Molecular Ecology (2013) 22, 1700–1716
doi: 10.1111/mec.12205
Impact of climate changes from Middle Miocene onwards on evolutionary diversification in Eurasia: Insights from the mesobuthid scorpions C H E N G - M I N S H I , * † Y A - J I E J I , * L I N L I U , * ‡ L E I W A N G * and D E - X I N G Z H A N G * † *State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China, †Center for Computational and Evolutionary Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China, ‡University of the Chinese Academy of Sciences, Beijing 100049, China
Abstract The aridification from Middle Miocene onwards has transformed the Asian interior into an arid environment, and the Pleistocene glacial–interglacial oscillations exerted further ecological impact. Therefore, both aridification and glaciation would have considerably influenced the evolution of many mid-latitude species in temperate Asia. Here, we tested this perspective by a phylogeographic study of the mesobuthid scorpions across temperate Asia using one mitochondrial and three nuclear genes. Concordant mitochondrial and nuclear gene trees were obtained, which are consistent with species tree inferred using a Bayesian approach. The age of the most recent common ancestor (MRCA) of all the studied scorpions was estimated to be 12.49 Ma (late Middle Miocene); Mesobuthus eupeus diverged from the clade composing Mesobuthus caucasicus and Mesobuthus martensii in early Late Miocene (10.21 Ma); M. martensii diverged from M. caucasicus at 5.53 Ma in Late Miocene. The estimated MRCA ages of M. martensii and the Chinese lineage of M. eupeus were 2.37 and 0.68 Ma, respectively. Central Asia was identified as the ancestral area for the lineage leading to M. martensii and M. caucasicus and the Chinese lineage of M. eupeus. The ancestral habitat of the genus Mesobuthus is likely to have been characterized by an arid environment; a shift towards more humid habitat occurred in the MRCA of M. martensii and a lineage of M. caucasicus, finally leading to the adaptation of M. martensii to humid environment. Our data strongly support the idea that the stepwise intensified aridifications from Mid-Miocene onwards drove the diversification of mesobuthid scorpions, and suggest that M. martensii and M. eupeus observed today in China originated from an ancestral lineage distributed in Central Asia. Both the colonization and the ensuing evolution of these species in East Asia appear to have been further moulded by Quaternary glaciations. Keywords: aridification, glaciation, Mesobuthus scorpion, Miocene climate changes, out of Central Asia, temperate Asia Received 13 July 2011; revision received 30 November 2012; accepted 4 December 2012
Introduction Eurasia has experienced profound changes in climate since the Mid-Miocene Climatic Optimum (a warm and humid period peaked at around 17–15 Ma; Flower & Correspondence: De-Xing Zhang, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, Beijing 100101, China. Fax: (86) 10 6480 7232; E-mail:
[email protected]
Kennett 1994; Zachos et al. 2001), with Central Asia and Northwest China being transformed towards an arid environment (Fortelius et al. 2002, 2006; Liu et al. 2009; Miao et al. 2012). The intermittent aridification in the vast interior of the continent from Middle Miocene onwards would have gradually split this giant landmass into ecologically differentiated subcontinents. The onset of Northern Hemisphere glaciations around 2.7 Ma (Raymo 1994) imposed further important influence on the evolution of biodiversity. Although the effects of these climatic © 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1701 events on the biotic elements may have varied from region to region and differed from species to species, depending largely on the adaptations of organisms (e.g. environmental tolerance and dispersal ability), a conventional conjecture on the impacts of Quaternary glaciations has been put forward, tracing back to Darwin’s time: the Quaternary climatic cycles may have constituted a major biogeographic driver constraining the geographic distribution of species (Darwin 1859, pp. 365–382) and intraspecific genetic variations (Hewitt 1996). This conjecture has received strong support from modern phylogeographic studies; for example, rather detailed periglacial and postglacial histories of the terrestrial flora and fauna across Eurasia have been reconstructed, and a consensus is emerging that the Quaternary climate oscillations have played an important role in shaping species’ distribution and genetic structure of modern biota (this is particularly clear for the last glacial cycle; Taberlet et al. 1998; Hewitt 1999, 2000, 2004, 2011; Weiss & Ferrand 2007; Schmitt 2009; Shafer et al. 2010; Stewart et al. 2010). In sharp contrast, the ecological and evolutionary consequences of aridifications in Eurasia from Middle Miocene onwards have been much less examined from a phylogeographic perspective (actually, the phylogeography of the world’s arid regions has been little studied in general; Byrne et al. 2008). One possible reason is that such signals (genetic signatures) might have been largely distorted and even erased by the more recent Pleistocene glaciation cycles (Zink et al. 2004). Nevertheless, a testable conjecture for mid-latitude temperate species in Eurasia can be reasonably generated: Although Pleistocene glacial cycles have greatly altered the distributional ranges of many mid-latitude species, the historical occurrence, evolutionary origin and diversification of these species could have stemmed much deeper in time, for example, in Pliocene and even Miocene, associated with climatic events such as the aridification. Examples are being accumulated, lending some preliminary support to this idea (Marmi et al. 2006; Kyriazi et al. 2008; Colangelo et al. 2010; Kornilios et al. 2012). Species groups with varying adaptations to arid, semi-arid or humid conditions may be more suitable for testing this perspective with sufficient spatial and temporal resolution. Scorpions were among the earliest terrestrial animals and have been found on all major landmasses except Antarctica (Polis 1990). Although they are extremely conservative in morphology, they show a great ability of adaptation in ecology, behaviour, physiology and life history (Polis 1990), which may explain their outstanding success throughout the environmental changes since the Middle Silurian (c. 425–450 Ma). These creatures also have limited dispersal ability (Polis & Sisson 1990). © 2013 Blackwell Publishing Ltd
Therefore, scorpions can serve as good models for large spatial and temporal scale biogeographic analysis. The genus Mesobuthus (Vachon, 1950) occurs widely in the mid-latitude Palaearctic region (northern limit of latitude 50°N, Gromov 2001) in a variety of habitats, from sand deserts to high mountains and even the littoral zone in East China (Remy & Leroy 1933; Millot & Vachon 1949; Shi et al. 2007), with the center of diversity in Central Asia and Iran (Fet 1989, 1994). Among the eight species of this genus listed in Fet et al. (2000), Mesobuthus martensii, Mesobuthus caucasicus, Mesobuthus eupeus and Mesobuthus gibbosus are the most studied; they are also the commonest and most widely distributed species in the genus. The remaining species are almost only known for their original report [e.g. Mesobuthus agnetis (Werner, 1936), Mesobuthus macmahoni (Pocock, 1900), Mesobuthus vesiculatus (Pocock, 1899) and Mesobuthus extremus (Werner, 1936)], and a few localized new species reported within the last few years remain largely controversial (e.g. Mesobuthus songi from southern Tibet has been transferred to the genus Hottentotta after further examination; Sun et al. 2010; Teruel & Rein 2010). In addition, Gantenbein et al. (2000) recognized a new species endemic to the Island Cyprus, Mesobuthus cyprius Gantenbein and Kropf. To a large degree, these five species may well represent the genus. In particular, geographically, they occur in tandem from west to east (with some overlapping) and occupy much of the temperate Eurasia (Fig. 1). Also importantly, the present-day distributions of these species mirror a trans-continental section of climate types: Mediterranean climate for M. gibbosus and M. cyprius, extremely arid continental climate for M. eupeus, arid and semi-arid climate for M. caucasicus and humid monsoonal climate for M. martensii. We believe that their evolutionary histories could provide some useful insights into the diversification and biogeographic evolution of biota on the Eurasian continent. The phylogenetic relationships of the first four species (M. gibbosus, M. cyprius, M. caucasicus and M. eupeus) were studied by Gantenbein et al. (2003). They found a deep split between the Mediterranean scorpions (M. gibbosus and M. cyprius) and the Central Asia scorpions (M. eupeus and M. caucasicus). Unfortunately, their effort was restricted to preliminary phylogenetic analysis, and only limited samples from the west half of the Asian continent were studied, without including the two East Asian forms (M. martensii and the Chinese population of M. eupeus). Here, we report a combined phylogenetic and phylogeographic study of all five major species in the genus employing the mitochondrial cytochrome C oxidase I gene (mtCOI) and nuclear protein kinase (PK), Serin-type endopeptidase (STE) and Serin proteinase inhibitor (Spn2) genes, with extensive
1702 C . - M . S H I E T A L .
Fig. 1 Approximate distributional ranges of Mesobuthus gibbosus, Mesobuthus cyprius, Mesobuthus caucasicus, Mesobuthus eupeus and Mesobuthus martensii and locations of the samples we collected. Geographically, these five closely related species occur largely in tandem (with some overlapping) from west to east and occupy much of the temperate Eurasia: (1) M. gibbosus (Brulle, 1932)—widely distributed in the northeast Mediterranean region (Balkans and Turkey; shown in black on the map); (2) M. cyprius Gantenbein and Kropf, 2000—endemic to Cyprus (and being the only scorpion species recorded on the island; shown in grey); (3) M. eupeus (Koch, 1839)—the most widespread species, ranging from Turkey to Mongolia and northwest part of China (shown as right slashed area in maroon); (4) M. caucasicus (Nordmann, 1840)—common in the Caucasus and Central Asia (Armenia, Azerbaidzhan, Georgia, Kazakhstan, Kyrgyzstan, Tajikistan, Turkmenistan and Uzbekistan; Fet 1989; shown as left slashed area in blue), and being geographically nested within M. eupeus; and (5) M. martensii (Karsch, 1879)—the easternmost species of the genus, occurring widely in east China (shown in green), and being parapatric with M. eupeus.
sampling of the East Asian lineages. We aim to test the hypothesis that both the Mid-Miocene onwards climate change (e.g. aridification) and the Pleistocene glaciation have considerably affected the diversification and geographic evolution of these mesobuthid scorpions. Our results strongly support this idea and suggest that the intensified aridifications from Mid-Miocene onwards drove the diversification of mesobuthid scorpions in general, and the ‘Out of Central Asia’ origin of the Chinese mesobuthid scorpions in particular, whereas the Quaternary glaciations have further shaped evolution of these scorpions.
Materials and methods Sample collection and molecular protocols Samples of Mesobuthus martensii and Mesobuthus eupeus in China were collected during field surveys of the
geographic distribution of Mesobuthus scorpions in China since 2000. This included 115 individuals of M. martensii from 28 sites in China and 45 individuals of M. eupeus from 9 sites in China, one site from Mongolia and one site from Tajikistan (Table 1; Fig. 1). The sampling regime covered all landscapes and ecogeographic regions across the entire range of M. martensii and the Chinese reach of M. eupeus. Intensive sampling was conducted in the region where the two species come into contact, resulting in samples from three sympatric populations to be included in the study. All specimens and DNA extracts were deposited at the Laboratory of Molecular Ecology and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing. Genomic DNA was extracted from fresh or alcoholpreserved tissues (usually leg IV or femur and patella of pedipalp) using a modified phenol-chloroform extraction procedure (Zhang & Hewitt 1998). Polymerase chain reactions (PCRs) were used to amplify fragments of the © 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1703 Table 1 Sampling localities and sample sizes of Mesobuthus martensii and Mesobuthus eupeus
M. martensii
M. eupeus
Code
Locality
Latitude (°N)
Longitude (°E)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20* 21* 22 23 24* 25 26 27 28 Total 1 2 3 4 5* 6 7 8* 9* M1 T1 Total
Wafangdian, Liaoning Yantai, Shandong Lingyuan, Liaoning Chengde, Hebei Zaozhuang, Shandong Zaozhuang, Shandong Taian, Shandong Suzhou, Anhui Ningyang, Shandong Huairou, Beijing Lincheng, Hebei Linzhou, Henan Nanyang, Henan Gujiao, Shanxi Qingshuihe, Inner Mongolia Yunxian, Hubei Danfeng, Shaaxi Yanan, Shaanxi Zhidan, Shaaxi Urad Qianqi, Inner Mongolia Urad Zhongqi, Inner Mongolia Zhengning, Gansu Haiyuan, Ningxia Zhongwei, Ningxia Tongwei, Gansu Lanzhou, Gansu Honggu, Gansu Guide, Qinghai
39.37 37.33 41.25 41.10 34.97 35.05 36.30 33.70 35.77 40.70 37.49 36.00 33.40 37.88 39.90 32.80 33.70 36.50 36.80 40.67 41.30 35.40 36.76 37.30 35.02 36.12 36.36 36.01
121.50 121.28 119.38 118.50 117.69 117.59 117.17 116.90 116.90 116.70 114.25 113.80 112.40 112.06 111.60 110.80 110.30 109.40 108.80 108.73 108.58 108.40 105.78 105.46 105.12 103.72 102.85 101.40
Altay, Xinjiang Jinta, Gansu Minqin, Gansu Gulang, Gansu Zhongwei, Ningxia Alxa Zouqi, Inner Mongolia Hanggin Qi, Inner Mongolia Urad Zhongqi, Inner Mongolia Urad Qianqi, Inner Mongolia South Gobi, Mongolia Khujand, Tajikistan
47.30 39.91 38.60 37.52 37.30 38.35 40.15 41.30 40.67 43.70 40.29
87.80 98.84 102.50 103.63 105.46 105.70 107.51 108.58 108.73 104.26 69.63
mtCOI
Spn2
STE
PK
3 4 3 3 2 2 7 4 2 3 4 4 4 3 13 3 3 4 3 4 2 4 3 1 8 6 7 6 115 5 7 4 8 2 4 4 4 4 2 1 45
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 28 1 1 1 1 1 1 1 1 1 1 1 11
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 28 1 1 1 1 1 1 1 1 1 1 1 11
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 28 1 1 1 1 1 1 1 1 1 1 1 11
*Sympatric sites, where both M. martensii and M. eupeus were found.
mtCOI and three nuclear loci, viz: PK, STE and Spn2 (Gantenbein & Keightley 2004). Sequences of the primers (5′ to 3′) and their annealing temperatures used in our study are as follows: LCO1490 (GGTCAACAAATCATAAAGATATTGG, Folmer et al. 1994) and Nancy (CCCGGTAAAATTAAAATATAAACTTC, Simon et al. 1994) for mtCOI, 53 °C; STEfor (AGTTCTTATTGGTGTT CTTCTTTTGG) and STErev (TTATTGTATCCCTATTAGA ATCGCAGTTTAAGG) for STE (Gantenbein & Keightley 2004), 51 °C; Spn2for (TGAACAGTTAGCTAAGGC) and Spn2rev (TTAACCCATTGATTAACTTCAT) for Spn2 © 2013 Blackwell Publishing Ltd
(Gantenbein & Keightley 2004), 52 °C; 03B10for (TCTGATGTATGGCAGATGGCAATG) and 03B10rev (CGAACTCAAGATCCACTCCTGTACTCG) for PK (Gantenbein et al. 2003), 55 °C. PCRs were carried out in volumes of 30 lL consisting of 1 9 reaction buffer, 1.5 mM of MgCl2, 0.2 mM of each dNTPs, 0.3 lM of each primer, 0.6 unit of Taq DNA polymerase (Promega, Shanghai, China) and 30–50 ng of genomic DNA. The purified PCR products were sequenced using the ABI BigDyee Terminator Cycle Sequencing Kit (RR Mix) on an ABI3100 automated sequencer (Applied Biosystems).
1704 C . - M . S H I E T A L . All the 115 individuals of M. martensii and 45 individuals of M. eupeus were sequenced for mtCOI. To verify and complement the mitochondrial data, one individual from each site was analysed for nuclear loci. Therefore, 28 individuals of M. martensii and 11 individuals of M. eupeus were analysed for each of the three nuclear loci. Six/four/four individuals were heterozygous at the PK/ Spn2/STE loci, respectively. One-site heterozygotes can be directly phased (Huang et al. 2008); unphasable heterozygous sites were coded ambiguously. Sequences of Mesobuthus caucasicus, Mesobuthus gibbosus, Mesobuthus cyprius and the non-Chinese samples of M. eupeus and M. martensii were obtained from published sources (Gantenbein et al. 2003; Gantenbein & Keightley 2004; Choi et al. 2007; Mirshami et al. 2010). In total, this includes 50 mitotypes and 11 nuclear haplotypes (Table S1, Supporting information). All mitochondrial sequences were checked for the possible interference of mitochondrial pseudogenes following the recommendations of Zhang & Hewitt (1996) and Bensasson et al. (2001). Androctonus australis and three species of Buthus (B. occitanus, B. ibericus and an unnamed species) were used as outgroup according to both morphological evidence (Sissom 1990) and recent molecular phylogenetic evidence (Gantenbein & Largiader 2003; Gantenbein et al. 2003; Parmakelis et al. 2006).
Phylogenetic analyses Sequences were aligned using Clustal X 1.83 (Thompson et al. 1997) and further inspected by eye. The unique haplotypes were determined using DnaSP version 5.10.01 (Librado & Rozas 2009). The mtCOI and nuclear loci (PK, STE and Spn2) were analysed separately with the following considerations: on one side, the sampling of nuclear loci is much sparser compared with mtCOI; on the other side, the mitochondrial DNA and nuclear genes follow different modes of inheritance and evolution, they should not be concatenated in analysis by assuming an identical history (Rosenberg & Nordborg 2002). The unique haplotypes of mitochondrial and nuclear genes have been deposited in Genbank under accession numbers KC141981–KC142042 and KC165691–KC165744, respectively (Table S1). Phylogenetic analyses were performed using both maximum likelihood (ML) and Bayesian inference methods. The appropriate models of DNA evolution for the data were inferred using ModelTest 3.7 program (Posada & Crandall 1998). According to the Akaike information criterion, the best-fit model is GTR + I + Γ for mtCOI, GTR for PK, TVMef + Γ for Spn2 and TVM + I for STE. A GTR + Γ model was selected for the concatenated sequences of the three nuclear loci. ML analysis was carried out using PHYML 3.0 (Guindon & Gascuel 2003).
Topological robustness was assessed through bootstrapping (1000 replicates). Bayesian analysis was conducted with MrBayes version 3.1.2 (Ronquist & Huelsenbeck 2003). Analyses were initiated with random starting trees, and each analysis ran for 107 (mtCOI) or 2 9 106 (nuclear genes) generations with four Markov chains employed. Trees were sampled every 100 generations, and the ‘temperature’ parameter was set to 0.1 (mtCOI) or 0.2 (nuclear genes). The first 30% trees were discarded as burn-in after a careful inspection of the stationary state and the convergence of the chains with TRACER 1.5 (Rambaut & Drummond 2007). For the nuclear genes, three approaches were applied. (i) The three loci were combined into an 1104 bp alignment and analysed in concatenation with the GTR + Γ model applied to the whole matrix, following the conditional combination approach introduced in Huelsenbeck et al. (1996) based upon the incongruence length difference test (but see Darlu & Lecointre 2002). (ii) As in (i), but the concatenated sequence was analysed under partition with each locus assigned a specific best-fit substitution model described above. (iii) Each nuclear gene was analysed separately using the corresponding bestfit model. Note that, no suitable outgroup sequence is available for the nuclear gene analyses. Topology inferred from mtCOI data was statistically tested for robustness against an alternative topology in which M. caucasicus was constrained to monophyly with Shimodaira–Hasegawa (SH) test and the approximately unbiased (AU) test implemented in CONSEL version 0.1j (Shimodaira & Hasegawa 2001). Site-wise likelihoods were estimated in PAUP* (Swofford 2003) under the GTR + Γ + I model. Species tree was jointly inferred across all loci from vectors of estimated gene trees using the Bayesian hierarchical model implemented in BEST 2.3 (Liu & Pearl 2007; Liu et al. 2008). The aforementioned substitution models were used for each gene accordingly. The topology and all other parameters were unlinked across genes. Chains were run for 200 million generations, with a sampling frequency of one per 1000 generations. The last 10 000 trees sampled from the stationary phase were summarized under the 50% majority-rule consensus criterion.
Estimation of divergence times As the molecular clock model was rejected by likelihood-ratio tests (2Dl = 1398.65, d.f. = 114, P = 0.00 for mtCOI; and 2Dl = 351.73, d.f. = 27, P = 0.00 for the concatenated nuclear sequence), divergence times were estimated with a relaxed molecular clock approach implemented in BEAST 1.6.2 (Drummond & Rambaut 2007). This method allows variation in substitution rates © 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1705 among branches and hence estimates phylogeny and divergence times while taking into account uncertainties in evolutionary rates and calibration times (Drummond et al. 2006). The rate change was explicitly modelled using uncorrelated lognormal distribution across trees. A Yule process (pure birth process) prior was used for modelling speciation. Tree topology and age were simultaneously estimated with branch length and substitution model parameters. One hundred million Markov chain Monte Carlo (MCMC) searches were performed and sampled every 1000 generations. Convergence of the MCMC chains was checked with TRACER 1.5 (Rambaut & Drummond 2007). Maximum clade credibility (MCC) tree, posteriors, means and 95% highest posterior densities (HPDs) of ages of nodes were indentified and annotated using TreeAnnotator 1.6.2 (Drummond & Rambaut 2007). The mtCOI data set and the concatenated nuclear genes data set were used for independent divergence time estimations, while we acknowledge the sampling inadequacy of nuclear loci in M. caucasicus [note that although the nuclear tree is unrooted, it can be assumed that the root is along the branch leading to M. gibbosus following Gantenbein et al. (2003)]. Because there is no fossil record available for this group of scorpions, we calibrated the divergent time with two palaeogeological events, both of which involving the eustatic processes. First, we followed Gantenbein et al. (2003) and Gantenbein & Keightley (2004) to use the time of refilling of the Mediterranean Basin by the end of the Messinian Salinity Crisis (MSC; 5.33 0.3 Ma) as the time of divergence of M. cyprius from its closest relatives (node C1, Fig. 2). We set a normal prior distribution with mean 5.3 Ma and standard deviation 0.3 Ma for this calibrating node. Second, we used a uniform prior distribution with a lower boundary of 9 Ma and an upper boundary of 13.8 Ma for divergence time between M. gibbosus and other Asian species (node C2, Fig. 2). See later section for more detailed discussion.
Biogeographic analysis: reconstructing ancestral distributional area and ancestral habitat The historical distribution range of the hypothetical ancestors (internal nodes) was reconstructed using Bayes-DIVA implemented in RASP 2.0 Beta (Yu et al. 2010). Bayes-DIVA determines the probability of ancestral distribution for each node averaged over all sampled trees derived from MCMC and thus accounts for phylogenetic uncertainty in biogeography (Nylander et al. 2008). We loaded 50 000 trees previously produced in BEAST and ran the analysis for 50 000 cycles using 10 chains. Six distributional areas were defined on the basis of palaeogeographical history and environmental © 2013 Blackwell Publishing Ltd
condition (Fig. S1, Supporting information): (A) Balkan, (B) Anatolian, (C) Iran, (D) Central Asia, (E) Northwest China plus Southwest Mongolia and (F) East China. (We have noticed that there exists some ambiguity in the meaning of the term ‘Central Asia’ in the literature. Here in our study, it refers to the geographic area consisting of Kazakhstan, Kyrgyzstan, Tajikistan, Turkmenistan and Uzbekistan.) The maximum number of areas in ancestral ranges was constrained to three, given the largely concatenated west–east arrangement of areas and weak long-distance-dispersal capability of the scorpions. Six major categories of climate (BS, arid steppe; BW, arid desert; Cs, temperate with dry summer; Ds, cold with dry summer; Dw, cold with dry winter; and Cw, temperate with dry winter) were recognized when the geographic distribution of these scorpions was projected onto the world map of K€ oppen-Geiger climate classification updated by Peel et al. (2007). The map was based on a large global data set of long-term monthly precipitation and temperature station time series. Please refer to Peel et al. (2007) for the defining criteria of the climate categories. When precipitation in the active seasons of scorpions is considered, these six habitat types can be combined into two categories, arid (BS, BW, Cs and Ds) and humid (Dw and Cw), because Cs and Ds were both characterized by dry summer. Thus, the habitat of M. martensii was assigned to ‘humid’, while all others were assigned to ‘arid’. The ancestral habitat preference (arid vs. humid) of the five scorpion species was inferred using both ML and Bayesian methods. Both methods were implemented in the BayesTraits package (Pagel et al. 2004). The mtCOI data were thinned to 33 representative sequences (haplotypes) by excluding very similar sequences, while the backbone topology of the full phylogenetic tree was retained. Thus, 1000 randomly sampled post-burnin trees with branch lengths inferred with BEAST were used in ancestral state reconstruction. In the ML approach, the transition rates from arid to humid habitat and the reverse were set equal because chi-squared test (d.f. = 1) did not reject the hypothesis of equal rate on all trees. The Bayesian approach applied a reversible jump MCMC method (Pagel & Meade 2006). It computed posterior distributions of rate coefficients and state probabilities while incorporating phylogenetic uncertainty as well as uncertainty in the ancestral state reconstruction. The ratedev parameter was set to six and a uniform prior distribution (0, 1) used, which gave an average acceptance rate of 18.2% (note that different combinations of the ratedev parameter and the hyperpriors/priors were explored to optimize the acceptance rate to be around 20% following the programme manual).
1706 C . - M . S H I E T A L .
Fig. 2 Time-calibrated phylogeny based on mitochondrial data and reconstructed ancestral distributional areas and habitat states. Shown here is the maximum clade credibility tree of scorpions inferred from mtCOI data using the Bayesian relaxed phylogenetic approach implemented in BEAST (Drummond & Rambaut 2007). Shown above the branches are bootstrap support values (%) from 1000 replicates (maximum likelihood analysis)/posterior probabilities (Bayesian inference). Clades are numbered as C1, C2 and 1–13, respectively. C1 and C2 are calibration points. A magnified view of clades 4 and 10 are shown in Fig. 3. Scale of divergence time (Ma) is displayed at the bottom. Species colour codes in the tree: green—Mesobuthus martensii; blue—Mesobuthus caucasicus; maroon— Mesobuthus eupeus; black—Mesobuthus gibbosus s. l. Ancestral distributional areas reconstructed from Bayes-DIVA analysis were mapped on the nodes as coloured pie charts; they were filled with the relevant colours proportional to the mean probability of the ancestral distributional area. Similarly, the posterior mean probabilities of the reconstructed ancestral habitat states of selected nodes were shown as proportionally coloured column on the right of the relevant nodes (see Table 3 for more details): yellow, arid habitat; green, humid habitat. The values in the column are the mean probabilities for the ancestral habitat of the node being arid or humid.
Results Phylogenetic analyses The 115 mtCOI sequences (575 bp) of Mesobuthus martensii collapsed into 44 haplotypes (MmaCN01-44) and the 45 mtCOI sequences of Mesobuthus eupeus into 18 haplotypes (MeuCN01-16, MeuMN01 and MeuTJ01; Table S2, Supporting information). The complete mtCOI data set in our analysis comprises 116 operational terminal units, including the aforementioned 62 haplotypes, plus the haplotype MmaMtNC from the complete mitochondrial genome sequence of M. martensii (Choi et al. 2007), 17 haplotypes of Mesobuthus caucasicus, 23 haplotypes of M. eupeus, 7 haplotypes of Mesobuthus gibbosus, 2 haplotypes of Mesobuthus cyprius and 4
sequences of the outgroups (Gantenbein et al. 2003; Gantenbein & Keightley 2004; Mirshami et al. 2010; Table S1). The ML tree and the Bayesian tree are highly congruent and differ only in some minor aspects such as arrangements of individual haplotypes within major clades. Figure 2 shows the MCC tree from the divergence time analysis of mtCOI data set, with the bootstrap support proportions from ML analysis listed above the clades along with the posterior probabilities (A magnifying view of clades 4 and 10 are shown in Fig. 3). Monophyly of M. martensii was strongly supported (98/ 1.00, node 4) by both analyses. Although M. caucasicus was paraphyletic with respect to M. martensii, the two paraphyletic lineages (M. caucasicus I and II) were highly supported (99/1.00 and 97/1.00 for nodes 5 & 6, © 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1707 (a)
Fig. 3 Lineage diversification in Mesobuthus martensii and the Chinese lineage of Mesobuthus eupeus. Shown here is a magnified view of clades 4 and 10 in Fig. 2 inferred from mtCOI data using the Bayesian relaxed phylogenetic approach implemented in BEAST. Bootstrap support values (%) from 1000 replicates (maximum likelihood analysis)/posterior probabilities (Bayesian inference) were indicated above the branches. Scale of divergence time (Ma) is displayed at the bottom. (a) Clades 4; (b) Clade 10.
(b)
respectively). Both the AU test and SH test favoured the tree shown in Fig. 2 over the topology in which M. caucasicus was forced to be monophyletic, but it is not statistically significant at 0.05 level (P = 0.811 and P = 0.917, respectively). Support for the clade composing all M. eupeus sequences was relatively weak (51/0.74; node 7); however, an embedded subclade containing samples from (Northwest) China and the neighbouring countries (Tajikistan, Uzbekistan, Kazakhstan and Mongolia) was strongly supported (99/1.00; node 10). In this subclade, all haplotypes from China, a sample from Mongolia and three samples from Kazakhstan were clustered together (90/1.00; node 12), with two samples from Central Asia (MeuTJ01 and MeuUZa1) being basal to it (Fig. 3b). The nodes joining M. martensii and © 2013 Blackwell Publishing Ltd
M. caucasicus I and II (nodes 2 & 3) were both rather robust (87/1.00 for node 2; 73/0.92 for node 3). M. gibbosus and M. cyprius formed a strongly supported clade (96/1.00), while M. gibbosus was paraphyletic with respect to M. cyprius. Within the Chinese scorpion M. martensii, there exist several well-supported subclades (Fig. 3a) that also appear to be geographically well-defined (one east China subclade, one central north China subclade, one isolated east subclade and one widespread subclade; data not shown). Also, these lineages diverged at different depths of time. We will not over-explore the significance of this observation because a more extensive sampling is clearly needed for rigorously examining intraspecific diversification and evolution in M. martensii.
1708 C . - M . S H I E T A L .
Fig. 5 Species tree jointly inferred across all loci from vectors of estimated gene trees using the Bayesian hierarchical model implemented in BEST. Node supports are Bayesian posterior probabilities. Colour codes are as defined in Fig. 2.
Fig. 4 The 50% majority consensus tree inferred from the concatenated nuclear loci with partitioned Bayesian analysis. Shown above the branches are bootstrap support values (%) from 1000 replicates (maximum likelihood analysis)/posterior probabilities (Bayesian inference). Colour codes are as defined in Fig. 2.
For the three nuclear loci (PK gene, 351 bp; Spn2, 369 bp; and STE, 384 bp), four, seven and four haplotypes were identified for M. martensii, respectively, and two, two and four haplotypes for the Chinese samples of M. eupeus, respectively (Table S2). The length of the combined sequence is 1104 bp; thirteen haplotypes were identified for M. martensii and five haplotypes for M. eupeus. The three approaches for the nuclear loci gave identical results with regard to the evolutionary relationships among M. martensii, M. caucasicus and M. eupeus. That is, the ML tree and Bayesian tree consistently supported that M. martensii is more closely related to M. caucasicus than to M. eupeus (96/1.00; Fig. 4; Fig. S2, Supporting information). As in mtCOI results, M. gibbosus was paraphyletic with respect to M. cyprius in the concatenated approaches regardless of whether the data were partitioned by genes or not. However, when analysed separately, the gene trees of PK and STE loci supported monophyly of M. cyprius and M. gibbosus, while the other gene (Spn2) supported paraphyly of M. gibbosus with respect to M. cyprius (Fig. S2; note that support to monophyly of M. gibbosus is rather weak at the STE locus. Also, the number of divergent sites is small at each locus; Table S2). Our results strongly suggest that the taxonomic status of M. cyprius and its relationship to M. gibbosus deserve
more extensive phylogenetic examination, and the possibility that they simply represent allopatric populations of the same species cannot be excluded. Hence, we consider M. gibbosus and M. cyprius together as M. gibbosus s. l. in subsequent analysis. Figure 5 shows the strongly supported species tree jointly inferred across all loci. The sister relationship between M. martensii and M. caucasicus was confirmed with a posterior probability of 1.00.
Divergence time estimates The means and 95% HPD intervals of divergence times are listed in Table 2 (the mitochondrial means also shown in the chronogram of Fig. 2). The age of the most recent common ancestor (MRCA) of all five Mesobuthus scorpions was estimated to be 12.49 Ma (95% HPD, 10.53–13.8 Ma) from the mtCOI data and 12.26 Ma (9.93–13.8 Ma) from the nuclear data. M. eupeus diverged from the clade composing M. caucasicus and M. martensii in early Late Miocene (mtCOI data: mean 10.21 Ma and 95% HPD, 8.01–12.33 Ma; nuclear data: mean 8.90 Ma and 95% HPD, 5.43–13.78 Ma). M. martensii diverged from M. caucasicus in the Late Miocene [mtCOI data: 5.53 Ma (3.92–7.26 Ma) between M. martensii and M. caucasicus clade I and 6.74 Ma (4.90–8.67 Ma) between their ancestral clade and M. caucasicus clade II; nuclear data: 6.27 Ma (3.03– 10.01 Ma)]. Interspecific divergence times estimated from both mitochondrial and nuclear loci accord very well with each other, but the nuclear estimates had much larger confidence intervals (Table 2) due to the limited informative sites of the nuclear genes (Table S2). Therefore, we will base our subsequent discussion mainly on the results of the mtCOI data. © 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1709 Table 2 Mean divergence times and the corresponding 95% highest posterior density intervals of the relevant nodes estimated using a relaxed molecular clock method in BEAST from mtCOI and nuclear gene data Node
Mean*
95% HPD lower*
95% HPD upper*
1 2 3 4 5 6 7 8 9 10 11 12 13 C1 C2
10.21 6.74 5.53 2.37 1.16 2.41 9.12 6.49 5.65 2.16 1.45 0.68 6.94 5.15 12.49
8.01 4.90 3.92 1.62 0.59 1.58 7.07 4.83 3.46 1.28 0.83 0.39 5.34 4.57 10.53
12.33 (13.78) 8.67 (10.01) 7.26 3.17 1.79 3.35 11.13 8.23 6.66 3.14 2.10 1.02 8.68 5.71 (5.76) 13.8 (13.8)
(8.90) (6.27)
(5.18) (12.26)
(5.43) (3.03)
(4.59) (9.93)
Estimates from the concatenated sequence of three nuclear loci were given in parentheses. HPD, highest posterior density. *Time is in million years (Myr). Nodes are labelled as in Fig. 2.
Because of the reduced sample sizes used in the analyses of the nuclear loci, we will refer to the mitochondrial calibration for the MRCA ages of intraspecific lineages of M. martensii and M. eupeus. The estimated MRCA age of M. martensii was 2.37 Ma (1.62–3.17 Ma), and several well-defined intraspecific lineages formed at varying times (from 0.99, node C2), and this preference was retained in almost all descending lineages except that a shift from arid to humid habitat occurred in the MRCA of M. martensii and a subclade of M. caucasicus (Parid < 0.7 and Phumid > 0.3, node 3) around 5.5 Ma, which had resulted in the humid-adapted M. martensii (Phumid = 1.00, node 4).
Discussion Biogeographic connection of Mesobuthus scorpions between China and Central Asia Recall that the geographic distributions of the studied species are arranged in tandem from west to east (with certain overlapping) across temperate Eurasia (Fig. 1). Our results reveal that the more easterly the distributional range, the younger the species (lineage) is phylogenetically (Figs 2–5). That is, the ages of these scorpions also follow largely a west-to-east descending order, with Mesobuthus gibbosus s. l. being the oldest, followed by Mesobuthus eupeus and then Mesobuthus cau-
Table 3 Results of ancestral habitat reconstruction with maximum likelihood (ML) and Bayesian approaches showing means and SDs of the probabilities for arid habitats (Parid). Parid-C2, Parid-1, Parid-2, Parid-3, and Parid-4 refer to the probability for the ancestral habitat of nodes C2 and 1–4 being arid, respectively Method ML Bayes
Log-likelihood 4.635 0.227 4.747 0.333
Node labels are the same as in Fig. 2. © 2013 Blackwell Publishing Ltd
Parid-C2
Parid-1
Parid-2
Parid-3
Parid-4
0.999 0.001 0.998 0.003
0.999 0.001 0.998 0.007
0.898 0.120 0.908 0.138
0.544 0.186 0.696 0.270
0.000 0.000 0.000 0.000
1710 C . - M . S H I E T A L . casicus, and Mesobuthus martensii being the youngest. Note that on the mitochondrial gene tree (Fig. 2), the strongly supported subclade containing M. eupeus samples from Northwest China and the neighbouring regions (Tajikistan, Uzbekistan, Kazakhstan and Mongolia) (node 12) is the youngest M. eupeus lineage. Another interesting observation is that the Chinese scorpion M. martensii is more closely related to M. caucasicus from Central Asia than to its geographic neighbour M. eupeus (Figs 2, 4 & 5). That is, the geographic neighbour is not phylogenetically the closest relative, and the two closest species M. martensii and M. caucasicus are geographically intervened by a more distinct species M. eupeus. This suggests that M. martensii was phylogenetically derived from a population (lineage) of M. caucasicus. Remarkably, nearly a century ago, the close relationship between M. caucasicus and M. martensii was already perceived by the Russian zoologist Alexei A. Birula, who even wrote that ‘the close kinship… may eventually reveal that B. martensi is no more than a geographic race of the former’ (that is, M. caucasicus; Birula 1917; B. martensi is synonymous with M. martensii). An independent line of evidence also confirms the closer affinity between M. martensii and M. caucasicus: Ecological niche modelling revealed that some regions in Central Asia where M. caucasicus is currently distributed, are potentially suitable niche for M. martensii (Shi et al. 2007). This is consistent with the well recognized niche conservatism that maintains that closely related species tend to be ecologically similar (Peterson et al. 1999; Prinzing et al. 2001; Webb et al. 2002; Wiens & Graham 2005; but see Losos 2008). The third particularity is that Central Asia was identified as the ancestral distributional area for the lineage leading to M. martensii and M. caucasicus and the Chinese lineage of M. eupeus, although M. martensii is restricted in East China. Our results indicate that the ancestral distributional area of the genus Mesobuthus was unlikely to be China (P < 2% for Southwest Mongolia plus Northwest China and East China; Table S3). The above observations, taken together, strongly suggest that both M. martensii and M. eupeus observed today in China were derived phylogeographically from Central Asia through eastward dispersal of their ancestral lineages (hereafter referred to as the ‘Out of Central Asia’ origin), indicating a close biogeographic connection of the Chinese mesobuthid scorpions to those in Central Asia. Their very different MRCA ages (2.37 Ma for M. martensii and 0.68 Ma for the Chinese lineage of M. eupeus, respectively) further suggest that the ancestral forms of the two scorpions dispersed to China independently, possibly associated with different historical events.
Mid-Miocene onwards climate change as a major driving force triggering diversification and biogeographic evolution of the mesobuthid species on Eurasian continent The estimated MRCA age of all five scorpion species is about 12 Ma (Fig. 2 and Table 2). This means that lineage diversification of the mesobuthid scorpions initiated just following the threshold event of the Middle Miocene climate transition (c. 16–12.9 Ma; Flower & Kennett 1994). It is well known that the warm and humid Mid-Miocene Climatic Optimum (around 17–15 Ma) was immediately followed by a stepwise cooling from c. 15–12.5 Ma, which led to colder climates in mid- to high-latitudes, greater climatic zonality, a surface ocean circulation more dynamic than any previous stages of Cenozoic, significant polar cooling and East Antarctic ice growth (Flower & Kennett 1994; Abels et al. 2005; Lewis et al. 2007). This had some major effects on global terrestrial environments. One of the consequences was the intensification of the aridity in mid-latitude climatic zone, as manifested by the enhanced development of grasslands and associated biota on all the major continents (Flower & Kennett 1994). In Eurasia, the increasingly intensified aridification was accompanied by major mammalian faunal turnover from around Late Miocene towards an increase in hypsodont species and grazers (Fortelius et al. 2006; Liu et al. 2009); it also provided a plausible explanation for the ecological adaptation of the mesobuthid scorpions in Central Asia/ Iran. Reconstruction of ancestral state of habitat preference revealed that arid habitat was the type of environment which the genus Mesobuthus primitively adapted to (Fig. 2 & Table 3). Then, as discussed below, from early Late Miocene onwards some lineages had adapted progressively towards less arid (e.g. mitochondrial subclade I of M. caucasicus) and humid conditions (M. martensii). Recall that the mottled scorpion M. eupeus is typically xerophilous, adapting to a variety of arid habitats (e.g. desert and semi-desert; Fet 1994) and being absent in littoral areas (Birula 1917). Compared with M. eupeus, the Caucasian scorpion M. caucasicus and the Chinese scorpion M. martensii prefer less harsh habitats (arid and semi-arid region with steppe vegetation for M. caucasicus, and humid and semi-humid regions with deciduous broadleaved forest and temperate steppe for M. martensii). The ancestral lineage leading to M. caucasicus and M. martensii diverged from that of M. eupeus from early Late Miocene (10.21 Ma; Fig. 2c, node 1). While during this time interval, the aridity in the Asian interior was further enhanced (An et al. 2001), it also corresponds to a period when Central Asia underwent extensive tectonic evolution (which was characterized by widespread east–west extension associated with north–south contraction, Yin 2010) and the East Asian © 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1711 summer monsoon became strengthening (which reached a maximum intensity at around 8 and 7 Ma; Chen et al. 2003; Wan et al. 2006). Signals of these reinforcements of the East Asian summer monsoon were also recorded in an 11-Ma-old red clay sequence on the Eastern Chinese Loess Plateau (Xu et al. 2009). Both the tectonic and topographic evolution and the enhanced East Asian summer monsoon could have influenced the rainfall patterns (Miao et al. 2012) and created locally increased humidity in the Asian interior (Fortelius et al. 2002; Ballato et al. 2010; Miao et al. 2012), hence promoting ecological adaptation of some scorpions towards less arid environment. The split between M. caucasicus and M. martensii was most likely caused by habitat fragmentation because of aridification and climatic cooling in the Late Miocene; this leading to geographic isolation and thus differentiation of populations ancestral to M. caucasicus and M. martensii. A likely scenario may be as follows: After the ancestral form of M. martensii and M. caucasicus had reached Eastern Asia by dispersal, severe degradation of habitat occurred in the middle area of the distributional range of the ancestral species because of intensified aridification and/or climatic cooling. The middle region thus became unsuitable for these scorpions (such as the desert habitat seen today in Northwest China), hence causing population fragmentation. Some lineages were trapped in China (or East China) and eventually gave rise to the current M. martensii (remember that East China was inferred as being the ancestral distributional area of M. martensii), which had shifted its niche towards more humid habitat. Those lineages in Central Asia became M. caucasicus, thus being geographically separated from M. martensii. This also provides a reasonable evolutionary explanation for our earlier observation from ecological niche modelling that some regions in Central Asia where M. caucasicus is currently distributed are potentially suitable niche for M. martensii (Shi et al. 2007). Our phylogenetic dating indicates that M. caucasicus and M. martensii diverged at about 5.53 (3.92–7.26) Ma (Fig. 2 and Table 2). This indeed corresponds to the starting of a period that initiated a long-term aridification of Northwest China and Central Asia (Miao et al. 2012) and the Portaferrian sea-level lowering in the Eastern Paratethys (5.8–5.5 Ma; Krijgsman et al. 2010). For example, the Tarim Basin (in Northwest China) had been transformed into a dry land by c. 4.2 Ma at the latest, and the Taklimakan desert (now the second largest desert of the world) appeared by c. 3.4 Ma. This aridification trend was further intensified at c. 2.6 Ma (Sun et al. 2011), coincided temporally with the onset of the Northern Hemisphere glaciations around 2.7 Ma (Raymo 1994). Therefore, the arid habitat in Northwest China had possibly acted as an isolating barrier © 2013 Blackwell Publishing Ltd
between Central Asia and East China, and promoted the differentiation between M. martensii and M. caucasicus. The aforementioned arid habitat in Northwest China, although isolating M. martensii and M. caucasicus, would fit M. eupeus well (because this scorpion can tolerate more arid condition). This provided an opportunity for the establishment of the Chinese lineage of M. eupeus possibly around 0.68 Ma. This age suggests a successful dispersal of M. eupeus to Northwest China (or West Mongolia) shortly after the first major global glaciation in Quaternary (c. 0.88 Ma; MIS 22; Wu et al. 2002; Ehler & Gibbard 2007). Note also that M. martensii had undergone extensive genetic diversifications since 2.37 Ma (Fig. 2 and Table 2), generating several phylogenetically distinct and geographically well-defined lineages at different time depths (Fig. 3). To stress the temporal significance of these observations, it is worthwhile to mention that the MRCA age estimates of the two scorpions (2.37 and 0.68 Ma) were paralleled by the dates of land bridges formed during glaciations between the Chinese continent and Japan at c. 2.6 and 0.63 Ma, respectively (Yoshikawa et al. 2007), which allowed eastward dispersals of mammals from the continent to the Japanese islands. The temporal concordance of these outwardly unrelated observations not only further reassures the reliability of our molecular dating, but also indicates that further evolution of the mesobuthid scorpions in China has been greatly influenced by Quaternary glaciation cycles in addition to aridification.
Limitations and implications Molecular dating. The reliability of molecular dating is crucially important for interpreting our results, particularly when these observations are to be associated with past climate change events. Because no fossil calibration point was available, and our dating was based on gene trees from only a small number of loci with limited sampling of M. caucasicus for the nuclear loci, our estimates of divergence time with palaeogeological events should be used with caution. Thus, the reliability of the calibration deserves further test from more loci/more extensive sampling or other study systems. Nevertheless, the following facts collectively imply that our molecular datings are likely reliable. First, it is well known that the MSC (5.33 0.3 Ma) is the most dramatic episode of oceanic change of the past 20 million years (Hs€ u et al. 1973; Krijgsman et al. 1999), and the island of Cyprus appears to have never been connected to the nearby landmass since the refilling of Mediterranean basin about 5.33 Ma (W. Krijgsman, personal communication). Therefore, the use of the time of refilling of the Mediterranean Basin by the end of MSC as the
1712 C . - M . S H I E T A L . time of divergence of Mesobuthus cyprius from its closest relatives is well founded. In addition, the ages of 13.8 and 9 Ma were used as the lower and upper boundaries, respectively, for divergence between M. gibbosus and other mesobuthid species (node C2, Fig. 2) upon the following considerations. Judging from the current distribution of Mesobuthus, it seemed that scorpions should only have had the opportunity to reach Anatolia and Balkan during the Bodenian salinity crisis (BSC, 13.81 0.08 Ma) of the Paratethys when the massive ‘Dinarid-Anatolian Land’ emerged (de Leeuw et al. 2010), although faunal migration and dispersal from Asia is possible at the end of the Early Miocene when the ‘Gomphoterium Land Bridge’ linked the European continent to the Anatolian Plate (c. 18 Ma; R€ ogl 1999; Koufos et al. 2005; Maridet et al. 2007). The stepwise Middle Miocene cooling was strengthened with a major step dated at 13.82 0.3 Ma in the Mediterranean (Abels et al. 2005), which was followed by the opening of the Eastern Anatolian seaway at the end of BSC (R€ ogl 1999; de Leeuw et al. 2010). These two events might have collectively caused isolation of the Balkan-Anatolian scorpion population from other Asian populations, thus leading to allopatric speciation for M. gibbosus. The formation of the Mid-Aegean Trench at about 12–9 Ma € ais (Creutzburg 1963; split the united landmass of Ag€ Dermitzakis & Papanikolaou 1981) into western (Balkan) and eastern (Anatolia) archipelago ever since. To achieve the Balkan-Anatolian distribution for M. gibbosus, its ancestor must have been there before 9 Ma. Second, the ages estimated from mitochondrial gene and nuclear loci are largely congruent (Table 2), suggesting that the nucleotide divergences we observed at these loci represent plausibly the actual signals of evolutionary divergences between species or populations rather than the stochastic noise. In addition, the 95% HPD intervals of the date estimates from mitochondrial DNA for all major clades are fairly narrow, indicating that the signals in the data were strong. Third, the pairwise distances between the mtCOI sequences of M. cyprius and its sister clade range from 0.0926 to 0.1076, which corresponds to a divergence rate of 1.74–2.02% per Myr. This rate estimate falls well into the range observed in other arthropods (see Borer et al. 2010 for a recent review), such as shrimps (1.4%, Knowlton & Weigt 1998) and beetles (1.5–2.5%, Caccone & Sbordoni 2001; Farrell 2001; Sota & Hayashi 2007; Borer et al. 2010). ‘Out of Central Asia’ origin of the Chinese mesobuthid scorpions. There are some variations of the possible scenarios leading to the distribution status of the Chinese mesobuthid scorpions observed today. For example, on the one hand, we cannot completely exclude the possi-
bility that M. martensii was formed in Central Asia before it dispersed into China. This requires the following additional assumptions: (i) all lineages of M. martensii became extinct except for the one leading to the current populations in China, or (ii) there exist other undiscovered lineages in Central Asia. On the other hand, neither can we exclude the possibility that there may exist other undiscovered Mesobuthus lineage(s) in China (especially Northwest China) apart from M. martensii and M. eupeus given the rich geographic and ecological diversity endured in Northwest China, which may alter the date estimation for example. Clearly, all these possibilities await more field work and taxonomical efforts for validation. Such hypothetical species, if discovered in the Asian interior, may alter the inference result of ancestral distributional area; but it is unlikely to invalidate the conclusion of ‘Out of Central Asia’ origin of the Chinese mesobuthid scorpions, given the robustness of the species tree. Nevertheless, it will help refine our understanding of the relevant evolutionary processes. Implications to biogeographic and evolutionary studies. Although traditional zoogeographic study has recognized that many taxa in China may be of Central Asia origin (reviewed in Zhang 1999), few genetic investigations have been carried out. Furthermore, very little is known about the processes leading to this pattern and the related temporal dimension. The scorpions studied here served as a good test example. Our major conclusion, that is, the ‘Out of Central Asia’ origin of the Chinese Mesobuthus scorpions via independent dispersals driven by the stepwise aridifications from Mid-Miocene onwards across Central Asia and the subsequent glaciations, is also supported by other independent observations. For example, Voelker (2010) concluded that the increased aridity and Central Asian desert expansion since Late Miocene appear to be the primary driving force of avian speciation across Eurasia. Similarly, Melville et al. (2009) suggested that the continued intensification of aridity and unfolding geologic uplift events since Late Miocene had a significant influence on diversification within the genus Phynocephalus of the Central Asian agamid lizards. Our phylogeographic study of the migratory locust (Locusta migratoria) also suggested that the North China population of this highly migratory insect probably had taken refuge in Central Asia during recent glaciations and then recolonized China after ecological conditions for this species had improved (Zhang et al. 2009). Our data also indicate that the last glaciation only had some limited influence on both M. martensii and the Chinese lineage of M. eupeus and suggest that © 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1713 M. martensii has persisted throughout the Quaternary glaciations in East China and the Chinese lineage of M. eupeus also survived the last few glaciation cycles in Northwest China since 0.68 Ma. For example, there exist a hierarchy of well-diversified mitochondrial lineages in M. martensii (the nucleotide diversity of the studied sample was 0.031; Table S2); note in particular that these lineages arose temporally heterogeneously within the last 2.37 Ma (Fig. 3). This preliminary observation may be suggestive of some general processes in the region. A range-wide in-depth population genetic analysis using M. martensii and M. eupeus is underway to further examine this interesting issue. Finally, given that few well-founded molecular calibrations are available for phylogeographic studies in China, which has been a major constraining factor for the inference of evolutionary and biogeographic processes, the datings provided here may serve as a useful reference for other phylogeographic and evolutionary investigations, while the uncertainty and limitation are acknowledged.
Concluding remarks Our data strongly support the hypothesis that the stepwise intensified aridifications from the Middle Miocene onwards had triggered ecological changes in Eurasia and hence drove the differential adaptation and evolutionary diversification of the mesobuthid scorpions, suggest that Mesobuthus martensii and Mesobuthus eupeus observed today in China originated from an ancestral lineage distributed in Central Asia, and both the colonization and the ensuing evolution of these species in East Asia appear to have been further shaped by Quaternary glaciations. Our observations in the mesobuthid scorpions likely underline a general biogeographic process that has been operating on many other temperate organisms in East Asia. Unlike in the high-latitude regions where repeated glaciations might have erased entire populations (Hewitt 2004), in the mid-latitude regions of Asia, many organisms may have more successfully adapted to various climatic stresses and be able to thrive on some severe glacial periods because of the greater ecological and geographic heterogeneity in the region. This thus provides plenty of opportunities for us to reconstruct biogeographic/evolutionary processes at continental and transcontinental scales beyond Quaternary. We would envisage that both Central Asia and East China have served as crucial refugial areas during past environmental crises, and the vast connecting area in between with the complex habitat diversity it harbours, has acted as an important corridor to exchange populations, to generate new lineages and species, and to foster genetic diversity across the Eurasian continent. © 2013 Blackwell Publishing Ltd
Acknowledgements We are grateful to Xin Chen, Jia Chen, Li-Jun He, Yue-Ping Hua, Zu-Shi Huang, Ruicai Huo, Jun Lei, Jiancang Ma, Duohong Wang, Yuchun Wu, Yongfeng Xu, Deyi Zhang for help in sample collection and to Dr. Hongbin Liang and Dr. Altanchimeg Dorjsuren for providing specimens from Tajikistan and Mongolia. We thank Professor Wout Krijgsman, Department of Earth Sciences, Utrecht University, for discussion on Mediterranean paleogeology. We are particularly indebted to four anonymous reviewers for their constructive comments and suggestions and correction over grammar and typos. This work was supported by the Natural Science Foundation of China (grant Nos 31000951, 30730016), the Knowledge Innovation Programs of the Chinese Academy of Sciences (grant Nos KZCX2-YW-JC104, KZCX2-YW-428) and the External Cooperation Program of the Chinese Academy of Sciences (grant No. GJHZ1023).
References Abels HA, Hilgen FJ, Krijgsman W et al. (2005) Long-period orbital control on middle Miocene global cooling: integrated stratigraphy and astronomical tuning of the Blue Clay Formation on Malta. Paleoceanography, 20, PA4012. An ZS, Kutzbach JE, Prell WL, Porter SC (2001) Evolution of Asian monsoons and phased uplift of the Himalaya-Tibetan plateau since late Miocene time. Nature, 411, 62–66. Ballato P, Mulch A, Landgraf A et al. (2010) Middle to late Miocene Middle Eastern climate from stable oxygen and carbon isotope data, southern Alborz mountains, N Iran. Earth and Planetary Science Letters, 300, 125–138. Bensasson D, Zhang DX, Hartl DL, Hewitt GM (2001) Mitochondrial pseudogenes: evolution’s misplaced witnesses. Trends in Ecology & Evolution, 16, 314–321. Birula AA (1917) Arthrogastric Arachnids of Caucasia. Part 1. Scorpions. Annals of the Caucasian Museum, Series A, No. 5. Translated from Russian. Israel Program for Scientific Translation, Jerusalem 1964. Borer M, Alvarez N, Buerki S, Margraf N, Rahier M, Naisbit R (2010) The phylogeography of an alpine leaf beetle: divergence within Oreina elongate span several ice ages. Molecular Phylogenetics and Evolution, 57, 703–709. Byrne M, Yeates DK, Joseph L et al. (2008) Birth of a biome: insights into the assembly and maintenance of the Australian arid zone biota. Molecular Ecology, 17, 4398–4417. Caccone A, Sbordoni V (2001) Molecular biogeography of cave life: a study using mitochondrial DNA from bathysciine beetles. Evolution, 55, 122–130. Chen M, Wang R, Yang L, Han J, Lu J (2003) Development of east Asian summer monsoon environments in the late Miocene: radiolarian evidence from Site 1143 of ODP Leg 184. Marine Geology, 201, 169–177. Choi EH, Park SJ, Jang KH, Hwang W (2007) Complete mitochondrial genome of a Chinese scorpion Mesobuthus martensii (Chelicerata, Scorpiones, Buthidae). DNA Sequence, 18, 459– 471. Colangelo P, Bannikova AA, Krystufek B, Lebedev VS, Annesi F, Loy A (2010) Molecular systematics and evolutionary biogeography of the genus Talpa (Soricomorpha: Talpidae). Molecular Phylogenetics and Evolution, 55, 372–380.
1714 C . - M . S H I E T A L . Creutzburg N (1963) Paleogeographic evolution of Crete from Miocene till our days. Cretan Annals, 15/16, 336–342. Darlu P, Lecointre G (2002) When does the incongruence length difference test fail? Molecular Biology and Evolution, 19, 432–437. Darwin C (1859) On the Origin of Species by Means of Natural Selection. John Murray, London. Dermitzakis DM, Papanikolaou DJ (1981) Paleogeography and geodynamics of the Aegean region during the Neogene. Annales Geologique des Pays Hellenique, 30, 245–289. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology, 7, 214. Drummond AJ, Ho SYW, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics and dating with confidence. PLoS Biology, 4, e88. Ehler J, Gibbard PL (2007) The extent and chronology of Cenozoic Global Glaciation. Quaternary International, 164–165, 6–20. Farrell BD (2001) Evolutionary assembly of the milkweed fauna: cytochrome oxidase I and the age of Tetraopes beetles. Molecular Phylogenetics and Evolution, 18, 467–478. Fet V (1989) A catalogue of scorpions (Chelicerata: Scorpiones) of USSR. Rivista del Museo Civico di Scienze Naturali ‘Enrico Caffi’(Bergamo), 13, 71–171. Fet V (1994) Fauna and Zoogeography of Scorpions (Arachnida: Scorpions) in Turkmenista. In: Biogeography and Ecology of Turkmenistan (eds Fet V, Atamuradov KI), pp. 525–534. Kluwer Academic Publishers, Netherland. Fet V, Sissom WD, Lowe G, Braunwalder ME (2000) Catalog of the Scorpions of the World (1758–1998). The New York Entomological Society, New York. Flower BP, Kennett JP (1994) The middle Miocene climatic transition: East Antarctic ice sheet development, deep ocean circulation and global carbon cycling. Palaeogeography, Palaeoclimatology, Palaeoecology, 108, 537–555. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294–299. Fortelius M, Eronen J, Jernvall J et al. (2002) Fossil mammals resolve regional patterns of Eurasian climate change over 20 million years. Evolutionary Ecology Research, 4, 1005–1016. Fortelius M, Eronen JT, Liu L et al. (2006) Late Miocene and Pliocene large land mammals and climatic changes in Eurasia. Palaeogeography, Palaeoclimatology, Palaeoecology, 238, 219–227. Gantenbein B, Keightley PD (2004) Rates of molecular evolution in nuclear genes of East Mediterranean scorpions. Evolution, 58, 2486–2497. Gantenbein B, Largiader CR (2003) The phylogeographic importance of the Strait of Gibraltar as a gene flow barrier in terrestrial arthropods: a case study with the scorpion Buthus occitanus as model organism. Molecular Phylogenetics and Evolution, 28, 119–130. Gantenbein B, Kropf C, Largiader CR, Scholl A (2000) Molecular and morphological evidence for the presence of a new buthid taxon (Scorpiones: Buthidae) on the island of Cyprus. Revue suisse de Zoologie, 107, 213–232. Gantenbein B, Fet V, Gromov AV (2003) The first DNA phylogeny of four species of Mesobuthus (Scorpiones: Buthidae) from Eurasia. Journal of Arachnology, 31, 412–420.
Gromov AV (2001) On the northern boundary of scorpions (Arachinda: Scorpiones) in Central Asia. In: Scorpions 2001: In Memoriam Gary A Polis (eds Fet V, Selden PA), pp. 301– 307. British Arachnological Society, Burnham Beeches, Bucks. Guindon S, Gascuel O (2003) A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology, 52, 696–704. Hewitt GM (1996) Some genetic consequences of ice ages, and their role in divergence and speciation. Biological Journal of the Linnean Society, 58, 247–276. Hewitt GM (1999) Post-glacial re-colonization of European biota. Biological Journal of Linnean Society, 68, 87–112. Hewitt G (2000) The genetic legacy of Quaternary ice age. Nature, 405, 907–913. Hewitt GM (2004) Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 359, 183–195. Hewitt GM (2011) Quaternary phylogeography: the roots of hybrid zones. Genetica, 139, 1–22. Hs€ u K, Ryan W, Cita M (1973) Late Miocene desiccation of the Mediterranean. Nature, 242, 240–244. Huang ZS, Ji YJ, Zhang DX (2008) Haplotype reconstruction for scnp DNA: a consensus vote approach with extensive sequence data from populations of the migratory locust (Locusta migratoria). Molecular Ecology, 17, 1930–1947. Huelsenbeck JP, Bull JJ, Cunningham CW (1996) Combining data in phylogenetic analysis. Trends in Ecology & Evolution, 11, 152–158. Knowlton N, Weigt LA (1998) New dates and new rates for divergence across the Isthmus of Panama. Proceedings of the Royal Society of London. Series B, Biological Sciences, 265, 2257–2263. Kornilios P, Iigaz C ß , Kumlutasß Y et al. (2012) Neogene climatic oscillations shape the biogeography and evolutionary history of the Eurasian blindsnake. Molecular Phylogenetics and Evolution, 62, 856–873. Koufos G, Kostopoulos DS, Vlachou TD (2005) Neogene/Quaternary mammalian migration in Eastern Mediterranean. Belgian Journal of Zoology, 135, 181–190. Krijgsman W, Hilgen FJ, Raffi I, Sierro FJ, Wilson DS (1999) Chronology, causes and progression of the Messinian salinity crisis. Nature, 400, 652–655. Krijgsman W, Stoica M, Vasiliev I, Popov VV (2010) Rise and fall of the Paratethyan Sea during the Messinian Salinity Crisis. Earth and Planetary Science Letters, 290, 183–191. Kyriazi P, Poulakakis N, Parmakelis A et al. (2008) Mitochondrial DNA reveals the genealogical history of the snake-eyed lizards (Ophisops elegans and O. occidentalis) (Sauria: Lacertidae). Molecular Phylogenetics and Evolution, 49, 795–805. de Leeuw A, Bukowski K, Krijgsman W, Kuiper KF (2010) Age of the Badenian salinity crisis; impact of Miocene climate variability on the circum-Mediterranean region. Geology, 38, 715–718. Lewis AR, Marchant DR, Ashworth AC, Hemming SR, Machlus ML (2007) Major middle Miocene global climate change: evidence from East Antarctica and the Transantarctic Mountains. Geological Society of America Bulletin, 119, 1449–1461. Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451–1452. Liu L, Pearl DK (2007) Species trees from gene trees: reconstructing Bayesian posterior distribution of a species phylog-
© 2013 Blackwell Publishing Ltd
I M P A C T O F M I D - M I O C E N E O N W A R D S C L I M A T E C H A N G E S 1715 eny using estimated gene tree distribution. Systematic Biology, 56, 504–514. Liu L, Pearl DK, Brumfield RT, Edwards SV (2008) Estimating species trees using multiple-allele DNA sequences data. Evolution, 62, 2080–2091. Liu L, Eronen JT, Fortelius M (2009) Significant mid-latitude aridity in the middle Miocene of East Asia. Palaeogeography, Palaeoclimatology, Palaeoecology, 279, 201–206. Losos JB (2008) Phylogenetic niche conservatism, phylogenetic signal and the relationship between phylogenetic relatedness and ecological similarity among species. Ecology Letters, 11, 995–1003. Maridet O, Escarguel G, Costeur L, Mein P, Hugueney M, Legendre S (2007) Small mammal (rodents and lagomorphs) European biogeography from the Late Oligocene to the mid Pliocene. Global Ecology and Biogeography, 16, 529–544. Marmi J, L opez-Giraldez F, Macdonald DW, Calafell F, Zholnerovskaya E, Domingo-Roura X (2006) Mitochondrial DNA reveals a strong phylogeographic structure in the badger across Eurasia. Molecular Ecology, 15, 1007–1020. Melville J, Hale J, Mantziou G, Ananjeva NB, Milto K, Clemann N (2009) Historical biogeography, phylogenetic relationships and intraspecific diversity of agamid lizards in the Central Asian deserts of Kazakhstan and Uzbekistan. Molecular Phylogenetics and Evolution, 53, 99–112. Miao Y, Herrman WuF, Yan X, Yang S (2012) What controlled Mid-Late Miocene long-term aridification in Central Asia?Global cooling or Tibetan Plateau uplift: a review. EarthScience Reviews, 112, 155–172. Millot J, Vachon M (1949) Ordre des Scorpions. Traitede Zoologie, 6, 386–436. Mirshami O, Sari A, Elahi E, Hosseinie S (2010) Phylogenetic relationships of Mesobuthus eupeus (C.L. Koch, 1839) inferred from COI sequences (Scorpiones: Buthidae). Journal of History, 44, 2851–2872. Nylander JAA, Olsson U, Alstr€ om P, Sanmartın I (2008) Accounting for phylogenetic uncertainty in biogeography: a Bayesian approach to dispersal-vicariance analysis of the thrushes (Aves: Turdus). Systematic Biology, 57, 257–268. Pagel M, Meade A (2006) Bayesian analysis of correlated evolution of discrete characters by reversible-jump Markov chain Monte Carlo. The American Naturalist, 167, 808–825. Pagel M, Meade A, Barker D (2004) Bayesian estimation of ancestral character states on phylogenies. Systematic Biology, 53, 673–684. Parmakelis A, Stathi I, Chatzaki M et al. (2006) Evolution of Mesobuthus gibbosus (Brulle, 1832) (Scorpiones: Buthidae) in the northeastern Mediterranean region. Molecular Ecology, 15, 2883–2894. Peel MC, Finlayson BL, McMahon TA (2007) Updated world map of the K€ oppen-Geiger climate classification. Hydrology and Earth System Sciences, 11, 1633–1644. Peterson AT, Soberon J, Sanchez-Cordero V (1999) Conservatism of ecological niches in evolutionary time. Science, 285, 1265–1267. Polis GA (1990) The Biology of Scorpions. Stanford University Press, Stanford. Polis GA, Sisson WD (1990) Life history. In: The Biology of Scorpions (ed. Polis GA). pp. 161–223. Stanford University Press, Stanford. Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. Bioinformatics, 14, 817–818.
© 2013 Blackwell Publishing Ltd
Prinzing A, Durka S, Klotz W, Brandl R (2001) The niche of higher plants: evidence for phylogenetic conservatism. Proceedings of the Royal Society of London. Series B, Biological Sciences, 268, 2383–2389. Rambaut A, Drummond AJ (2007) Tracer v1.4. Available from http://beast.bio.ed.ac.uk/Tracer. Raymo ME (1994) The initiation of Northern Hemisphere glaciation. Annual Review of Earth and Planetary Sciences, 22, 353–383. Remy P, Leroy P (1933) Presence de Scorpions dans la zone subterrestre du littoral marin. Bulletin Mensuel Societe Linneenne de Lyon, 2, 3–42. R€ ogl F (1999) Mediterranean and Paratethys. Fascts and hypotheses of an Oligocene to Miocene paleogeography (short overview). Geologica Carpathica, 50, 339–349. Ronquist F, Huelsenbeck JP (2003) MrBayes 3: bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. Rosenberg NA, Nordborg M (2002) Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms. Nature Review Genetics, 3, 380–390. Schmitt T (2009) Biogeographical and evolutionary importance of the European high mountain systems. Frontiers in Zoology, 6, 9. Shafer ABA, Cullingham CI, C^ ote SD, Coltman DW (2010) Of glaciers and refugia: a decade of study sheds new light on the phylogeography of northwestern North America. Molecular Ecology, 19, 4589–4621. Shi CM, Huang ZS, Wang L et al. (2007) Geographical distribution of two species of Mesobuthus (Scorpiones, Buthidae) in China: insights from systematic field surveys and predictive models. Journal of Arachnology, 35, 215–226. Shimodaira H, Hasegawa M (2001) CONSEL: for assessing the confidence of phylogenetic tree selection. Bioinformatics, 17, 1246–1247. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America, 87, 651–701. Sissom WD (1990) Systematics, Biogeography, and Paleontology. In: The Biology of Scorpions (ed. Polis GA), pp. 64–160. Stanford University Press, Stanford. Sota T, Hayashi M (2007) Comparative historical biogeography of Plateumaris leaf beetles (Coleoptera: Chrysomelidae) in Japan: interplay between fossil and molecular data. Journal of Biogeography, 34, 977–993. Stewart JR, Lister AM, Barnes I, Dalen L (2010) Refugia revisited: individualistic responses of species in space and time. Proceedings of the Royal Society of London. Series B, Biological Sciences, 277, 661–671. Sun D, Zhu M-S, Lourencßo WR (2010) A new species of Mesobuthus (Scorpiones: Buthidae) from Xinjiang, China, with notes on Mesobuthus songi. Journal of Arachnology, 38, 35–43. Sun DH, Bloemendal J, Yi ZY et al. (2011) Palaeomagnetic and palaeoenvironmental study of two parallel sections of late Cenozoic strata in the central Taklimakan Desert: implications for the desertification of the Tarim Basin. Palaeogeography, Palaeoclimatology, Palaeoecology, 300, 1–10. Swofford DL (2003) PAUP*, Phylogenetic Analysis Using Parsimony (*and Other Methods), vol. 4b10. Sinauer Associates, Sunderland, Massachusetts.
1716 C . - M . S H I E T A L . Taberlet P, Fumagalli L, Wust-Saucy AG, Cosson JF (1998) Comparative phylogeography and postglacial colonization routes in Europe. Molecular Ecology, 7, 453–464. Teruel R, Rein JO (2010) A new species of Hottentotta Birula, 1908 from Afghanistan, with a note on the generic position of Mesobuthus songi Lourencßo, Qi et Zhu, 2005 (Scorpiones: Buthidae). Euscorpius, 94, 1–8. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 24, 4876–4882. VoelkerG (2010) Repeatedvicariance of Eurasiansongbird lineages since the Late Miocene. Journal of Biogeography, 37, 1251–1261. Wan SM, Li AC, Clift PD, Jiang HY (2006) Development of the East Asian summer monsoon: evidence from the sediment record in the South China Sea since 8.5 Ma. Palaeogeography, Palaeoclimatology, Palaeoecology, 241, 139–159. Webb CO, Ackerly DD, McPeek MA, Donoghue MJ (2002) Phylogenies and community ecology. Annual Review of Ecology, Evolution, and Systematics, 33, 475–505. Weiss S, Ferrand N (2007) Phylogeography of Southern European Refugia. Springer, Netherlands. Wiens JJ, Graham CH (2005) Niche conservatism: integrating evolution, ecology, and conservation biology. Annual Review of Ecology, Evolution, and Systematics, 36, 519–539. Wu G, Pan B, Gua Q (2002) The maximum glaciation and desert expansion in China during MIS16. Journal of Glaciology and Geocryology, 24, 544–549. Xu Y, Yue L, Li J et al. (2009) An 11-Ma-old red clay sequence on the Eastern Chinese Loess Plateau. Palaeogeography, Palaeoclimatology, Palaeoecology, 284, 383–391. Yin A (2010) Cenozoic tectonic evolution of Asia: a preliminary synthesis. Tectonophysics, 488, 293–325. Yoshikawa S, Kawamura Y, Taruno H (2007) Land bridge formation and proboscidean immigration into the Japanese Islands during the Quaternary. Journal of Geosciences (Osaka City University), 50, 1–6. Yu Y, Harris AJ, He X (2010) S-DIVA (Statistical DispersalVicariance Analysis): a tool for inferring biogeographic histories. Molecular Phylogenetics and Evolution, 56, 848–850. Zachos J, Pagani M, Sloan L, Thomas E, Billups K (2001) Trends, rhythms, and abberations in global climte 65 Ma to Present. Science, 292, 686–693. Zhang RZ (1999) Zoogeography of China. Science Press, Beijing (in Chinese). Zhang DX, Hewitt GM (1996) Nuclear integrations: challenges for mitochondrial DNA markers. Trends in Ecology & Evolution, 11, 247–251. Zhang DX, Hewitt GM (1998) Isolation of animal cellular total DNA. In: Molecular Tools for Screening Biodiversity: Plants and Animals (eds Karp A, Isaac PG, Ingram DS), pp. 5–9. Chapman & Hall, London. Zhang DX, Yan LN, Ji YJ, Hewitt GM, Huang ZS (2009) Unexpected relationships of substructured populations in Chinese Locusta migratoria. BMC Evolutionary Biology, 9, 144. Zink RM, Klicka J, Barber BR (2004) The tempo of avian diversification during the Quaternary. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 359, 215–219.
C.-M.S. is an assistant research professor with a central interest in evolutionary consequences of palaeoenvironmental changes on temperate Asian animals. The work presented here is part of his PhD thesis completed in 2007. L.L. is a PhD student working on scorpion phylogeography. L.W. was an MSc student from 2004 to 2007 in the laboratory. Y.-J.J. is an associate research professor focusing on molecular evolution and application of DNA markers. D.-X.Z.’s research group studies the consequence of past climate changes in China applying evolutionary and phylogeographic approaches to small vertebrates, insects and other invertebrates. Other research topics of the group include population dynamics and geographic interaction of agricultural and forestry pest insects, methods and techniques for retrieving and analysing genetic data from populations and closely related species. C.M.S. and D.X.Z. conceived and designed the project, and analysed data; C.M.S., Y.J.J. and D.X.Z. wrote the manuscript. C.M.S. and L.W. performed much of the field work, C.M.S., Y.J.J. and L.L. executed experiments.
Data accessibility DNA sequences: Genbank accessions KC141981– KC142042, KC165691–KC165744. Phylogenetic data: TreeBASE Study accession no. S13612. Sample locations, Genbank accession numbers of Mesobuthus scorpion and outgroup sequences, Tree data for reconstructing ancestral distributional areas: Dryad doi:10.5061/dryad.9h91 m.
Supporting information Additional supporting information may be found in the online version of this article. Fig. S1 Map showing the relative locations of the six putative ancestral distributional areas adopted in Bayes-DIVA analysis. Fig. S2 The 50% majority consensus trees inferred from nuclear loci PK (left), Spn2 (middle) and STE (right). Table S1 Genbank accession numbers of Mesobuthus scorpions and outgroup sequences. Table S2 Summary statistics of population samples of Mesobuthus martensii and the Chinese lineage of Mesobuthus eupeus. Table S3 Results of Bayes-DIVA analysis.
© 2013 Blackwell Publishing Ltd
