post infection are shown. Gel numbers (see Fig. 2), protein names, SwissProt accession numbers and percent change (% Δ) for both WT and SP-A-/- are listed. Bolded numbers indicate changes that were significant (p < 0.05 by t-test) between 4 and 24 hours for a given group.


not linked in the network are shown in the inset. In the diagram reflecting baseline conditions (Fig. 3A) the majority of proteins are colored green, reflecting levels of expression in the SP-A-/- mice below those seen in WT mice, as we described earlier. A very different picture is seen when the same comparison is made at 4 hr after infection (Fig. 4). At this time point most of the proteins are red, representing the fact that expression is higher in SP-A-/- mice than in WT mice and indicating that in the SP-A-/- mice the synthesis and/or secretion of these proteins is rapidly enhanced by infection. 3) Comparison of changes that occur in each strain between 4 and 24 hr after infection

A comparison of the infection-induced response between 4 and 24 hr in WT and SP-A-/- mice, was made by calculating changes in the levels of specific proteins between 4 and 24 hr of infection in each strain, and comparing the WT and SP-A-/- mice. This analysis showed the following. The first difference of note is that changes between 4 and 24 hr in 13 of the 59 identified proteins were statistically significant in the WT mice, 12 of the 13 being significant increases (Tables 3 and 4). By contrast, there were only 4 significant changes between 4 and 24 hr in the SPA-/- mice. However, in general the response patterns were quite similar in both strains with 41 proteins (excluding SP-A) showing either increases or decreases in both strains (Table 3) and 18 more that showed increases in one strain and decreases in the other (Table 4). The similarities and differences between strains in the responses are described below in more detail. a) Similar responses in both strains Following infection of mice with K. pneumoniae there were a number of proteins that underwent similar changes between 4 and 24 hr after infection, typically increases, in both strains of mice (Table 3). The first group of note includes betaactin, myosin IIB (a non-muscle myosin), creatine kinase M, and Rho GDP dissociation inhibitor-alpha. All of these are proteins that play a role in phagocytosis [36] and are increased in both strains. These increases could be related to the presence of increased numbers of phagocytic cells to combat the infection. In all cases the amount of increase was greater in the WT mice and for most of the proteins the changes attained statistical significance only in WT mice. Also notable were the increases in two chitinases, Ym1 and Chia protein (an acidic mammalian chitinase). The increases were statistically significant in WT mice, but did not achieve significance in the SP-A-/- mice. These proteins appear to play a role in asthma, chronic obstructive pulmonary disease, and other inflammatory lung diseases [37-39] although their exact action in these conditions is not known. Annexin A1 had a similar pattern, increasing with infection in both strains, but only reaching significance in the WT mice. The basis for this

Page 14 of 18

increase is unclear but its altered expression here may play a protective role against infection. This postulate is consistent with various reported actions of Annexin A1. These include its protective role after organ injury [40] that could be similar to the case with infection, and its ability to promote apoptosis and limit cell proliferation [41], a potentially important function in the present situation given the rapid influx of immune cells following lung infection. Also increased was the Clara cell protein, CC10 or CC16, which is considered to be a marker of lung injury [42] and may have anti-inflammatory activity. Pronounced increases in its levels of expression were seen in both strains, but were greater in the SP-A-/- mice. These increases appear to be a response to the lung injury resulting from K. pneumoniae infection. We also observed increases in alpha and beta chains of hemoglobin in both strains. Unlike the changes described above, the degree of change for both proteins was greater in the SP-A-/- mice than in WT. It should be pointed out that we did not observe corresponding increases in other serum proteins including albumin, ceruloplasmin, and haptoglobin indicating that these increases in hemoglobin are probably not due to serum protein leakage into the alveolar spaces. Hemoglobin expression has been shown to occur in alveolar epithelial cells [43]. Moreover, it has been shown that cell-free hemoglobin may play a role in the scavenging of NO [44], the levels of which increase in response to various stresses. Thus, the function of this hemoglobin produced in the lung may be one of protection against nitrosative stress as postulated previously [43,44]. This protection may come about via its ability to bind NO and thereby reduce harmful reactive species such as peroxynitrite [43,44]. The above changes describe aspects of the response to infection that were similar in both mouse strains, although in many cases (30 of 42) the magnitude of these changes was greater in the WT mice than in SP-A-/mice. b) Responses that differ between strains In addition to the list of similar responses described above, there were changes occurring between 4 and 24 hr that followed different patterns (i.e. increased in WT; decreased in SP-A-/ - or vice versa Table 4). These included annexin A5, apolipoprotein A-1, and lysozyme. Apolipoprotein A-1 (Apo A-1) is a known negative acute phase protein and during infection in the WT mice its levels decreased by 166%. Among other actions, Apo A-1 neutralizes LPS and has anti-inflammatory activity [35,45]. The decrease in its levels as the duration of infection increases in WT mice (thereby lessening its anti-inflammatory influence), could be interpreted as permitting a vigorous defense against the infecting organism. During the same interval in the SP-A-/- mice, levels of Apo A-1 increase by 38%. Given the actions of Apo A-1, this increase could impede the


response against the K. pneumoniae infection: a) by neutralizing the effects of LPS and thereby the response to it; and b) by limiting the extent of the inflammatory response to infection, thus compromising defenses against the infecting pathogen. The basis for these differences and their significance remain to be determined. We have shown in previously published work [12] that the clinical course of WT and SP-A-/- mice differs significantly in the pneumonia model, with the SP-A-/- mice being more susceptible.

Page 15 of 18

We speculate that SP-A functions indirectly as a regulator of lung host defense function, possibly via the alveolar macrophage, resulting in lower baseline levels of many DEF proteins in SP-A-/- mice. These deficits in the SP-A/- mice appear to be rapidly compensated for with the induction of infection, but without a corresponding improvement in clinical status (i.e. survival). This lack of improvement indicates that the direct effects of SP-A on host defense against K. pneumoniae (i.e. enhancement of phagocytosis [12,15] or bacterial killing) may be more

Baseline WT >> SP-A-/WT > SP-A-/SP-A-/- >> WT SP-A-/- > WT

Figure 3 Network analysis of BAL proteome changes under baseline conditions. Changes in levels of expression between WT and SP-A-/- mice under baseline conditions and at 4 hr after infection (Figure 4) were analyzed using the Ingenuity Pathway program focusing on pathways related to lung disease (shown as Function (Fx) in olive green squares). Proteins undergoing significant changes are indicated in bold. Changing proteins that were not included in the pathway are shown in the inset in the lower right corner. The relationship between symbol color and relative levels of expression is shown in the upper left corner. Unshaded proteins in the pathway were not identified in our gels. The proteins included in the analysis and the Ingenuity abbreviation are listed below (see also Table 1): Cytosolic malate dehydrogenase: MDH1; Ferritin light chain 1: FTL; Gamma-actin: ACTG1; Gelsolin: GSN; Glutathione S-transferase, alpha 3: GSTA3; Glutathione S-transferase, alpha 4: GSTA4; Glutathione S-transferase, mu 1: GSTM5; Glutathione S-transferase, omega 1: GSTO1; Glutathione S-transferase, Ya chain (GST class-alpha): GSTA5; Haptoglobin: HP; Hemoglobin subunit alpha: HBA2; Isocitrate dehydrogenase: IDH1; Keratin complex 1, acidic, gene 10: KRT10; Kpnb1 protein b: KPNB1; Lactate dehydrogenase 2, B chain: LDHB; Lysozyme 2:; LYZ; Murinoglobulin-1 precursor: MUG1; Myosin heavy chain IIB: MYH4; Peroxiredoxin 1: PRDX1; Peroxiredoxin 6: PRDX6; Pregnancy zone protein: PZP; Prothrombin precursor: F2; Pulmonary surfactant associated protein A precursor: SFTPA1; Rho GDP dissociation inhibitor (GDI) alpha: ARHGDIA; SEC14-like 3: SEC14L3; Selenium binding protein 1: SELENBP1; Toll-like receptor 13 precursor: TLR13; Transferrin: TF; Tyrosine-3-monooxygenase/tryptophan 5-monooxygenase activation protein, Epsilon polypeptide: YWHAE


Page 16 of 18

4hr Infection WT >> SP-A-/WT > SP-A-/SP-A-/- >> WT SP-A-/- > WT

Figure 4 Network analysis of BAL proteome changes at 4 hours after infection. Changes in levels of expression between WT and SP-A-/- mice under baseline conditions (Figure 3) and at 4 hr after infection (Figure 4) were analyzed using the Ingenuity Pathway program. A description of the figure and the abbreviations used are the same as those in the legend for Figure 3.

instrumental in determining the clinical course of the infection.

Conclusion In summary, this proteomic comparison of BAL proteins in WT and SP-A-/- mice under normal conditions and after infection with K. pneumoniae provide us with the following information. 1) Proteins involved in the regulation of host defense and redox balance are reduced in the SP-A-/- mice under baseline conditions. Prior evidence that the alveolar macrophages of SP-A-/- mice are dysfunctional or hypoactive [12] lead us to speculate that reduced levels of regulatory molecules produced by these macrophages may be responsible for these lower levels of expression of DEF and RED proteins. 2) Although SP-A-/ - mice have reduced levels of DEF and RED proteins under baseline conditions, when faced with an appropriate stimulus (in this case infection with K. pneumoniae) they respond vigorously by increasing the levels of many

of the molecules that had been at low levels. 3) Despite baseline differences between mouse strains, the pattern (but not necessarily the magnitude) of changes in protein expression in response to infection in many respects is similar in both strains. 4) However, there are a few conspicuous differences in the regulatory patterns of some proteins after infection. These observations demonstrate that SP-A may directly or indirectly alter the regulation of a number of proteins involved in host defense. Based on this study and previously published work [12,15] we propose a model in which SP-A regulates host defense function by both indirect and direct mechanisms. The indirect effects, as documented in this study, comprise a broad-based regulation of levels of expression of a number of BAL proteins important for innate immunity and host defense function. In the K. pneumoniae model employed here these deficits were rapidly reversed by the infectious challenge, perhaps indicating overlap in the regulation of various mediators by SP-A and bacterial


components. However, despite this vigorous response, the SP-A-/- mice have increased mortality and morbidity when compared to WT mice [12,15], suggesting that, at least with respect to K. pneumoniae, direct effects of SPA on host defense function (i.e. enhancement of phagocytosis) are more important than the pleiotropic indirect effects on the BAL proteome.

Additional material Additional file 1 MIAPE: Gel Electrophoresis. File containing Minimum information about a proteomics experiment - Gel Electrophoresis in the format recommended by the Human Proteome Organization Proteomic Standards Initiative. Additional file 2 MIAPE: Gel Informatics. File containing Minimum information about a proteomics experiment - Gel Informatics in the format recommended by the Human Proteome Organization Proteomic Standards Initiative. Competing interests The authors declare that they have no competing interests. Authors' contributions MA infected the animals, collected samples, ran gels, did preliminary analysis, and assisted with the writing of the manuscript. TMU organized and analyzed data, and participated in the writing of the manuscript. RH assisted with animal work and gels and helped with preliminary analysis and assisted with writing. ANM assisted with bacterial cultures, preparation, and infection. WMF did most of the MALDI-ToF/ToF analysis and assisted with evaluation of mass spec data. JF assisted with study design and data interpretation and participated in manuscript preparation. DSP designed the study, interpreted data, and prepared the manuscript. All authors read and approved the final manuscript. Acknowledgements This work was supported in part by grant number 1RO1 ES09882 from the National Institute of Environmental Health Sciences. Author Details 1Penn State Center for Host defense, Inflammation, and Lung Disease (CHILD) Research, Hershey, PA 17033, USA, 2Department of Pediatrics, The Pennsylvania State University College of Medicine, Hershey, PA 17033, USA, 3Department of Pharmacology, The Pennsylvania State University College of Medicine, Hershey, PA 17033, USA and 4Department of Obstetrics and Gynecology, The Pennsylvania State University College of Medicine, Hershey, PA 17033, USA Received: 7 April 2010 Accepted: 17 June 2010 Published: 17 June 2010

Page 17 of 18

8. 9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22. 23.

© This Proteome 2010 is article an AliOpen Science et is al; available Access licensee 2010,from: article 8:34 BioMed http://www.proteomesci.com/content/8/1/34 distributed Central Ltd. under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

References 1. Phelps DS: Surfactant regulation of host defense function in the lung: A question of balance. Pediatr Pathol Mol Med 2001, 20:269-292. 2. Crouch EC: Collectins and pulmonary host defense. Am J Respir Cell Mol Biol 1998, 19:177-201. 3. Kremlev SG, Phelps DS: Effect of SP-A and surfactant lipids on expression of cell surface markers in the THP-1 monocytic cell line. Am J Physiol 1997, 272:L1070-L1077. 4. Kremlev SG, Umstead TM, Phelps DS: Surfactant protein A regulates cytokine production in the monocytic cell line THP-1. Am J Physiol 1997, 272:L996-1004. 5. Brinker KG, Garner H, Wright JR: Surfactant protein A modulates the differentiation of murine bone marrow-derived dendritic cells. Am J Physiol Lung Cell Mol Physiol 2003, 284:L232-L241. 6. Bridges JP, Davis HW, Damodarasamy M, Kuroki Y, Howles G, Hui DY, et al.: Pulmonary surfactant proteins A and D are potent endogenous inhibitors of lipid peroxidation and oxidative cellular injury. J Biol Chem 2000, 275:38848-38855. 7. Crowther JE, Kutala VK, Kuppusamy P, Ferguson JS, Beharka AA, Zweier JL, et al.: Pulmonary surfactant protein a inhibits macrophage reactive

24.

25.

26.

27.

28.

29.

oxygen intermediate production in response to stimuli by reducing NADPH oxidase activity. J Immunol 2004, 172:6866-6874. Sano H, Kuroki Y: The lung collectins, SP-A and SP-D, modulate pulmonary innate immunity. Mol Immunol 2005, 42:279-287. LeVine AM, Kurak KE, Bruno MD, Stark JM, Whitsett JA, Korfhagen TR: Surfactant protein-A-deficient mice are susceptible to Pseudomonas aeruginosa infection. Am J Respir Cell Mol Biol 1998, 19:700-708. LeVine AM, Bruno MD, Huelsman KM, Ross GF, Whitsett JA, Korfhagen TR: Surfactant protein A-deficient mice are susceptible to group B streptococcal infection. J Immunol 1997, 158:4336-4340. Li G, Siddiqui J, Hendry M, Akiyama J, Edmondson J, Brown C, et al.: Surfactant protein-A--deficient mice display an exaggerated early inflammatory response to a beta-resistant strain of influenza A virus. Am J Respir Cell Mol Biol 2002, 26:277-282. Mikerov AN, Haque R, Gan X, Guo X, Phelps DS, Floros J: Ablation of SP-A has a negative impact on the susceptibility of mice to Klebsiella pneumoniae infection after ozone exposure: sex differences. Respir Res 2008, 9:77. Haque R, Umstead TM, Freeman WM, Floros J, Phelps DS: The impact of surfactant protein-A on ozone-induced changes in the mouse bronchoalveolar lavage proteome. Proteome Sci 2009, 7:12. Podschun R, Ullmann U: Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev 1998, 11:589-603. Mikerov AN, Gan X, Umstead TM, Miller L, Chinchilli VM, Phelps DS, et al.: Sex differences in the impact of ozone on survival and alveolar macrophage function of mice after Klebsiella pneumoniae infection. Respir Res 2008, 9:24. Baleeiro CE, Wilcoxen SE, Morris SB, Standiford TJ, Paine R III: Sublethal hyperoxia impairs pulmonary innate immunity. J Immunol 2003, 171:955-963. Laichalk LL, Kunkel SL, Strieter RM, Danforth JM, Bailie MB, Standiford TJ: Tumor necrosis factor mediates lung antibacterial host defense in murine Klebsiella pneumonia. Infect Immun 1996, 64:5211-5218. Markart P, Korfhagen TR, Weaver TE, Akinbi HT: Mouse lysozyme M is important in pulmonary host defense against Klebsiella pneumoniae infection. Am J Respir Crit Care Med 2004, 169:454-458. Cogen AL, Moore TA: Beta2-microglobulin-dependent bacterial clearance and survival during murine Klebsiella pneumoniae bacteremia. Infect Immun 2009, 77:360-366. Alban A, David SO, Bjorkesten L, Andersson C, Sloge E, Lewis S, et al.: A novel experimental design for comparative two-dimensional gel analysis: two-dimensional difference gel electrophoresis incorporating a pooled internal standard. Proteomics 2003, 3:36-44. Freeman WM, Brebner K, Amara SG, Reed MS, Pohl J, Phillips AG: Distinct proteomic profiles of amphetamine self-administration transitional states. Pharmacogenomics Journal 2005, 5:203-214. Freeman WM, Hemby SE: Proteomics for protein expression profiling in neuroscience. Neurochemical Research 2004, 29:1065-1081. Magi B, Bargagli E, Bini L, Rottoli P: Proteome analysis of bronchoalveolar lavage in lung diseases. Proteomics 2006, 6:6354-6369. Rottoli P, Magi B, Cianti R, Bargagli E, Vagaggini C, Nikiforakis N, et al.: Carbonylated proteins in bronchoalveolar lavage of patients with sarcoidosis, pulmonary fibrosis associated with systemic sclerosis and idiopathic pulmonary fibrosis. Proteomics 2005, 5:2612-2618. Chang DW, Hayashi S, Gharib SA, Vaisar T, King ST, Tsuchiya M, et al.: Proteomic and computational analysis of bronchoalveolar proteins during the course of the acute respiratory distress syndrome. Am J Respir Crit Care Med 2008, 178:701-709. Mitchell GB, Clark ME, Caswell JL: Alterations in the bovine bronchoalveolar lavage proteome induced by dexamethasone. Vet Immunol Immunopathol 2007, 118:283-293. Mitchell GB, Clark ME, Siwicky M, Caswell JL: Stress alters the cellular and proteomic compartments of bovine bronchoalveolar lavage fluid. Vet Immunol Immunopathol 2008, 125:111-125. Bowler RP, Reisdorph N, Reisdorph R, Abraham E: Alterations in the human lung proteome with lipopolysaccharide. BMC Pulm Med 2009, 9:20. Umstead TM, Freeman WM, Chinchilli VM, Phelps DS: Age-related changes in the expression and oxidation of bronchoalveolar lavage proteins in the rat. Am J Physiol Lung Cell Mol Physiol 2009, 296:L14-L29.


30. Akinbi HT, Epaud R, Bhatt H, Weaver TE: Bacterial killing is enhanced by expression of lysozyme in the lungs of transgenic mice. J Immunol 2000, 165:5760-5766. 31. Haque R, Umstead TM, Ponnuru P, Guo X, Hawgood S, Phelps DS, et al.: Role of surfactant protein-A (SP-A) in lung injury in response to acute ozone exposure of SP-A deficient mice. Toxicol Appl Pharmacol 2007, 220:72-82. 32. Korfhagen TR, LeVine AM, Whitsett JA: Surfactant protein A (SP-A) gene targeted mice. Biochim Biophys Acta 1998, 1408:296-302. 33. LeVine AM, Hartshorn K, Elliott J, Whitsett J, Korfhagen T: Absence of SP-A modulates innate and adaptive defense responses to pulmonary influenza infection. Am J Physiol Lung Cell Mol Physiol 2002, 282:L563-L572. 34. Haque R, Umstead TM, Ahn MH, Phelps DS, Floros J: Effect of low doses of lipopolysaccharide prior to ozone exposure on bronchoalveolar lavage: Differences between wild type and surfactant protein Adeficient mice. Pneumon 2009, 22:143-155. 35. Hyka N, Dayer JM, Modoux C, Kohno T, Edwards CK III, Roux-Lombard P, et al.: Apolipoprotein A-I inhibits the production of interleukin-1beta and tumor necrosis factor-alpha by blocking contact-mediated activation of monocytes by T lymphocytes. Blood 2001, 97:2381-2389. 36. Groves E, Dart AE, Covarelli V, Caron E: Molecular mechanisms of phagocytic uptake in mammalian cells. Cell Mol Life Sci 2008, 65:1957-1976. 37. Song HM, Jang AS, Ahn MH, Takizawa H, Lee SH, Kwon JH, et al.: Ym1 and Ym2 expression in a mouse model exposed to diesel exhaust particles. Environ Toxicol 2008, 23:110-116. 38. Zhu Z, Zheng T, Homer RJ, Kim YK, Chen NY, Cohn L, et al.: Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 2004, 304:1678-1682. 39. Agapov E, Battaile JT, Tidwell R, Hachem R, Patterson GA, Pierce RA, et al.: Macrophage chitinase 1 stratifies chronic obstructive lung disease. Am J Respir Cell Mol Biol 2009, 41:379-384. 40. Babbin BA, Laukoetter MG, Nava P, Koch S, Lee WY, Capaldo CT, et al.: Annexin A1 regulates intestinal mucosal injury, inflammation, and repair. J Immunol 2008, 181:5035-5044. 41. Wong CM, Cheema AK, Zhang L, Suzuki YJ: Protein carbonylation as a novel mechanism in redox signaling. Circ Res 2008, 102:310-318. 42. Kropski JA, Fremont RD, Calfee CS, Ware LB: Clara cell protein (CC16), a marker of lung epithelial injury, is decreased in plasma and pulmonary edema fluid from patients with acute lung injury. Chest 2009, 135:1440-1447. 43. Newton DA, Rao KM, Dluhy RA, Baatz JE: Hemoglobin is expressed by alveolar epithelial cells. J Biol Chem 2006, 281:5668-5676. 44. Azarov I, He X, Jeffers A, Basu S, Ucer B, Hantgan RR, et al.: Rate of nitric oxide scavenging by hemoglobin bound to haptoglobin. Nitric Oxide 2008, 18:296-302. 45. de Torre C, Ying SX, Munson PJ, Meduri GU, Suffredini AF: Proteomic analysis of inflammatory biomarkers in bronchoalveolar lavage. Proteomics 2006, 6:3949-3957. doi: 10.1186/1477-5956-8-34 Cite this article as: Ali et al., Differences in the BAL proteome after Klebsiella pneumoniae infection in wild type and SP-A-/- mice Proteome Science 2010, 8:34

Page 18 of 18

Haque et al. Arthritis Research & Therapy 2010, 12:R66 http://arthritis-research.com/content/12/2/R66

Open Access

RESEARCH ARTICLE

FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development Research article

Rizwanul Haque1, Fengyang Lei1, Xiaofang Xiong1, Yuzhang Wu2 and Jianxun Song*1,2

Abstract Introduction: Forkhead box p3 (FoxP3)-expressing regulatory T cells (Tregs) have been clearly implicated in the control of autoimmune disease in murine models. In addition, ectopic expression of FoxP3 conveys a Treg phenotype to CD4+ T cells, lending itself to therapeutic use in the prevention of rheumatoid arthritis (RA). In this study, we generated therapeutically active Tregs with an increased life span and hence greater therapeutic potential. Methods: We used retrovirus-mediated transduction to introduce FoxP3 or FoxP3 with anti-apoptotic Bcl-2 family molecule Bcl-xL linked by a 2A picornavirus self-cleaving peptide into CD4+ T cells to generate Tregs. In addition, by using in vitro functional analyses and adoptive immunotherapy in a murine model of RA, we demonstrated that these Tregs were highly reactive. Results: We found that CD4+ T cells expressing both FoxP3 and Bcl-xL were able to differentiate into functional Tregs, which have a long-term survival advantage over cells transduced with FoxP3 alone. In an in vivo murine model, adoptive transfer of Tregs expressing both FoxP3 and Bcl-xL demonstrated more effective suppression of RA than CD4+ T cells expressing FoxP3 alone. Conclusions: FoxP3 and Bcl-xL can cooperatively promote the differentiation and persistence of Tregs, with the capacity to prevent arthritis. Our results provide a novel approach for generating highly reactive Tregs for augmenting cellular immunotherapy for autoimmune disease. Introduction Regulatory T cells (Tregs) are a specialized subpopulation of T cells that act to suppress activation of the immune system and thereby maintain immune system homeostasis and tolerance to self-antigens. Tregs are defined by expression of the forkhead family transcription factor FoxP3 (forkhead box p3), and CD4+CD25+FoxP3+ Tregs are referred to as 'naturally occurring' Tregs [1]. Tregs comprise about 5% to 10% of the mature CD4+ helper T-cell subpopulation in mice and about 1% to 2% of CD4+ T cells in humans. It has been shown that functional Tregs can be generated from naive CD4+ T cells by gene transduction of FoxP3 [2-4]. The presence of transforming growth factorbeta 1 (TGF-β1), interleukin-10 (IL-10), and IL-35 is also * Correspondence: [email protected] 1

Department of Microbiology & Immunology and Penn State Hershey Cancer Institute, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033, USA Full list of author information is available at the end of the article

required for maximal suppressive activity of Tregs [5-7]. However, the mechanisms by which Tregs exert their suppressor/regulatory activity have not been fully characterized and are the subject of intensive research. T-cell receptor (TCR) engagement or co-stimulatory signals (for example, CD28) or both lead to expression of several Bcl-2 family members, including Bcl-xL, Bcl-2, and Bfl-1, which control T-cell survival [8,9]. In addition, these signals modulate expression of FoxP3, which controls differentiation of Tregs [10-13]. Previously, we demonstrated that retrovirus-mediated transduction of target genes of co-stimulation (for example, Bcl-xL, IKKβ [inhibitor of kappaB kinase beta], survivin, and aurora B) could promote T-cell functions [14-17]. Therefore, we hypothesize that gene transduction of naive CD4+ T cells with FoxP3 and Bcl-xL can induce the generation of highly reactive Tregs, which may be used in the treatment of autoimmune disease.

© 2010 Haque et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons

BioMed Central Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


Recent strategies have used the foot-and-mouth disease virus 2A or 2A-like elements to create multicistronic vectors capable of generating multiple proteins from the same transcript. We previously demonstrated that a single 2A peptide-linked retroviral vector can be used successfully to generate reliable and versatile gene therapy vectors that can be used in biomedical research [18]. To understand whether FoxP3 and Bcl-xL can cooperatively regulate differentiation and survival of Tregs, we used retrovirus-mediated transduction to introduce FoxP3 and Bcl-xL linked by a 2A peptide into naive CD4+ T cells. We found that co-expression of FoxP3 and Bcl-xL in CD4+ cells is critical for augmenting the differentiation and persistence of Tregs. Most significantly, the co-introduction of these molecules into CD4+ T cells resulted in their ability to significantly block the development of arthritis in a well-established murine model. Thus, these data indicate that FoxP3 and Bcl-xL can cooperatively promote differentiation and function of Tregs. Furthermore, genetic modification with FoxP3 and Bcl-xL using vectors containing the 2A sequence is able to generate highly reactive Tregs that could be used for augmented cellular immunotherapy for autoimmune disease.

Materials and methods Mice

DAB/1J and C57BL/6J mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). OT-II TCRtransgenic mice, expressing a TCR composed of variable (Vβ5 and Vα2) chains responsive to the I-Ab-restricted ovalbumin (OVA) peptide 323-339 (ISQAVHAAHAEINAGR), were maintained by breeding with C57BL/6J mice. All experiments were in compliance with the regulations of the Pennsylvania State University College of Medicine Animal Care Committee and were in accordance with guidelines of the Association for the Assessment and Accreditation of Laboratory Animal Care. Antibodies

Anti-CD28 (37.51), mouse IL-2, and interferon-gamma (IFN-γ) were from BD Pharmingen (San Diego, CA, USA). Anti-actin (C2, sc-8432) for Western blot was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Anti-Bcl-xL (#2762), peroxidase-conjugated anti-rabbit (#7054), and anti-mouse Ig (#7056) for Western blot were purchased from Cell Signaling Technology (Beverly, MA, USA). All FITC (fluorescein isothiocyanate)-, PE (phycoerythrin)-, Cy5 (cyanine 5)-, and APC (antigen-presenting cell)-conjugated antibodies were purchased from BioLegend (San Diego, CA, USA). T cells

Naive CD4+ T cells from spleen and lymph nodes of OTII mice were enriched by magnetic sorting with the CD4+

Page 2 of 11

T Cell Isolation Kit (#130-090-860; Miltenyi Biotec Inc., Auburn, CA, USA). The cells were more than 90% CD4+, and more than 95% of these cells expressed a naive phenotype and the appropriate TCR as determined by flow cytometry at the Penn State Hershey flow cytometry core facility. T-cell cultures

T cells were cultured in 24-well plates containing 1 mL of RPMI 1640 (Invitrogen Corporation, Carlsbad, CA, USA) with 10% fetal calf serum (HyClone, Logan, UT, USA). Naive CD4+ T cells were stimulated with plate-bounded anti-CD3 (2C11, 4 μg/mL) and soluble anti-CD28 (37.51, 4 μg/mL) antibodies. Retrovirus-mediated transduction

cDNA corresponding to human Bc1xL was subcloned into the murine bicistronic retroviral expression vector Mig [18]. Mig-FoxP3 was a gift from Alexander Y Rudensky (Department of Immunology, University of Washington, Seattle, WA, USA) [19]. Retrovirus-mediated transduction was performed as described previously [16]. Briefly, T cells (1 × 106) were stimulated with platebounded anti-CD3 and soluble anti-CD28 antibodies. After 2 days, the supernatant was replaced with 1 mL of viral supernatant containing 5 μg/mL Polybrene (SigmaAldrich, St. Louis, MO, USA), and the cells were sedimented by centrifugation for 1.5 hours at 32°C and incubated at 32°C for 8 hours. This step was repeated the following day. Viral supernatant was removed and replaced with fresh medium, and T cells were re-cultured. Expression of green fluorescent protein (GFP) in CD4+ T cells, indicative of retrovirus-mediated transduction, was determined by flow cytometry. GFP-expressing T cells were purified by cell sorting using a MoFlo high-performance cell sorter (Beckman Coulter, Fullerton, CA, USA). Collagen-induced arthritis

Male DBA/1J mice (greater than 4 months of age) were injected at the base of the tail with 0.1 mL of emulsion containing 100 μg of bovine type II collagen (CII) (Chondrex, Redmond, WA, USA) in complete Freund's adjuvant (CFA) (Chondrex) using a 1-mL glass tuberculin syringe with a 26-guage needle. Mice were assessed for clinical arthritis in the paws, with each paw individually scored using a 4-point scale: 0, normal paw; 1, minimal swelling or redness; 2, redness and swelling involving the entire forepaw; 3, redness and swelling involving the entire limb; 4, joint deformity or ankylosis or both. Animals achieving a clinical score of 4 were euthanized. Histological evaluation

Mice were sacrificed on day 60 after the challenge of CII. Hind foot paws were amputated, fixed in 10% formalin,


and decalcified in Formical-4 (Decal Chemical Corporation, Tallman, NY, USA). The tissues were embedded in paraffin, sectioned at 4 μm, and stained with hematoxylin and eosin (HE) or Safranin O-fast green as described before [20]. HE staining for bone erosions was scored using a semiquantitative scoring system from 0 to 4 (0 = no erosions, 4 = extended erosions and destruction of bone). Safranin O staining for the loss of proteoglycans was scored with a semiquantitative scoring system (0 to 3), where 0 represents no loss of proteoglycans and 3 indicates complete loss of staining for proteoglycans. Antibody detection

Blood samples were collected from the orbital sinus or by heart puncture on day 60 after primary immunization with CII. Total IgG was measured using the Easy-Titer IgG Assay Kit (Pierce, Rockford, IL, USA) in accordance with the recommendations of the manufacturer. The levels of anti-CII IgG in these sera were measured by enzyme-linked immunosorbent assay (ELISA) as described before [21]. Briefly, a 96-well microplate (Nunc, Roskilde, Denmark) was coated with 5 μg/mL CII at 4°C overnight followed by blocking with 0.2% bovine serum albumin and 0.05% Tween-20 in phosphate-buffered saline (PBS) at 4°C for 6 hours. Test samples were appropriately diluted with PBS containing 2% normal goat serum and added at 200 μL/well. After storage at 4°C overnight, wells were washed three times with PBS. Next, 100 μL of 1:1,000-diluted rabbit anti-mouse IgG1 or IgG2a conjugated with biotin and 100 μL of streptavvidin-peroxidase secondary antibody (Rockland Immunochemicals Inc., Gilbertsville, PA, USA) was added to each well and incubated at 4°C for 2 hours and 1 hour, respectively. After thorough washing, bound peroxidase activity was assayed by incubating samples at room temperature with 100 μL of TMB (3,3',5,5' tetramethylbenzidine) substrate (BioLegend). Absorbance at 405 nm was measured using a microplate reader. Adoptive cell transfer

T cells were cultured with CD3/CD28 and transduced on day 2/3 with retroviral vectors as described previously [16]. Cells were recultured for 3 more days. GFP+ CD4+ T cells were sorted by a MoFlo high-performance cell sorter, and 2.5 × 106 cells were injected intravenously into the tail vein of male DBA/1J mice that had been induced to develop collagen-induced arthritis (CIA) 15 days prior by immunization with CII. Cytokine secretion, cell recovery, and proliferation

Cytokines were measured by ELISA [15]. T-cell survival in vitro was determined by trypan blue exclusion. Cell proliferation was measured by incorporation of 5-bromo2-deoxyuridine (BrdU) (Invitrogen Corporation) over-

Page 3 of 11

night, staining with anti-BrdU, and analysis by flow cytometry. Alternatively, incorporation of [3H] thymidine (1 μCi/well; PerkinElmer Inc., Boston, MA, USA) during the last 12 hours of culture was measured. Immunoblotting

Live CD4+ T cells were lysed in ice-cold RIPA lysis buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerophosphate, 1 mM Na3VO4, and 1 μg/mL leupeptin) for 30 minutes. Insoluble material was removed by centrifugation, and lysates were used for Western blotting. Protein content was determined by a Bio-Rad protein assay kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Equal amounts of protein (40 μg) were loaded onto 4% to 12% NuPage Bis-Tris precasting gels and separated by SDS-PAGE, transferred onto nitrocellulose membrane (Invitrogen Corporation), and immunoblotted. All blots were developed with the ECL (enhanced chemiluminescence) immunodetection system (Amersham Pharmacia Biotech, now part of GE Healthcare, Little Chalfont, Buckinghamshire, UK).

Results Expression of FoxP3 and Bcl-xL using 2A gene sequence in primary CD4+ T cells

Previously, we used the 2A peptide regions from picornavirus TaV (abbreviated herein as T2A) to generate multicistronic cassettes that linked Bcl-xL and survivin to make a single fragment encoding two proteins [18]. To generate reliable and versatile constructs to transduce primary CD4+ T cells that permit expression of FoxP3 and Bcl-xL genes, we used the T2A peptide to generate a retroviral vector with efficient translation of two cistrons (for example, FoxP3 and Bcl-xL) (Figure 1a). The human Bcl-xL gene and T2A were excised from Mig-Bcl-xL-2Asurvivin [18] and subcloned into Mig-FoxP3. Thus, BclxL and FoxP3 were linked with the 2A sequence in the Mig vector. The integrity of the Mig-Bcl-xL-2A-FoxP3 construct was confirmed by DNA sequencing (data not shown), and protein expression was verified by Western blot (Figure 1b). Both Bcl-xL expression and FoxP3 expression were induced by retroviral infection of CD4+ T cells following transduction with retroviral constructs expressing the individual genes or both genes (Figure 1b). By this method, approximately half of the cultured CD4+ T cells were induced to express FoxP3 following retrovirus-mediated transduction as visualized by flow cytometry (Figure 1c). FoxP3 and Bcl-xL promote sustained survival of Tregs in vitro

To determine whether induced co-expression of FoxP3 and Bcl-xL promotes the persistence of Tregs, we trans-


Page 4 of 11

Figure 1 Expression of FoxP3 and Bcl-xL using a 2A gene sequence in primary CD4+ T cells. (a) Schematic representation of the retrovirus construct expressing Bcl-xL and FoxP3. ψ, packaging signal; 2A, picornavirus self-cleaving 2A sequence. (b) Naive CD4+ T cells from C57BL/6J mice were stimulated with anti-CD3 plus anti-CD28 antibodies. On day 2/3, T cells were transduced with retroviral vectors expressing green fluorescent protein (GFP) (Mig), GFP with FoxP3 (Mig-FoxP3), GFP with Bcl-xL (Mig-Bcl-xL), or GFP with Bcl-xL and FoxP3 (Mig-Bcl-xL-2A-FoxP3). On day 8 of primary culture, GFP+ CD4+ T cells were sorted, and protein expression of FoxP3, Bcl-xL, and β-actin was determined by Western blotting. Data are representative of three independent experiments. (c) Intracellular FoxP3 expression on day 6 of primary culture was analyzed by flow cytometry after gating on live CD4+ T cells. Data are representative of three independent experiments.

duced naive CD4+ T cells with the GFP-IRES (GFP-internal ribosome entry site) retroviral vector containing FoxP3 and Bcl-xL (Mig-Bcl-xL-2A-FoxP3) (Figure 2a). After 2 to 3 days of transduction, the recovery of live T cells was monitored by GFP expression. On day 4 posttransduction, we found that the expansion of CD4+ T cells that had been transduced with both FoxP3 and BclxL was greater than the expansion of cells transduced with FoxP3 alone (Figure 2b). Longer-term culture over 8 days showed that co-expression of FoxP3 and Bcl-xL enhanced the ability of CD4+ T cells to survive as compared with that of CD4+ T cells transduced with FoxP3 alone (Figure 2b). This result was not due to differences in FoxP3 expression between cells transduced with both FoxP3 and Bcl-xL versus FoxP3 alone, indicating that exogenous Bcl-xL did not affect FoxP3 expression (Figure 1b). Moreover, expression of CD25, a marker for Tregs, was significantly upregulated by day 4 in the CD4+ GFP+ T cells that were transduced with FoxP3 or with FoxP3 plus Bcl-xL as compared with cells in the vector control group, suggesting that these cells were characteristic of Tregs after gene transfection (Figure 2c). Similar profiles were observed in the expression of cytotoxic T-lymphocyte-associated molecule-4 (CTLA-4) (data not shown). Thus, co-expression of FoxP3 and Bcl-xL induced from a single retroviral vector produced a Treg phenotype in the resulting cells and provided increased long-term survival of these cells.

FoxP3 and Bcl-xL enhance the suppressive activity of Tregs in vitro

To investigate whether co-expression of FoxP3 and BclxL promotes suppressive activity of Tregs, CD4+ T cells expressing FoxP3 and Bcl-xL from primary cultures were sorted based on GFP expression, and equal numbers of cells were re-stimulated with anti-CD3 plus anti-CD28 antibodies. Greater numbers of cells were recovered over time from Tregs derived from expression of both FoxP3 and Bcl-xL as compared with cells transduced with FoxP3 alone (Figure 3a). To evaluate Treg function, Tregs isolated from CD4+ T cells expressing both FoxP3 and BclxL or FoxP3 alone were co-cultured with naive CD4+ T cells (Tregs/T cells = 1:1) in the presence of anti-CD3 and anti-CD28 antibodies for various periods of time. The results show that production of IL-2 and IFN-γ over the 48-hour period was significantly decreased in the presence of Tregs derived from expression of FoxP3 alone or FoxP3 plus Bcl-xL (Figure 3b). However, the proliferation in CD4+ GFP- T cells was significantly suppressed by Tregs co-expressing FoxP3 and Bcl-xL as compared with cells expressing FoxP3 alone on day 4 but not day 2 (Figure 3c, d). These data indicate that the transduction of both FoxP3 and Bcl-xL sustains suppressive activity of CD4+ T cell-derived Tregs by promoting survival advantage.


Page 5 of 11

,

;

D

E

=

F

?

G

>

3

@

A

H

D

I

D

H

B

C

>

D

E

=

F

?

7

!

"

4

5

6

5

3

7

!

"

*

*

3

!

"

+

8

9

7

)

*

2

(

&

0

'

1

-

.

/

#

$

%

Figure 2 Retrovirus-mediated transduction of FoxP3 and Bcl-xL promotes survival of regulatory T cells in vitro. Naive CD4+ T cells from C57BL/ 6J mice were stimulated with anti-CD3 plus anti-CD28 antibodies, transduced on days 2/3 with retroviral vectors expressing green fluorescent protein (GFP), GFP with FoxP3, or GFP with Bcl-xL and FoxP3, and then recultured without any further stimulation. (a) Live CD4+ GFP+ T cells were visualized by flow cytometry on day 6 of culture. Data are representative of three independent experiments. (b) GFP+ T-cell recovery was normalized to take into account differences in initial transduction efficiency between cultures. Numbers of GFP+ cells present on day 2 were assigned a value of 100%, and numbers surviving on days 4, 6, and 8 were used to calculate the percentage recovery relative to day 2. Data represent the mean percentage change ± standard deviation from three separate experiments (*P 4 months of age). Fifteen days prior to adoptive transfer (day 0), CIA was induced in the recipient DBA/1J mice by one intradermal immunization in the base of the tail with 100 μg of CII in CFA, containing 5 mg/mL killed Mycobacterium tuberculosis (H37Ra). Arthritis incidence (Figure 5a) and clinical score (Figure 5b) were assessed in the paws from three independent experiments (Additional files 1 and 2). Mice receiving FoxP3-plus-Bcl-xLtransduced Tregs had a significantly decreased incidence of arthritis compared with mice receiving Tregs transduced with FoxP3 alone (32% versus 70% on day 60; Figure 5a). Most importantly, mice receiving FoxP3-plusBcl-xL-transduced Tregs had a lower clinical score than those receiving Tregs transduced with FoxP3 alone (a score of 1.2 versus 2.8 on day 60; Figure 5b). We also examined whether disease severity correlates with antibody production and histological observations of the joints. We found that mice receiving FoxP3-plusBcl-xL-transduced Tregs had similar levels of total IgG and anti-CII IgG1 in the serum as mice that received Tregs transduced with FoxP3 alone (Figure 6a, b). However, anti-CII IgG2a was significantly decreased following adoptive transfer of FoxP3-plus-Bcl-xL-transduced Tregs (Figure 6c). These results are similar to observations reported in a recent study that describes decreased levels of IgG2a following adoptive transfer of Tregs [23]. Because anti-CII IgG2a was the major component of


Page 6 of 11

0

!

"

#

/

*

*

*

%

* *

*

/

0

%

&

'

(

)

*

+

,

-

. 1

!

"

)

2

3

'

. 1

4

a )

2

3

'

.

@

$

>

+

,

"

>

+

,

?

%

=

;

!

!

0

/

%

"

#

*

< "

#

:

8

9

*

>

5

6

+

,

"

>

+

,

?

7

Figure 3 Retrovirus-mediated transduction of FoxP3 and Bcl-xL enhances suppressive activity of regulatory T cells (Tregs) in vitro. Naive CD4+ T cells from C57BL/6J mice were stimulated with anti-CD3 plus anti-CD28 antibodies (Abs). On day 2/3, T cells were transduced with retroviral vectors expressing green fluorescent protein (GFP), GFP with FoxP3, or GFP with Bcl-xL and FoxP3. On day 6 of primary culture, GFP+ CD4+ Tregs were sorted and re-stimulated with anti-CD3 and anti-CD28 Abs (a) or co-cultured with naive CD4+ T cells from C57BL/6J mice (Tregs/T cells = 1:1) stimulated with anti-CD3 and anti-CD28 Abs for various periods (b, c). (a) Recall survival of Tregs, based on recovery of GFP+ CD4+ T cells over time. Cell numbers present on day 0 were assigned a value of 100%, and cell numbers surviving on day 2 to day 8 were used to calculate the percentage recovery. Data represent the mean percentage change ± standard deviation from three separate experiments. (b) Interleukin-2 (IL-2) production and interferon-gamma (IFN-γ) production were measured by enzyme-linked immunosorbent assay at 48 hours. Data are representative of three independent experiments. Proliferation on day 2 or 4 was analyzed by flow cytometry for 5-bromo-2-deoxyuridine (BrdU) incorporation (c) and thymidine incorporation during the last 12 hours (d). Data are representative of three experiments. *P WT) was of greater magnitude in the KO mice than in the WT mice. It is also interesting to note that

http://www.proteomesci.com/content/7/1/12

in all three of the functional protein groups (DEF, RED, and PMM) described above, the changes in ozoneexposed mice compared to FA-exposed mice were greater in the KO mice than in the WT mice. This trend was particularly pronounced: a) in the DEF group of proteins where 21 (72%) of the 29 changing proteins underwent greater changes in the KO mice than in the WT; and b) in the RED group where 18 (82%) of the 22 changes were greater in the KO mice (Table 4; KO > WT). In many of the proteins showing a change from one group to another a common pattern was observed. This pattern is characterized by: a) levels of expression in KOFA mice being closer to WTO3 mice than to WTFA mice; and b) by responses to ozone in the KOO3 mice that result in increases or decreases (depending on the particular protein) in expression levels of a certain protein exceeding those in the WTO3 mice. Changes in specific proteins Several examples that illustrate the trends described above are shown in Figure 5. The corresponding normalized volumes for most of these proteins are given in Tables 1, 2, and 3. In Figure 5 Panels A and B a reduction in levels of expression of creatine kinase M-type and lactate dehydrogenase 2, respectively, was observed in WTO3 mice. The KOFA mice have levels that are similar to the WTO3 mice but reductions are observed in KOO3compared to KOFA or WTO3. Panels C through F show examples (including respectively, antithrombin III, pregnancy zone protein, apolipoprotein A-1, and alpha-1-antitrypsin 1–6) of ozone-induced increases in WTO3 mice that are mirrored by similar or greater increased levels of expression in KOFA mice. The levels of these proteins in KOO3 mice are further increased to a varying degree compared to WTO3 or KOFA. Apolipoprotein A-1 has a role in defense and immunity by its ability to bind and neutralize LPS and in redox regulation by its role in neutralizing lipid hydroperoxides and decreasing neutrophil degranulation and superoxide production. Pregnancy zone protein is an antiprotease, but has also been shown to have anti-inflammatory activity [96]. Antithrombin III and alpha-1antitrypsin 1–6 have antiprotease activity and have been shown to have anti-inflammatory activities [62,64].

In these examples and a number of others (not shown), a consistent trend for the levels of a particular protein is observed. A progressive increase (or in some cases decrease) is observed as one progresses from WTFA to WTO3 to KOFA to KOO3. Indeed, in roughly two-thirds of the proteins listed in Tables 1, 2, and 3 KOFA values differed from WTFA values in the same manner (increasing or decreasing) as WTO3 differed from WTFA. However, there were only 6 cases (not including SP-A) where these differences between WTFA and KOFA achieved statistical

Page 12 of 22 (page number not for citation purposes)


↓

Aldehyde dehydrogenase (EC 1.2.1.5) Aldose reductase (EC 1.1.1.21) Apolipoprotein A-I

↓

Apolipooprolein A-IV

↑


↓

Ceruloplasmin isoform

↑


↓

Ferritin light chain

↓

Gelsolin

↑

Glutathione S-transferase A4 (GST A4-4)

↓

Glutathione S-transferase omega 1

↓

Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12) Heat shock protein 70

↓

Hemopexin

↑

Isocitrate dehydrogenase cytoplasmic (EC 1.1.1.42) Lactate dehydrogenase 2, B chain Peroxiredoxin 6 (Antioxidant protein 2; AOP2) Protein disulfide-isomerase A3 (EC 5.3.4.1) Retinal dehydrogenase (RALDH1)(EC 1.2.1.36) Selenium binding protein 1

↑


↓ ↑

↑

↓ ↓ ↓ ↓ ↓ ↓

1.24 (0.163) 2.75 (0.471) 1.84 (0.193) 1.59 (0.300) 2.50 (0.221) 4.47 (0.537) 7.51 (0.766) 1.18 (0.126) 1.43 (0.325) 7.07 (1.072) 1.41 (0.153) 3.52 (0.140) 2.54 (0.750) 3.93 (0.807) 9.19 (1.184) 2.14 (0.119) 1.26 (0.417) 5.60 (0.884) 5.62 (1.658) 7.88 (1.629) 1.42 (0.177) 5.61 (0.794)

0.93 (0.286) 1.83 (0.570) 1.60 (0.294) 2.18 (0.350) 3.01 (0.306) 2.66 (1.329) 9.48 (1.487) 0.80 (0.234) 1.21 (0.180) 11.69 (3.636) 0.80 (0.445) 2.78 (0.416) 1.94 (1.125) 5.82 (1.173) 10.85 (1.000) 2.12 (0.152) 1.03 (0.520) 3.35 (1.694) 4.87 (1.685) 5.55 (1.817) 0.83 (0.402) 3.53 (1.407)

WTFA vs WTO3 p ≤ 0.05

*

* * * .056 *

.051 * *

* .076

* .057

* *

Normalized Volumes Mean (SD) KOFA KOO3 1.23 (0.163) 2.57 (0.365) 1.88 (0.362) 2.24 (0.668) 2.69 (0.122) 4.67 (0.543) 7.53 (0.960) 1.09 (0.141) 1.34 (0.382) 6.87 (0.347) 1.32 (0.148) 2.94 (0.422) 1.99 (0.379) 4.64 (0.556) 11.49 (0.759) 1.64 (0.241) 1.05 (0.179) 5.39 (0.486) 4.67 (0.956) 7.85 (1.118) 1.39 (0.212) 5.33 (0.742)

0.86 (0.140) 1.68 (0.362) 1.53 (0.348) 4.41 (1.038) 3.27 (0.611) 2.36 (0.453) 9.39 (1.337) 0.80 (0.124) 1.13 (0.380) 11.89 (1.682) 0.65 (0.146) 2.77 (0.986) 1.48 (0.241) 7.79 (1.026) 13.71 (0.905) 1.97 (0.662) 0.84 (0.062) 3.11 (0.667) 4.64 (0.211) 5.07 (1.220) 0.68 (0.105) 3.00 (0.472)

KOFA vs KOO3 p ≤ 0.05

WTFA vs KOFA p ≤ 0.05

WTO3 vs KOO3 p ≤ 0.05

* *

*

*

* .065 *

* * * .067 * *

* *

*

* .072 *

* * *

The proteins assigned to the redox balance category (RED) are listed (n = 22). An arrow indicates whether levels of expression are increased (↑) or decreased (↓) in response to ozone. The mean values for the normalized volumes and standard deviations for each named protein are given for WTFA, WTO3, KOFA, and KOO3. The asterisk indicates whether the p-value for the comparisons of WTFA vs. WTO3; KOFA vs. KOO3; WTFA vs. KOFA; and WTO3 vs. KOO3 was ≤ 0.05. Values that were slightly above 0.05 are also given.

Page 13 of 22

Normalized Volumes Mean (SD) WTFA WTO3

(page number not for citation purposes)

http://www.proteomesci.com/content/7/1/12 Proteome Science 2009, 7:12

Table 2: Proteins involved in redox balance

14-3-3 zeta Adipsin (complement factor D) Alpha-1-antitrypsin 1-1 precursor Alpha-1-antitrypsin 1-6 precursor Antithrombin-III

↓ ↑ ↑ ↓ ↑ ↑

Contrapsin

↑

Haptoglobin

↓

Heat shock protein 1, alpha Heat shock protein 70

↑

Kininogen1

↑

Murinoglobulin-1 precursor (MuG1) Plasminogen

↑


↑

Protein disulfideisomerase A3 precursor Prothrombin precursor (EC 3.4.21.5) Serine (or cysteine) proteinase inhibitor, clade A, member 1e Transitional endoplasmic reticulum ATPase Tyr 3-monooxygenase/ trp 5-monooxygenase activation protein

↓

↑

↓

↑ ↑ ↑ ↑

3.75 (0.425) 2.05 (0.337) 1.18 (0.191) 2.15 (0.230) 3.08 (0.589) 8.72 (0.626) 12.71 (2.040) 0.75 (0.092) 3.93 (0.807) 5.36 (1.723) 0.77 (0.166) 8.39 (1.194) 0.76 (0.166) 5.62 (1.658) 1.42 (0.171) 5.34 (0.842)

3.56 (0.285) 2.43 (0.610) 1.04 (0.102) 2.94 (0.353) 4.54 (0.659) 13.00 (3.512) 11.21 (0.835) 0.95 (0.114) 5.82 (1.173) 6.99 (0.703) 1.07 (0.136) 7.35 (0.653) 0.83 (0.059) 4.87 (1.685) 2.01 (0.423) 7.41 (0.723)

1.62 (0.230) 0.87 (0.059)

2.94 (1.149) 1.04 (0.092)

WTFA vs WTO3 p ≤ 0.05

* * .053

* *

*

* *

.066 *

Normalized Volumes Mean (SD) KOFA KOO3 4.21 (0.329) 2.13 (0.472) 1.35 (0.369) 2.85 (0.484) 3.53 (0.342) 10.28 (1.886) 11.47 (0.326) 0.70 (0.164) 4.64 (0.556) 5.89 (0.514) 0.88 (0.073) 8.82 (0.775) 0.94 (0.343) 4.67 (0.956) 1.56 (0.167) 6.10 (0.636)

4.39 (0.552) 2.34 (0.655) 0.94 (0.210) 3.47 (0.712) 4.78 (0.454) 13.47 (2.994) 7.61 (0.764) 0.95 (0.076) 7.79 (1.026) 7.65 (0.456) 1.26 (0.131) 7.70 (2.054) 1.05 (0.080) 4.64 (0.211) 2.15 (0.301) 8.34 (0.800)

1.92 (0.469) 0.93 (0.133)

3.91 (0.527) 1.24 (0.135)

KOFA vs KOO3 p ≤ 0.05

WTFA vs KOFA p ≤ 0.05

WTO3 vs KOO3 p ≤ 0.05

*

* *

*

*

* *

*

* *

.08

*

* *

* *

.054

The proteins assigned to the protein modification and metabolism and chaperone category (PMM) are listed (n = 18). An arrow indicates whether levels of expression are increased (↑) or decreased (↓) in response to ozone. The mean values for the normalized volumes for each named protein are given for WTFA, WTO3, KOFA, and KOO3. The asterisk indicates whether the pvalue for the comparisons of WTFA vs. WTO3; KOFA vs. KOO3; WTFA vs. KOFA; and WTO3 vs. KOO3 was ≤ 0.05. Values that were slightly above 0.05 are also given.

Page 14 of 22

Normalized Volumes Mean (SD) WTFA WTO3

(page number not for citation purposes)

http://www.proteomesci.com/content/7/1/12 Proteome Science 2009, 7:12

Table 3: Proteins involved in protein modification and metabolism

Proteome Science 2009, 7:12


Table 4: Summary of responses

Total Overall DEF (excluding SP-A) RED PMM

O3↑

O3↓

WT*

KO*

KO > WT

WT > KO

13 7 14

16 15 5

25 15 11 8

37 18 13 10

45 (70%) 21 (72%) 18 (82%) 10 (56%)

19 (30%) 8 (28%) 4 (18%) 8 (44%)

64 29 22 18#

An overview of the changes in expression in response to ozone is given. The number of proteins in the entire data set and in each of the three functional groups is given. The number of responses to ozone that involved an increase in levels of expression (O3↑) or a decrease (O3↓) is indicated. Note (#) that after ozone exposure one protein in the PMM group is decreased in WT mice and increased in KO. The number of significant changes in comparisons of WTFA vs. WTO3 (WT*) or KOFA vs. KOO3 (KO*) is indicated. For each group, the number of ozone responses where the magnitude is greater in KO mice is given (KO > WT), as are those where WT is greater (WT > KO).

Normalized Volume

WT FA

B

WT O3

KO FA

KO O3


WT FA

C

D

Creatine kinase M-type (EC 2.7.3.2) (M-CK)

WT O3

KO FA

KO O3

Antithrombin-III precursor (ATIII)

WT FA

WT O3

KO FA

KO O3


WT FA

Normalized Volume

A

E

KO FA

KO O3

Apolipoprotein A-1

WT FA

F

WT O3

WT O3

KO FA

KO O3


WT FA

WT O3

KO FA

KO O3

Figure 5 Representative graphs of specific protein changes Representative graphs of specific protein changes. Histograms depicting levels of specific expressed proteins from WT (WTFA, WTO3) and KO (KOFA, KOO3) mice after exposure to FA or ozone (O3) are shown +/- standard deviation. The graphs depict data from: A) creatine kinase M-type; B) lactate dehyrogenase 2; C) antithrombin III; D) pregnancy zone protein; E) apolipoprotein A-I; and F) alpha-1-antitrypsin 1–6. Comparisons between groups that were statistically significant (p < 0.05) are indicated with a bracket.



significance. A similar situation was observed when we compared WTO3 to KOO3 values where values for a given protein followed this progression, but differences were only significant in a few cases. The similarity of expression patterns between WTO3 mice and KOFA mice supports the possibility that an increase in oxidative stress in KOFA mice exists, perhaps due to the absence of SP-A, an innate immune protein known to have antioxidant activity.

Discussion Ozone and other air pollutants are known to cause lung inflammation, to exacerbate other lung diseases such as asthma, and to increase susceptibility to infections. The mechanism(s) behind these effects are not well understood but may involve proteins in the epithelial lining fluid of the lung that have a role in innate immune mechanisms. One of these proteins, SP-A, is involved in many aspects of innate immunity. A number of studies have described disruptions in SP-A function following exposure to ozone or other oxidants and others have presented evidence indicating that SP-A may have antioxidant function. In several previous studies we have compared the responses of WT and KO mice to ozone exposure and their relative susceptibility to infection after ozone exposure [8,9,16]. We found that KO mice sustained greater tissue damage after ozone exposure and were more susceptible to infection. These results indicated that SP-A may play a role in protecting the lung from oxidant-induced injury and from infection. However, the basis for these differences was unclear. In this study we sought to build upon and extend the existing information. In order to gain insight into the responsible mechanisms we employed a discovery proteomics approach to characterize changes in the expression of proteins in mouse BAL following ozone exposure and assess the contribution of SP-A to this response by comparing the BAL proteomes of SP-A KO mice and WT mice for the first time and comparing the responses of these two mouse strains to ozone exposure. Using the PANTHER ontology database and the published literature, the proteins identified via MALDI-ToF/ToF MS were assigned to three major functional groups. This broad categorization may provide a more informative overview than the dozens of different biological processes and molecular functions assigned by PANTHER alone. Subsequent analysis compared significant changes among the experimental groups (WTFA, WTO3, KOFA, KOO3) and enabled us to postulate an important role for SP-A in response to ozone-induced oxidative stress. This putative role (i.e. its involvement in redox regulation, in addition to its well-described role in innate immunity) builds on several reports that have described an antioxidant function for SP-A [101-103]. When we compared the responses of WT and SP-A KO mice to oxidative stress (in the form of an acute ozone


exposure), we identified a number of changes in protein expression. These were consistent with oxidative stress and were associated with known complications of ozone exposure, including increased susceptibility to infection in humans [1,18,19] and animals [1,9,16]. In addition, we observed that the responses to ozone, in terms of percent change, were often more pronounced in KOO3 compared to WTO3 mice, indicating that KO mice may be more susceptible to ozone-induced oxidative stress. This observation is consistent with our earlier study in which we reported increased BAL levels of LDH in KO mice, indicating that KO mice sustained more ozone-induced tissue damage than WT mice [8]. Moreover, in a number of cases we found that control KOFA mice expressed many proteins at levels equivalent to, or even exceeding, WTO3, indicating that KO mice may be subject to oxidative stress, even in the absence of the exogenous ozone-induced oxidative stress. We speculate that this increase occurs because of the lack of SP-A, an important host defense protein that plays an antioxidant or oxidant scavenger role in the alveolus. This is based on several converging lines of evidence including: 1) the attribution of an antioxidant role to SP-A [101-103]; 2) the demonstration that SP-A is highly susceptible to oxidative modification by carbonylation)[53] and to ozone-induced oxidation of methionine residues [34], and that its function is disrupted by these oxidative modifications)[9,31-34]; and 3) the description of other systems in which proteins serve as "sacrificial antioxidants" [104-109]. In past studies we and other investigators have targeted specific proteins in the characterization of the ozone response. The selection of target proteins was based on previously published studies and tended to provide incremental advances in our understanding of the involved mechanisms. A case in point is the analysis of cytokines and chemokines that may be involved in ozone-induced inflammation [8,40-44]. Studies of this type have only examined a handful of the dozens of cytokines that may potentially play a role in this process. Furthermore, the functional redundancy of some of these molecules can complicate interpretation. The two-dimensional electrophoretic analysis of rodent BAL proteins after ozone exposure has been very limited. One preliminary study has used conventional 2-D gel approaches to examine differences in BAL protein expression between an ozone-sensitive strain of mice and an ozone-resistant strain [46], although these authors did not examine ozone-induced changes. Interestingly, one of the proteins they found to differ between strains, was peroxiredoxin 6 (identified in their study as antioxidant protein 2) which we found to be significantly reduced after ozone exposure in both strains that we studied. The other protein that differed between strains in their study, Clara cell protein 10, was too small to be resolved in the second Page 16 of 22 (page number not for citation purposes)


dimensional gel system we used. Another study with rats examined the effect of prior ozone exposure on 1-nitronaphthalene adduction of BAL proteins [45] and found peroxiredoxin 6 to be increasingly adducted following ozone exposure. By applying a two-dimensional gel-based discovery proteomics approach to the study of ozone exposure we hoped to obtain additional information about the role of molecules such as peroxiredoxin 6 in this process and to identify previously overlooked molecules that may also play important roles, thereby gaining insight into the interplay of different processes affected by ozone exposure and the resulting pathophysiology. Moreover, the ability (via the use of a normalization pool) in 2D-DIGE to internally standardize the protein spots of all BAL samples in all gels under study provides a major advance that previous BAL studies largely lacked. Proteome of WT mice In our previous study examining the effects of ozone exposure on mice [8] we reported that SP-A, a protein that is highly susceptible to oxidation, was oxidized immediately after ozone exposure, whereas increases in total protein oxidation were not detectable until 4 hours later. This delayed oxidation coincides with an influx of neutrophils into the alveolar space that may be a consequence of their activation by ozone-induced tissue damage and the subsequent production of RONS by these cells. In the present study, most of the significant changes in levels of expression of the RED protein group involved in redox balance were decreases, a finding that would be consistent with increased degradation of proteins that had been oxidatively modified while neutralizing reactive oxidants [110]. On the other hand, in the PMM group of proteins with roles in protein metabolism and modification and the chaperones, half of these proteins changed significantly with most undergoing increases after ozone exposure. One could speculate that this is a response to the increased oxidative modification of proteins and the apparent increased turnover of the proteins involved in regulating redox balance. Thus, the data from this discovery proteomics study, together with previously published data [8], support the postulate that in response to ozoneinduced oxidative stress there is an increase in total protein oxidation and this reflects decreases in proteins involved in redox balance and increases in proteins involved in protein modification and metabolism.

Approximately half of the DEF group of defense and immunity proteins underwent significant changes, with changes that included roughly equal numbers of increases and decreases. This "mixed" response may explain why ozone exposure has been reported to prime pulmonary innate immunity, and thereby enhance the response to LPS [111], while impairing clearance of pathogens that are dependent upon removal by cell-mediated immune mechanisms, including Listeria monocytogenes or Klebsiella


pneumoniae [9,112]. There is precedent for selective changes in susceptibility. Published studies have shown that genetic ablation of SP-A increases the susceptibility of the SP-A KO mouse to organisms whose recognition and clearance are highly dependent on SP-A, such as group B streptococcus and Pseudomonas aeruginosa [35,36]. On the other hand, increased levels of SP-A can predispose the host to organisms, such as Pneumocystis carinii [113,114], that are typically cleared by other mechanisms. Taken together, these responses document ozone-induced changes in several dozen BAL proteins, many of which had not been previously examined in this context. Comparison of WT and KO mice Although an analysis of the ozone response revealed an overall similar response between WTO3 and KOO3, some differences were also observed. One striking difference between the WT and SP-A KO mice was in the DEF and RED protein groups, where roughly three-fourths of the responses were greater in the KO mice. In most cases the significant ozone-induced changes in the KOO3 mice were similar to trends observed in the WTO3 mice, but the magnitude of the change was greater in the KOO3 mice than in WTO3. This is also exemplified by the PCA analysis in which the first principal component, which separated groups by ozone exposure, accounted for a greater degree of study variance (42.54%) than the second component (12.76% of study variance) which segregated KO mice from WT. This indicates both an increased sensitivity to the oxidative stress caused by ozone exposure in both WT and KO, and a more vigorous and perhaps less well-regulated response to the ozone exposure in KO mice.

Comparison of the values of KOFA mice with the WTFA and WTO3 values revealed another very interesting point. In many cases the baseline (FA-exposed) value of the KOFA mice differed from the WTFA values in a similar fashion as the WTO3 mice differed from the WTFA group. For example, lactate dehydrogenase and sec14-like 3 levels were reduced after ozone exposure and the corresponding levels in the KOFA group were similar to the WTO3 group. Following ozone exposure, the levels in the KOO3 mice were further reduced. Similarly, there were a number of cases where increases in WTO3 mice were mirrored by similar increases in the KOFA mice that were subsequently further increased by ozone as assessed by the values observed in KOO3 mice. These include apolipoprotein A-I, kininogen 1, and pregnancy zone protein, among others. The similarity between the levels of many proteins in the KOFA mice to those seen in WTO3 mice (in other words, baseline levels in the KO mice corresponded to levels induced by oxidative stress in the WT mice) led us to propose the following scenario. Many of the changes in WTO3 mice are likely due to oxidative stress resulting from acute ozone exposure. We Page 17 of 22 (page number not for citation purposes)


have demonstrated that SP-A is highly susceptible to oxidative modification and that its modification significantly compromises its function))[31-33,53,115-117]. In WT mice SP-A is an abundant BAL protein and several lines of evidence have linked it to redox regulation and led investigators to propose an antioxidant function for SP-A. In these papers it has been demonstrated that SP-A inhibits lipid peroxidation [101,102,116] and that it can restore function to oxidized surfactant [103]. We postulate that the reason that many proteins in the KOFA mice have levels similar to WTO3 mice is because the KOFA mice are under chronic oxidative stress due to the lack of SP-A. In our previous study of ozone exposure and SP-A KO mice we did not detect differences in glutathione levels between WT and KO mice, but we did not measure levels of the many other enzymatic and non-enzymatic antioxidants in BAL [118], nor did we investigate the possible role of compartmentalization of these antioxidants. In addition, although carbonylated protein levels were higher in WTO3 mice than in KOO3, we did not assess levels of other oxidized molecular species, such as lipid peroxidation products, whose formation is known to be inhibited by SP-A [101,102,119]. If indeed, SP-A plays an antioxidant role in WT mice by scavenging reactive species under both normal and perturbed conditions as has been previously suggested [120], its absence in the KO mice may result in increased oxidative stress, even under normal conditions. The findings in the present study support this postulate. Moreover, the lack of SP-A may contribute to an added oxidative stress following O3 exposure via the reduction in PMN recruitment as shown in this and in a previous study [8]. Thus, based on both similarities and differences in protein levels among the groups under study, it is likely that different and overlapping mechanisms are operative.

Conclusion Using discovery proteomics and a mouse genetic model of a deficiency of an innate host defense molecule (SP-A) we have examined, for the first time using the 2D-DIGE approach, global changes in the BAL proteome of WT and KO mouse strains that occur in response to ozone exposure, an acute oxidative stress. By characterizing these protein expression changes with the broader, unbiased perspective of a "discovery" approach we were able to gain insight into a more complete understanding of pathophysiologic changes caused by ozone exposure. For example, the widespread decreases in RED proteins involved in redox balance suggest enhanced turnover of these proteins as a consequence of the oxidative stress resulting from ozone exposure, and the increases in PMM proteins involved in protein metabolism and modification are likely related to this increased turnover. The many changes (both increases and decreases) in proteins in the DEF group provide a possible basis for the increased sus-


ceptibility of some individuals to infection following an oxidative stress. Furthermore, the differences described in the response patterns of WT mice and SP-A KO mice provide support for a role of SP-A in innate immunity and redox balance under normal conditions (in the absence of an exogenous oxidative stress) as well as in the presence of an ozone-induced oxidative stress. Thus, based on the present findings, we submit that the sensitivity to oxidative stress in the four conditions we studied here is: KOO3 ≥ KOFA ≈ WTO3 ≥ WTFA. Moreover, the susceptibility of SP-A to oxidation shown by previous studies, together with its abundance in BAL fluid, make it ideally suited to play a role as a "sacrificial antioxidant," as has been described for albumin [104,105,109] and postulated for other proteins [107]. Further study is warranted to investigate the postulated mechanisms in greater detail.

Abbreviations 2D-DIGE: two-dimensional difference gel electrophoresis; BAL: bronchoalveolar lavage; DEF: defense and immunity; KO: SP-A -/- (knockout) mice; KOFA: SP-A -/- mice exposed to filtered air; KOO3: SP-A -/- mice exposed to O3; MALDI-ToF/ToF: matrix-assisted laser desorption ionization-time of flight/time of flight; PCA: principal component analysis; PMM: protein metabolism and modification and chaperones; PMN: polymorphonuclear leukocytes; ppm: parts per million; RED: redox balance; SP-A: surfactant protein-A; WT: wild type mice; WTFA: wild type mice exposed to filtered air; WTO3: wild type mice exposed to O3

Competing interests The authors declare that they have no competing interests.

Authors' contributions RH exposed animals to ozone, collected samples, ran gels, did preliminary analysis, and assisted with the manuscript. TMU assisted RH, organized and analyzed data, and participated in the writing of the manuscript. WMF did MALDI-ToF/ToF analysis and assisted with evaluation of 2D-DIGE and mass spec data. JF assisted with study design and data interpretation and participated in manuscript preparation. DSP designed the study, interpreted data, and prepared the manuscript. All authors read and approved the final manuscript.

Additional material Additional file 1 MIAPE GE. File containing Minimum Information About a Proteomics Experiment – Gel Electrophoresis in the format recommended by the Human Proteome Organization Proteomic Standards Initiative. Click here for file [http://www.biomedcentral.com/content/supplementary/14775956-7-12-S1.doc]



Additional file 2 MIAPE GI. File containing Minimum Information About a Proteomics Experiment – Gel Informatics in the format recommended by the Human Proteome Organization Proteomic Standards Initiative. Click here for file [http://www.biomedcentral.com/content/supplementary/14775956-7-12-S2.doc]


13.

14. 15.

Additional file 3 List of identified proteins. Table contains a list of all proteins on the reference gel that have been identified by MALDI-ToF/ToF, their accession numbers, and the biological processes and molecular functions attributed to each by PANTHER. We have also assigned most of these to one of three functional groups: Defense and immunity (DEF); Redox balance (RED); Protein metabolism and modification and chaperones (PMM) and provided the reference from which that assignment was made (See reference list in main paper). Click here for file [http://www.biomedcentral.com/content/supplementary/14775956-7-12-S3.doc]

16.

17. 18.

19. 20.

Acknowledgements This study was supported in part by grant number 1RO1 ES09882 from the National Institute of Environmental Health Sciences (JF) and, in part, by the Children's Miracle Network at Penn State College of Medicine (DSP), and under a grant with the Pennsylvania Department of Health using Tobacco Settlement Funds (DSP). The Department of Health specifically disclaims responsibility for any analyses, interpretations or conclusions.

21. 22. 23. 24.

References 1. 2.

3. 4. 5. 6. 7. 8.

9.

10.

11. 12.

Hollingsworth JW, Kleeberger SR, Foster WM: Ozone and pulmonary innate immunity. Proc Am Thorac Soc 2007, 4:240-246. Holz O, Jorres RA, Timm P, Mucke M, Richter K, Koschyk S, Magnussen H: Ozone-induced airway inflammatory changes differ between individuals and are reproducible. Am J Respir Crit Care Med 1999, 159:776-784. Kim JJ: Ambient air pollution: health hazards to children. Pediatrics 2004, 114:1699-1707. Koenig JQ: Effect of ozone on respiratory responses in subjects with asthma. Environ Health Perspect 1995, 103(Suppl 2):103-105. Morrison D, Rahman I, MacNee W: Permeability, inflammation and oxidant status in airspace epithelium exposed to ozone. Respir Med 2006, 100:2227-2234. Pinkerton KE, Balmes JR, Fanucchi MV, Rom WN: Ozone, a malady for all ages. Am J Respir Crit Care Med 2007, 176:107-108. Yang IA, Fong KM, Zimmerman PV, Holgate ST, Holloway JW: Genetic susceptibility to the respiratory effects of air pollution. Thorax 2008, 63:555-563. Haque R, Umstead TM, Ponnuru P, Guo X, Hawgood S, Phelps DS, Floros J: Role of surfactant protein-A (SP-A) in lung injury in response to acute ozone exposure of SP-A deficient mice. Toxicol Appl Pharmacol 2007, 220:72-82. Mikerov AN, Gan X, Umstead TM, Miller L, Chinchilli VM, Phelps DS, Floros J: Sex differences in the impact of ozone on survival and alveolar macrophage function of mice after Klebsiella pneumoniae infection. Respir Res 2008, 9:24. Wagner JG, Jiang Q, Harkema JR, Illek B, Patel DD, Ames BN, Peden DB: Ozone enhancement of lower airway allergic inflammation is prevented by gamma-tocopherol. Free Radic Biol Med 2007, 43:1176-1188. Shore SA, Abraham JH, Schwartzman IN, Murthy GG, Laporte JD: Ventilatory responses to ozone are reduced in immature rats. J Appl Physiol 2000, 88:2023-2030. Kleeberger SR, Reddy SP, Zhang LY, Cho HY, Jedlicka AE: Toll-like receptor 4 mediates ozone-induced murine lung hyperper-

25. 26. 27.

28.

29.

30. 31.

32. 33.

34.

meability via inducible nitric oxide synthase. Am J Physiol Lung Cell Mol Physiol 2001, 280:L326-L333. Long NC, Suh J, Morrow JD, Schiestl RH, Murthy GG, Brain JD, Frei B: Ozone causes lipid peroxidation but little antioxidant depletion in exercising and nonexercising hamsters. J Appl Physiol 2001, 91:1694-1700. Johnston CJ, Holm BA, Gelein R, Finkelstein JN: Postnatal lung development: immediate-early gene responses post ozone and LPS exposure. Inhal Toxicol 2006, 18:875-883. Hatch GE, Slade R, Harris LP, McDonnell WF, Devlin RB, Koren HS, Costa DL, McKee J: Ozone dose and effect in humans and rats. A comparison using oxygen-18 labeling and bronchoalveolar lavage. Am J Respir Crit Care Med 1994, 150:676-683. Mikerov AN, Haque R, Gan X, Guo X, Phelps DS, Floros J: Ablation of SP-A has a negative impact on the susceptibility of mice to Klebsiella pneumoniae infection after ozone exposure: sex differences. Respir Res 2008, 9:77. Cho HY, Kleeberger SR: Genetic mechanisms of susceptibility to oxidative lung injury in mice. Free Radic Biol Med 2007, 42:433-445. Peel JL, Tolbert PE, Klein M, Metzger KB, Flanders WD, Todd K, Mulholland JA, Ryan PB, Frumkin H: Ambient air pollution and respiratory emergency department visits. Epidemiology 2005, 16:164-174. Fischer P, Hoek G, Brunekreef B, Verhoeff A, van Wijnen J: Air pollution and mortality in The Netherlands: are the elderly more at risk? Eur Respir J Suppl 2003, 40:34s-38s. Baleeiro CE, Wilcoxen SE, Morris SB, Standiford TJ, Paine R III: Sublethal hyperoxia impairs pulmonary innate immunity. J Immunol 2003, 171:955-963. Kelly FJ, Mudway IS: Protein oxidation at the air-lung interface. Amino Acids 2003, 25:375-396. Cecarini V, Gee J, Fioretti E, Amici M, Angeletti M, Eleuteri AM, Keller JN: Protein oxidation and cellular homeostasis: Emphasis on metabolism. Biochim Biophys Acta 2007, 1773:93-104. Ding J, Umstead TM, Floros J, Phelps DS: Factors affecting SP-Amediated phagocytosis in human monocytic cell lines. Respir Med 2004, 98:637-650. Mikerov AN, Umstead TM, Huang W, Liu W, Phelps DS, Floros J: SPA1 and SP-A2 variants differentially enhance association of Pseudomonas aeruginosa with rat alveolar macrophages. Am J Physiol Lung Cell Mol Physiol 2005, 288:L150-L158. Kremlev SG, Phelps DS: Effect of SP-A and surfactant lipids on expression of cell surface markers in the THP-1 monocytic cell line. Am J Physiol 1997, 272:L1070-L1077. Kremlev SG, Umstead TM, Phelps DS: Surfactant protein A regulates cytokine production in the monocytic cell line THP-1. Am J Physiol 1997, 272:L996-1004. Brinker KG, Garner H, Wright JR: Surfactant protein A modulates the differentiation of murine bone marrow-derived dendritic cells. Am J Physiol Lung Cell Mol Physiol 2003, 284:L232-L241. Hickman-Davis JM, Fang FC, Nathan C, Shepherd VL, Voelker DR, Wright JR: Lung surfactant and reactive oxygen-nitrogen species: antimicrobial activity and host-pathogen interactions. Am J Physiol Lung Cell Mol Physiol 2001, 281:L517-L523. Hussain S, Wright JR, Martin WJ: Surfactant protein A decreases nitric oxide production by macrophages in a tumor necrosis factor-alpha-dependent mechanism. Am J Respir Cell Mol Biol 2003, 28:520-527. Phelps DS: Surfactant regulation of host defense function in the lung: A question of balance. Pediatr Pathol Mol Med 2001, 20:269-292. Mikerov AN, Umstead TM, Gan X, Huang W, Guo X, Wang G, Phelps DS, Floros J: Impact of ozone exposure on the phagocytic activity of human surfactant protein A (SP-A) and SP-A variants. Am J Physiol Lung Cell Mol Physiol 2008, 294:L121-L130. Stagos D, Umstead TM, Phelps DS, Skaltsounis L, Haroutounian S, Floros J, Kouretas D: Inhibition of ozone-induced SP-A oxidation by plant polyphenols. Free Radic Res 2007, 41:357-366. Wang G, Umstead TM, Phelps DS, Al Mondhiry H, Floros J: The effect of ozone exposure on the ability of human surfactant protein A variants to stimulate cytokine production. Environ Health Perspect 2002, 110:79-84. Wang G, Bates-Kenney SR, Tao JQ, Phelps DS, Floros J: Differences in biochemical properties and in biological function between



35.

36.

37. 38. 39.

40. 41.

42.

43.

44.

45.

46.

47.

48.

49. 50.

51. 52.

53.

human SP-A1 and SP-A2 variants, and the impact of ozoneinduced oxidation. Biochemistry 2004, 43:4227-4239. LeVine AM, Kurak KE, Bruno MD, Stark JM, Whitsett JA, Korfhagen TR: Surfactant protein-A-deficient mice are susceptible to Pseudomonas aeruginosa infection. Am J Respir Cell Mol Biol 1998, 19:700-708. LeVine AM, Kurak KE, Wright JR, Watford WT, Bruno MD, Ross GF, Whitsett JA, Korfhagen TR: Surfactant protein-A binds group B streptococcus enhancing phagocytosis and clearance from lungs of surfactant protein-A-deficient mice. Am J Respir Cell Mol Biol 1999, 20:279-286. LeVine AM, Whitsett JA, Hartshorn KL, Crouch EC, Korfhagen TR: Surfactant protein D enhances clearance of influenza A virus from the lung in vivo. J Immunol 2001, 167:5868-5873. LeVine AM, Gwozdz J, Stark J, Bruno M, Whitsett J, Korfhagen T: Surfactant protein-A enhances respiratory syncytial virus clearance in vivo. J Clin Invest 1999, 103:1015-1021. Hickman-Davis JM, Gibbs-Erwin J, Lindsey JR, Matalon S: Role of surfactant protein-a in nitric oxide production and Mycoplasma killing in congenic C57BL/6 mice. Am J Respir Cell Mol Biol 2004, 30:319-325. Bhalla DK, Hoffman LA, Pearson AC: Modification of macrophage adhesion by ozone: role of cytokines and cell adhesion molecules. Ann N Y Acad Sci 1996, 796:38-46. Devalia JL, Bayram H, Rusznak C, Calderon M, Sapsford RJ, Abdelaziz MA, Wang J, Davies RJ: Mechanisms of pollution-induced airway disease: in vitro studies in the upper and lower airways. Allergy 1997, 52:45-51. Hollingsworth JW, Cook DN, Brass DM, Walker JK, Morgan DL, Foster WM, Schwartz DA: The role of Toll-like receptor 4 in environmental airway injury in mice. Am J Respir Crit Care Med 2004, 170:126-132. Ishii Y, Yang H, Sakamoto T, Nomura A, Hasegawa S, Hirata F, Bassett DJ: Rat alveolar macrophage cytokine production and regulation of neutrophil recruitment following acute ozone exposure. Toxicol Appl Pharmacol 1997, 147:214-223. Johnston CJ, Stripp BR, Piedbeouf B, Wright TW, Mango GW, Reed CK, Finkelstein JN: Inflammatory and epithelial responses in mouse strains that differ in sensitivity to hyperoxic injury. Exp Lung Res 1998, 24:189-202. Wheelock AM, Boland BC, Isbell M, Morin D, Wegesser TC, Plopper CG, Buckpitt AR: In vivo effects of ozone exposure on protein adduct formation by 1-nitronaphthalene in rat lung. Am J Respir Cell Mol Biol 2005, 33:130-137. Wattiez R, Noel-Georis I, Cruyt C, Broeckaert F, Bernard A, Falmagne P: Susceptibility to oxidative stress: proteomic analysis of bronchoalveolar lavage from ozone-sensitive and ozoneresistant strains of mice. Proteomics 2003, 3:658-665. Alban A, David SO, Bjorkesten L, Andersson C, Sloge E, Lewis S, Currie I: A novel experimental design for comparative twodimensional gel analysis: two-dimensional difference gel electrophoresis incorporating a pooled internal standard. Proteomics 2003, 3:36-44. Freeman WM, Brebner K, Amara SG, Reed MS, Pohl J, Phillips AG: Distinct proteomic profiles of amphetamine self-administration transitional states. Pharmacogenomics Journal 2005, 5:203-214. Freeman WM, Hemby SE: Proteomics for protein expression profiling in neuroscience. Neurochemical Research 2004, 29:1065-1081. Focking M, Boersema PJ, O'Donoghue N, Lubec G, Pennington SR, Cotter DR, Dunn MJ: 2-D DIGE as a quantitative tool for investigating the HUPO Brain Proteome Project mouse series. Proteomics 2006, 6:4914-4931. Guest PC, Skynner HA, Salim K, Tattersall FD, Knowles MR, Atack JR: Detection of gender differences in rat lens proteins using 2D-DIGE. Proteomics 2006, 6:667-676. Jung EJ, Avliyakulov NK, Boontheung P, Loo JA, Nel AE: Pro-oxidative DEP chemicals induce heat shock proteins and an unfolding protein response in a bronchial epithelial cell line as determined by DIGE analysis. Proteomics 2007, 7:3906-3918. Umstead TM, Freeman WM, Chinchilli VM, Phelps DS: Age-related changes in the expression and oxidation of bronchoalveolar lavage proteins in the rat. Am J Physiol Lung Cell Mol Physiol 2009, 296:L14-L29.


54.

55.

56. 57.

58. 59.

60. 61.

62.

63.

64. 65. 66. 67.

68.

69. 70.

71.

72.

Gibson F, Anderson L, Babnigg G, Baker M, Berth M, Binz PA, Borthwick A, Cash P, Day BW, Friedman DB, Garland D, Gutstein HB, Hoogland C, Jones NA, Khan A, Klose J, Lamond AI, Lemkin PF, Lilley KS, Minden J, Morris NJ, Paton NW, Pisano MR, Prime JE, Rabilloud T, Stead DA, Taylor CF, Voshol H, Wipat A, Jones AR: Guidelines for reporting the use of gel electrophoresis in proteomics. Nat Biotechnol 2008, 26:863-864. Poon HF, Shepherd HM, Reed TT, Calabrese V, Stella AM, Pennisi G, Cai J, Pierce WM, Klein JB, Butterfield DA: Proteomics analysis provides insight into caloric restriction mediated oxidation and expression of brain proteins associated with age-related impaired cellular processes: Mitochondrial dysfunction, glutamate dysregulation and impaired protein synthesis. Neurobiol Aging 2006, 27:1020-1034. Kuncewicz T, Sheta EA, Goldknopf IL, Kone BC: Proteomic analysis of S-nitrosylated proteins in mesangial cells. Mol Cell Proteomics 2003, 2:156-163. Searfoss GH, Jordan WH, Calligaro DO, Galbreath EJ, Schirtzinger LM, Berridge BR, Gao H, Higgins MA, May PC, Ryan TP: Adipsin, a biomarker of gastrointestinal toxicity mediated by a functional gamma-secretase inhibitor. J Biol Chem 2003, 278:46107-46116. Miner JL, Hahn KJ, Spurlock ME, Staten NR: Expression and complement d activity of porcine adipsin. Protein Expr Purif 2001, 23:14-21. Fain JN, Nesbit AS, Sudlow FF, Cheema P, Peeples JM, Madan AK, Tichansky DS: Release in vitro of adipsin, vascular cell adhesion molecule 1, angiotensin 1-converting enzyme, and soluble tumor necrosis factor receptor 2 by human omental adipose tissue as well as by the nonfat cells and adipocytes. Metabolism 2007, 56:1583-1590. Ellis EM: Reactive carbonyls and oxidative stress: potential for therapeutic intervention. Pharmacol Ther 2007, 115:13-24. Keightley JA, Shang L, Kinter M: Proteomic analysis of oxidative stress-resistant cells: a specific role for aldose reductase overexpression in cytoprotection. Mol Cell Proteomics 2004, 3:167-175. Greene CM, Miller SD, Carroll T, McLean C, O'Mahony M, Lawless MW, O'Neill SJ, Taggart CC, McElvaney NG: Alpha-1 antitrypsin deficiency: a conformational disease associated with lung and liver manifestations. J Inherit Metab Dis 2008, 31:21-34. van Genderen HO, Kenis H, Hofstra L, Narula J, Reutelingsperger CP: Extracellular annexin A5: functions of phosphatidylserinebinding and two-dimensional crystallization. Biochim Biophys Acta 2008, 1783:953-963. Schouten M, Wiersinga WJ, Levi M, van Der PT: Inflammation, endothelium, and coagulation in sepsis. J Leukoc Biol 2008, 83:536-545. de Torre C, Ying SX, Munson PJ, Meduri GU, Suffredini AF: Proteomic analysis of inflammatory biomarkers in bronchoalveolar lavage. Proteomics 2006, 6:3949-3957. Chen C, Lorimore SA, Evans CA, Whetton AD, Wright EG: A proteomic analysis of murine bone marrow and its response to ionizing radiation. Proteomics 2005, 5:4254-4263. Wong WM, Gerry AB, Putt W, Roberts JL, Weinberg RB, Humphries SE, Leake DS, Talmud PJ: Common variants of apolipoprotein A-IV differ in their ability to inhibit low density lipoprotein oxidation. Atherosclerosis 2007, 192:266-274. Meier BW, Gomez JD, Kirichenko OV, Thompson JA: Mechanistic basis for inflammation and tumor promotion in lungs of 2,6di-tert-butyl-4-methylphenol-treated mice: electrophilic metabolites alkylate and inactivate antioxidant enzymes. Chem Res Toxicol 2007, 20:199-207. Healy J, Tipton K: Ceruloplasmin and what it might do. J Neural Transm 2007, 114:777-781. Chupp GL, Lee CG, Jarjour N, Shim YM, Holm CT, He S, Dziura JD, Reed J, Coyle AJ, Kiener P, Cullen M, Grandsaigne M, Dombret MC, Aubier M, Pretolani M, Elias JA: A chitinase-like protein in the lung and circulation of patients with severe asthma. N Engl J Med 2007, 357:2016-2027. Zhu Z, Zheng T, Homer RJ, Kim YK, Chen NY, Cohn L, Hamid Q, Elias JA: Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 2004, 304:1678-1682. Abdul AA, Gunasekaran K, Volanakis JE, Narayana SV, Kotwal GJ, Murthy HM: The structure of complement C3b provides



73.

74. 75.

76. 77.

78. 79.

80.

81. 82.

83. 84.

85.

86. 87.

88.

89.

90. 91. 92.

insights into complement activation and regulation. Nature 2006, 444:221-225. Rawal N, Rajagopalan R, Salvi VP: Activation of complement component C5: comparison of C5 convertases of the lectin pathway and the classical pathway of complement. J Biol Chem 2008, 283:7853-7863. Drouin SM, Sinha M, Sfyroera G, Lambris JD, Wetsel RA: A protective role for the fifth complement component (c5) in allergic airway disease. Am J Respir Crit Care Med 2006, 173:852-857. Wait R, Chiesa G, Parolini C, Miller I, Begum S, Brambilla D, Galluccio L, Ballerio R, Eberini I, Gianazza E: Reference maps of mouse serum acute-phase proteins: changes with LPS-induced inflammation and apolipoprotein A-I and A-II transgenes. Proteomics 2005, 5:4245-4253. Yoshida K, Suzuki Y, Sinohara H: Molecular cloning and sequence analysis of C57BL/6 mouse contrapsin cDNA. DNA Seq 2001, 12:289-291. Shi Q, Xu H, Kleinman WA, Gibson GE: Novel functions of the alpha-ketoglutarate dehydrogenase complex may mediate diverse oxidant-induced changes in mitochondrial enzymes associated with Alzheimer's disease. Biochim Biophys Acta 2008, 1782:229-238. Hubbard RE, O'Mahony MS, Calver BL, Woodhouse KW: Plasma esterases and inflammation in ageing and frailty. Eur J Clin Pharmacol 2008, 64:895-900. Grimsrud PA, Picklo MJ Sr, Griffin TJ, Bernlohr DA: Carbonylation of adipose proteins in obesity and insulin resistance: identification of adipocyte fatty acid-binding protein as a cellular target of 4-hydroxynonenal. Mol Cell Proteomics 2007, 6:624-637. Harju TH, Peltoniemi MJ, Rytila PH, Soini Y, Salmenkivi KM, Board PG, Ruddock LW, Kinnula VL: Glutathione S-transferase omega in the lung and sputum supernatants of COPD patients. Respir Res 2007, 8:48. Baty JW, Hampton MB, Winterbourn CC: Proteomic detection of hydrogen peroxide-sensitive thiol proteins in Jurkat cells. Biochem J 2005, 389:785-795. Van Gucht S, Atanasova K, Barbe F, Cox E, Pensaert M, Van Reeth K: Effect of porcine respiratory coronavirus infection on lipopolysaccharide recognition proteins and haptoglobin levels in the lungs. Microbes Infect 2006, 8:1492-1501. Yang F, Haile DJ, Berger FG, Herbert DC, Van Beveren E, Ghio AJ: Haptoglobin reduces lung injury associated with exposure to blood. Am J Physiol Lung Cell Mol Physiol 2003, 284:L402-L409. Ghosh S, Janocha AJ, Aronica MA, Swaidani S, Comhair SA, Xu W, Zheng L, Kaveti S, Kinter M, Hazen SL, Erzurum SC: Nitrotyrosine proteome survey in asthma identifies oxidative mechanism of catalase inactivation. J Immunol 2006, 176:5587-5597. Pespeni M, Mackersie RC, Lee H, Morabito D, Hodnett M, Howard M, Pittet JF: Serum levels of Hsp60 correlate with the development of acute lung injury after trauma. J Surg Res 2005, 126:41-47. Kaetsu A, Fukushima T, Inoue S, Lim H, Moriyama M: Role of heat shock protein 60 (HSP60) on paraquat intoxication. J Appl Toxicol 2001, 21:425-430. Bromberg Z, Raj N, Goloubinoff P, Deutschman CS, Weiss YG: Enhanced expression of 70-kilodalton heat shock protein limits cell division in a sepsis-induced model of acute respiratory distress syndrome. Crit Care Med 2008, 36:246-255. Guo S, Wharton W, Moseley P, Shi H: Heat shock protein 70 regulates cellular redox status by modulating glutathionerelated enzyme activities. Cell Stress Chaperones 2007, 12:245-254. Williams AS, Issa R, Leung SY, Nath P, Ferguson GD, Bennett BL, Adcock IM, Chung KF: Attenuation of ozone-induced airway inflammation and hyper-responsiveness by c-Jun NH2 terminal kinase inhibitor SP600125. J Pharmacol Exp Ther 2007, 322:351-359. Senthilnathan P, Padmavathi R, Magesh V, Sakthisekaran D: Modulation of TCA cycle enzymes and electron transport chain systems in experimental lung cancer. Life Sci 2006, 78:1010-1014. Mitchell GB, Clark ME, Siwicky M, Caswell JL: Stress alters the cellular and proteomic compartments of bovine bronchoalveolar lavage fluid. Vet Immunol Immunopathol 2008, 125:111-125. Alyaqoub FS, Liu Y, Tao L, Steele VE, Lubet RA, Pereira MA: Modulation by bexarotene of mRNA expression of genes in mouse lung tumors. Mol Carcinog 2008, 47:165-171.


93. 94.

95. 96.

97. 98.

99.

100.

101. 102.

103.

104. 105.

106. 107. 108. 109.

110. 111.

112.

Sharma PR, Jain S, Tiwari PK: Elevated level of serum LDH2 and LDH3 in sputum three positive TB patients of Sahariya tribe: a preliminary study. Clin Biochem 2007, 40:1414-1419. Waghabi MC, Coutinho CM, Soeiro MN, Pereira MC, Feige JJ, Keramidas M, Cosson A, Minoprio P, Van Leuven F, Araujo-Jorge TC: Increased Trypanosoma cruzi invasion and heart fibrosis associated with high transforming growth factor beta levels in mice deficient in alpha(2)-macroglobulin. Infect Immun 2002, 70:5115-5123. Swaisgood CM, Aronica MA, Swaidani S, Plow EF: Plasminogen is an important regulator in the pathogenesis of a murine model of asthma. Am J Respir Crit Care Med 2007, 176:333-342. Skornicka EL, Kiyatkina N, Weber MC, Tykocinski ML, Koo PH: Pregnancy zone protein is a carrier and modulator of placental protein-14 in T-cell growth and cytokine production. Cell Immunol 2004, 232:144-156. Kelsen SG, Duan X, Ji R, Perez O, Liu C, Merali S: Cigarette smoke induces an unfolded protein response in the human lung: a proteomic approach. Am J Respir Cell Mol Biol 2008, 38:541-550. Molotkov A, Duester G: Genetic evidence that retinaldehyde dehydrogenase Raldh1 (Aldh1a1) functions downstream of alcohol dehydrogenase Adh1 in metabolism of retinol to retinoic acid. J Biol Chem 2003, 278:36085-36090. Mattow J, Demuth I, Haeselbarth G, Jungblut PR, Klose J: Seleniumbinding protein 2, the major hepatic target for acetaminophen, shows sex differences in protein abundance. Electrophoresis 2006, 27:1683-1691. Ghio AJ, Carter JD, Richards JH, Richer LD, Grissom CK, Elstad MR: Iron and iron-related proteins in the lower respiratory tract of patients with acute respiratory distress syndrome. Crit Care Med 2003, 31:395-400. Blanco O, Catala A: Surfactant protein A inhibits the non-enzymatic lipid peroxidation of porcine lung surfactant. Prostaglandins Leukot Essent Fatty Acids 2001, 65:185-190. Terrasa AM, Guajardo MH, de Armas SE, Catala A: Pulmonary surfactant protein A inhibits the lipid peroxidation stimulated by linoleic acid hydroperoxide of rat lung mitochondria and microsomes. Biochim Biophys Acta 2005, 1735:101-110. Rodriguez CK, McCormack FX, Possmayer F: Pulmonary surfactant protein-A (SP-A) restores the surface properties of surfactant after oxidation by a mechanism that requires the Cys6 interchain disulfide bond and the phospholipid binding domain. J Biol Chem 2003, 278:20461-20474. Himmelfarb J, Stenvinkel P, Ikizler TA, Hakim RM: The elephant in uremia: oxidant stress as a unifying concept of cardiovascular disease in uremia. Kidney Int 2002, 62:1524-1538. Kim IG, Park SY, Oh TJ: Dithiothreitol induces the sacrificial antioxidant property of human serum albumin in a metalcatalyzed oxidation and gamma-irradiation system. Arch Biochem Biophys 2001, 388:1-6. Levine RL, Berlett BS, Moskovitz J, Mosoni L, Stadtman ER: Methionine residues may protect proteins from critical oxidative damage. Mech Ageing Dev 1999, 107:323-332. Levine RL, Moskovitz J, Stadtman ER: Oxidation of methionine in proteins: roles in antioxidant defense and cellular regulation. IUBMB Life 2000, 50:301-307. Stadtman ER, Van Remmen H, Richardson A, Wehr NB, Levine RL: Methionine oxidation and aging. Biochim Biophys Acta 2005, 1703:135-140. Sayed AA, Cook SK, Williams DL: Redox balance mechanisms in Schistosoma mansoni rely on peroxiredoxins and albumin and implicate peroxiredoxins as novel drug targets. J Biol Chem 2006, 281:17001-17010. Newton BW, Russell WK, Russell DH, Ramaiah SK, Jayaraman A: Liver Proteome Analysis in a Rodent Model of Alcoholic Steatosis. J Proteome Res 2009. Hollingsworth JW, Maruoka S, Li Z, Potts EN, Brass DM, Garantziotis S, Fong A, Foster WM, Schwartz DA: Ambient ozone primes pulJ Immunol 2007, monary innate immunity in mice. 179:4367-4375. Steerenberg P, Verlaan A, De Klerk A, Boere A, Loveren H, Cassee F: Sensitivity to ozone, diesel exhaust particles, and standardized ambient particulate matter in rats with a listeria monocytogenes-induced respiratory infection. Inhal Toxicol 2004, 16:311-317.




113. Phelps DS, Umstead TM, Rose RM, Fishman JA: Surfactant proteinA levels increase during Pneumocystis carinii pneumonia in the rat. Eur Respir J 1996, 9:565-570. 114. Phelps DS, Rose RM: Increased recovery of surfactant protein A in AIDS-related pneumonia. Am Rev Respir Dis 1991, 143:1072-1075. 115. Janic B, Umstead TM, Phelps DS, Floros J: Modulatory effects of ozone on THP-1 cells in response to SP-A stimulation. Am J Physiol Lung Cell Mol Physiol 2005, 288:L317-L325. 116. Kuzmenko AI, Wu H, Bridges JP, McCormack FX: Surfactant lipid peroxidation damages surfactant protein A and inhibits interactions with phospholipid vesicles. J Lipid Res 2004, 45:1061-1068. 117. Kuzmenko AI, Wu H, Wan S, McCormack FX: Surfactant protein A is a principal and oxidation-sensitive microbial permeabilizing factor in the alveolar lining fluid. J Biol Chem 2005, 280:25913-25919. 118. Rahman I, Biswas SK, Kode A: Oxidant and antioxidant balance in the airways and airway diseases. Eur J Pharmacol 2006, 533:222-239. 119. Bridges JP, Davis HW, Damodarasamy M, Kuroki Y, Howles G, Hui DY, McCormack FX: Pulmonary surfactant proteins A and D are potent endogenous inhibitors of lipid peroxidation and oxidative cellular injury. J Biol Chem 2000, 275:38848-38855. 120. Gil HW, Oh MH, Woo KM, Lee EY, Oh MH, Hong SY: Relationship between pulmonary surfactant protein and lipid peroxidation in lung injury due to paraquat intoxication in rats. Korean J Intern Med 2007, 22:67-72.

Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK

Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright

BioMedcentral

Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp
