In vitro differentiation of human calvarial suture ... - Wiley Online Library

ORIGINAL ARTICLE Journal of

In Vitro Differentiation of Human Calvarial Suture Derived Cells With and Without Dexamethasone Does Not Induce In Vivo-Like Expression

Cellular Physiology

ANNA K. COUSSENS,1,2* IAN P. HUGHES,1 C. PHILLIP MORRIS,1 BARRY C. POWELL,2,3,4 AND PETER J. ANDERSON2,3,4 1

Cooperative Research Centre for Diagnostics, Institute of Health and Biomedical Innovation, Queensland University of Technology,

Kelvin Grove, QLD, Australia 2

Women’s and Children’s Health Research Institute, North Adelaide, SA, Australia

3

Discipline of Paediatrics, Faculty of Health Sciences, University of Adelaide, Adelaide, SA, Australia

4

Australian Craniofacial Unit, Children’s, Youth and Women’s Health Service, North Adelaide, SA, Australia

Osteogenic supplements are a requirement for osteoblastic cell differentiation during in vitro culture of human calvarial suture-derived cell populations. We investigated the ability of ascorbic acid and b-glycerophosphate with and without the addition of dexamethasone to stimulate in vivo-like osteoblastic differentiation. Cells were isolated from unfused and prematurely fused suture tissue from patients with syndromic and non-syndromic craniosynostosis and cultured in each osteogenic medium for varying lengths of time. The effect of media supplementation was investigated with respect to the ability of cells to form mineralised bone nodules and the expression of five osteodifferentiation marker genes (COL1A1, ALP, BSP, OC and RUNX2), and five genes that are differentially expressed during human premature suture fusion (GPC3, RBP4, C1QTNF3, WIF1 and FGF2). Cells from unfused sutures responded more slowly to osteogenic media but formed comparable bone nodules to fused suture-derived cells after 16 days of culture in either osteogenic media. However, gene expression differed between unfused and fused suture-derived cells, as did expression in each osteogenic medium. When compared to expression in the explant tissue of origin, neither medium induced a level or profile of gene expression similar to that seen in vivo. Overall, our results demonstrate that cells from the same suture that are isolated during different stages of morphogenesis in vivo, despite being de-differentiated to a similar level in vitro, respond uniquely and differently to each osteogenic medium. Further, we suggest that neither cell culture medium recapitulates differentiation via activation of the same genetic cascades as occurs in vivo. J. Cell. Physiol. 218: 183–191, 2009. ß 2008 Wiley-Liss, Inc.

The calvarial suture complex is a heterogeneous tissue comprised of osteoblastic mesenchyme, osteoprogenitor cells, preosteoblasts, osteoblasts and osteocytes, as well as cells from other developmental lineages. Explant culture of osteoblastic cells derived from human calvarial suture tissue provides an in vitro model to study the processes of bone formation which includes progenitor cell proliferation and osteoblast differentiation coupled via an inverse relationship (Owen et al., 1990; Malaval et al., 1999). Furthermore, the culturing of cells derived from unfused and prematurely fused sutures from patients with craniosynostosis facilitates phenotypic and genetic investigations of pathologic processes such as deregulation of proliferation, differentiation, or other processes, such as apoptosis, which may result in this craniofacial developmental abnormality (for review, see Opperman, 2000; Morriss-Kay and Wilkie, 2005). For the results from such experiments to be appropriately translated to the clinical situation, the in vitro system used to investigate these patient-derived cells must therefore relate as close as possible to the in vivo environment from which they were obtained. Osteoblast development is generally subdivided into three stages: (1) proliferation, (2) extracellular matrix maturation, and (3) mineralisation (Owen et al., 1990). In vitro analysis of the different developmental stages is conducted using different culture conditions: proliferation is analysed under minimal medium, while differentiation and matrix mineralisation are analysed using media supplemented with various osteogenic ß 2 0 0 8 W I L E Y - L I S S , I N C .

factors. The capacity of cells to differentiate is evaluated by their ability to deposit a collagenous extracellular matrix (ECM) and to form bone nodules consisting of multiple layers of cells in a mineralised ECM. The stage of differentiation of these cells is estimated through an analysis of temporally expressed differentiation-associated genes such as runt-related transcription factor 2 (RUNX2), collagen type 1 alpha 1 (COL1A1),

B.C. Powell and P.J. Anderson contributed jointly to the direction of the project. Additional supporting information may be found in the online version of this article. Contract grant sponsor: Cooperative Research Centre for Diagnostics. Contract grant sponsor: Friends of the Australian Craniofacial Foundation. Contract grant sponsor: Australian Craniofacial Institute. *Correspondence to: Anna K. Coussens, Women’s and Children’s Health Research Institute, 72 King William Rd, North Adelaide, South Australia 5006, Australia. E-mail: [email protected] Received 10 July 2008; Accepted 7 August 2008 Published online in Wiley InterScience (www.interscience.wiley.com.), 19 September 2008. DOI: 10.1002/jcp.21586

183

184

COUSSENS ET AL.

alkaline phosphatase (ALP), bone sialoprotein (BSP), and osteocalcin (OC) (for review, see Aubin and Triffitt, 2002). RUNX2 and COL1A1 are the earliest markers of immature osteoprogenitor cells, ALP is expressed in mature osteoprogenitors/ preosteoblasts and mature osteoblasts, and is down-regulated when mineralisation is well progressed. BSP is expressed transiently twice, initially in primitive osteoprogenitor cells, and then during osteoprogenitor differentiation after ALP upregulation. Finally, OC is expressed in post-proliferative osteoblasts concomitantly with mineralisation (Candeliere et al., 1999; Liu et al., 2003). As differentiation of osteoprogenitor cells is dependent upon the formation of an ECM (Franceschi and Iyer, 1992), the standard differentiation medium incorporates ascorbic acid, which is a cofactor in collagen matrix synthesis, and organic phosphate (e.g. b-glycerophosphate), to promote mineralisation (Nefussi et al., 1985; Franceschi, 1992). The selection of an appropriate minimal media is also important due to their basal concentrations of b-glycerophosphate (Gerber and Gwynn, 2001). A primitive calvarial-derived osteoprogenitor cell population also exists in culture which only differentiates through the addition of specific inductive stimuli such as glucocorticoids (e.g. dexamethasone), other steroids (e.g. progesterone), or other factors such as bone morphogenetic proteins (Turksen and Aubin, 1991; Hughes et al., 1995; Ishida and Heersche, 1997). The use of these supplements creates an artificial environment which may induce osteoblastic differentiation of particular cell populations, or matrix mineralisation that mimics in vivo bone formation. However, it is unlikely that these processes will occur through the activation of the complex network of pathways that interact in vivo during calvarial osteoblast differentiation (for review, see Rice et al., 2003; Morriss-Kay and Wilkie, 2005). Rather, the phenotype is more likely to be derived through specific activation of a restricted number of pathways not necessarily representative of the in vivo situation. Indeed, it is known that dexamethasone affects FGFR1 gene expression differently in vitro and in vivo (Meisinger et al., 1996). We have previously shown that after explant culture, irrespective of the origin of calvarial explant tissue, whether it be unfused human sutures which are predominantly comprised of mesenchyme and osteoprogenitor cells, or prematurely fused human calvarial sutures which are predominantly comprised of differentiated osteoblasts/osteocytes, these cells immediately lose their in vivo specific expression profile and de-differentiate to a similar level (Coussens et al., 2008). Under minimal medium conditions, the gene expression of these different cell populations essentially stabilises after the first passage and an in vitro specific gene expression profile similar to that of undifferentiated osteoblastic cells is adopted. Thus, the degree to which the commonly used media supplements restore the expression profile of these de-differentiated cells to that seen in vivo is an important question for osteogenic-cell biologists to consider. Here, we have analysed the effect of two osteogenic media, standard differentiation medium (DMEM), which has relatively low b-glycerophosphate levels (Gerber and Gwynn, 2001) containing ascorbic acid and b-glycerophosphate with and without dexamethasone on the phenotype and gene expression profiles of human calvarial bone explant cells isolated from both unfused and prematurely fused calvarial sutures from patients with syndromic and non-syndromic craniosynostosis. We compared the induced gene expression profiles between both cell types and also determined if differential expression profiles which are observed between unfused and fused suture tissues in vivo are maintained in vitro. Finally, as fused sutures represent a fully differentiated tissue type, we also compared the levels of gene expression between JOURNAL OF CELLULAR PHYSIOLOGY

explant tissues and corresponding explant cells grown in osteogenic supplements to determine the ability of osteogenic supplements to induce in vivo-like differentiation. Gene expression was analysed for five common differentiation marker genes. In addition, five genes were analysed that we had previously identified to exhibit high levels of differential expression between unfused and prematurely fused human calvarial tissues, namely glypican 3 (GPC3), retinol binding protein 4 (RBP4), C1q and tumor necrosis factor related protein 3 (C1QTNF3), WNT inhibitory factor 1 (WIF1), and fibroblast growth factor 2 (FGF2) (Coussens et al., 2007). We show that despite stimulating the formation of a mineralised ECM, osteogenic supplements added to minimal medium generally produce a limited modulation of gene expression. Furthermore, the induced expression profiles for each medium were unique and also differed depending on the nature of the tissue from which the de-differentiated cells were isolated (e.g. fused or unfused sutures). Finally, none of these induced profiles were equivalent to those observed in the tissues of origin. Materials and Methods Suture samples

Calvarial suture samples were obtained from three patients undergoing transcranial surgery for craniosynostosis. Consent was provided by all guardians in line with the guidelines received from the Research Ethics Committee of the Children, Youth and Women’s Health Service, Adelaide, South Australia. Patients were previously genotyped for all known mutations in craniosynostosis-causing genes FGFR1–3 and TWIST1 (Anderson et al., 2007). Suture tissue was taken from prematurely fused coronal and lambdoid sutures from a patient (male, 7 months) diagnosed with Apert syndrome (AP) and carrying an FGFR2 Ser252Trp mutation. Samples of unfused coronal and lambdoid sutures were taken from a patient (male, 7 months) with non-syndromic sagittal synostosis (NS) who was negative for FGFR and TWIST1 mutations. Samples were sectioned into two parts on removal. Specimens used for cell culture were placed in Ringers solution for up to 4 h until processed. Specimens used for tissue RNA extraction were stored in RNAlater (Ambion, Austin, TX). To determine if the phenotypic differences observed between the cells derived from non-syndromic and syndromic samples were due to the different aetiologies of craniosynostosis, cells were cultured from unfused and prematurely fused sections of the same lambdoid suture from an additional patient (male, 4 months) with Pfeiffer syndrome (PF) harbouring an FGFR2 splice mutation. Cellular mineralisation was similarly assessed for cells from this patient, however no tissue RNA was obtained to facilitate gene expression comparisons. The suture complex (suture mesenchyme plus 3 mm of bone on either side for unfused sutures, or fused bony ridge plus 3 mm of bone on either side for fused sutures) was dissected from all specimens and the overlying pericranium removed. Suture cell culture

Human calvarial suture cells were obtained by collagenase digestion and explant culture following the method described by de Pollack et al. (1996). Briefly, dissected suture samples were minced into 1 mm fragments and incubated in 0.25% collagenase for 2 h at 378C. Samples were centrifuged and supernatant removed. Following three washes in PBS, samples were plated at 5 bone fragments per well, in 12-well plates, and cultured in minimal medium in a humidified atmosphere of 5% CO2 kept at 378C. Minimal medium consisted of high glucose Dulbecco’s modified essential medium (DMEM, Invitrogen Life Technologies, Gaithersburg, MD) supplemented with L-glutamine (584 mg/L), 10% foetal calf serum, and 1% antibiotics (penicillin 100 IU/ml, streptomycin 100 mg/ml). Upon confluence, cells were plated in

185

OSTEOGENIC MEDIA VERSES IN VIVO EXPRESSION

T25 flasks and labelled P1. Medium was changed every 2 days. Cells were passaged to P3 to obtain sufficient cells before being frozen down and stored in liquid nitrogen. Frozen cells were brought up at P4, plated under minimal medium into 24-well plates at a density of 2 104 cells/well. Samples were plated in triplicate, for each of the three media, for RNA extraction (9 wells per sample per time point) and in duplicate, for each of the three media, for mineralisation assays (6 wells per sample per time point). Passage-four cells were used for all experiments to ensure that any tissue-specific expression was lost, thus enabling the precise delineation of the effect of each supplement on gene expression. No difference in mineralisation potential or gene expression between P1 and P4 cells has been observed previously (Owen et al., 1990; Gerber and Gwynn, 2001; Coussens et al., 2008). At confluence (day 6), medium was replaced with either minimal medium (Min), standard osteogenic medium (OM; minimal medium supplemented with 0.05 mM ascorbic acid and 10 mM b-glycerophosphate), or osteogenic medium supplemented with 100 nM dexamethasone (OM þ D). Media were changed every 3 days. RNA was extracted at day 16 (i.e. 10 days post-supplementation) for all samples and at day 22 (i.e. 16 days post-supplementation) for coronal suture-derived cells. Extracellular matrix and bone nodule assay

Matrix formation and mineralisation was measured at days 7, 16 and 22. Cells were washed in distilled H2O followed by staining for mineralisation using the von Kossa method and then for collagenous extracellular matrix formation using the van Gieson method, followed by fixation in 70% ethanol. Total RNA isolation and cDNA synthesis

Total RNA was isolated from P4 cells, after washing with PBS and homogenisation in 500 ml per well of TRI Reagent (Molecular Research Centre, Inc., Cincinnati, OH), following the manufacturer’s protocol. Total RNA was extracted from tissue samples as previously described (Coussens et al., 2007). Briefly, tissue samples stored in RNAlater were thawed on ice and cut into 30–40 mg pieces. Individual pieces were snap frozen, crushed, and homogenised in 2 ml TRI Reagent using a Mini-Bead-Beater-8 (BioSpec Products, Bartlesville, OK). RNA was isolated from supernatant according to Naderi et al. (2004) using 5 mg/ml linear polyacrylamide (Ambion) and isopropanol precipitation. RNA extracts from the same tissues were combined and 10 mg of each combined RNA was purified and concentrated with a phenol/ chloroform/isoamyl alcohol (25:24:1) extraction. RNA was reverse transcribed into cDNA using SuperScript III (Invitrogen Life Technologies) following the manufacturer’s protocol. In addition to the experimental RNA samples, a calibrator RNA sample which was used to standardise absolute quantitative RT-PCR (qRT-PCR) results, was transcribed into cDNA, column purified (QIAquick PCR purification kit, Qiagen, Clifton Hill, VIC) and quantified by UV spectroscopy. cDNA from all samples was diluted 1/3 and 1/120 with TE (pH 8.0) supplemented with herring sperm DNA to 1 ng/ml (Promega, Annandale, NSW, Australia). The 1/120 dilutions were used for the amplification of the 18S rRNA gene and the 1/3 dilutions were used for the analysis of all other genes.

Real-time absolute qRT-PCR

Absolute quantification was carried out using standard curves generated by 10-fold serial dilution of target amplicon-containing plasmids (pGEM-T Easy Vector, Promega) which covered at least 5 logs of amplicon copy number. Primers were designed over exon boundaries using Primer Express software (Applied Biosystems, Foster City, CA) for COL1A1, ALP, BSP, OC, RUNX2, GPC3, RBP4, C1QTNF3, WIF1, FGF2 and the reference gene 18S rRNA (Table 1). All primers were designed over exon boundaries and amplicons were designed with a melting temperature of 608C. Reactions were carried out using SYBR green (Applied Biosystems) on a Prism 7300 Sequence Detection System (Applied Biosystems). Each tissue-derived cDNA was analysed in triplicate reactions, cDNAs generated from three independent experiments for each cell culture treatment were analysed using one reaction each, and standard curve points were analysed in duplicate reactions. Melting curve analysis was conducted to confirm specific amplicon amplification without genomic DNA contamination. Absolute copy number values calculated from standard curves were normalised to a calibrator cDNA sample (1 ng was used for qRT-PCR) by calculating a ratio of the cycle threshold (Ct) for each experimental-sample 18S to that of the calibrator-sample 18S Ct. qRT-PCR statistical analysis

Triplicate expression results from each cell culture treatment or tissue were combined to give a mean absolute expression SEM. Student’s t-test was used to test for significance between log10 transformed expression levels in tissues or cells grown in osteogenic media and cells grown under minimal media. Significance was taken as P < 0.05 and a Bonferroni multiple comparison correction was applied to P-values. Coronal day 16 minimal medium comparisons were corrected for 4 comparisons (tissue, OM, OM þ D, minimal day 22; P < 0.0127) and coronal day 22 and lambdoid day 16 comparisons were corrected for 3 comparisons (tissue, OM, OM þ D; P < 0.0170). Results Different osteogenic media stimulate unique mineralisation phenotypes

Collagenous ECM and bone nodule formation was assessed in primary cells derived from unfused and fused sutures from three patients: one with non-syndromic (NS) and two with syndromic (AP and PF) craniosynostosis and cultured in three different media following confluence at day 6. At day 7 no difference between media was observed for all cell populations (data not shown). At day 16, mineralised ECM formation was observed for cells grown under both osteogenic media (OM and OM þ D), but not those under minimal medium (Fig. 1). The only exception was fused coronal cells from patient AP which under OM media produced a collagenous ECM but failed to mineralise. Both unfused and fused suture-derived cell populations displayed greater matrix mineralisation in OM þ D compared to OM. However, explant cells from fused sutures had greater ECM and bone nodule formation compared to cells from unfused sutures. Importantly, this difference was also seen

TABLE 1. Primers used for real-time quantitative RT-PCR Primer set

Forward (5(–3()

Reverse (5(–3()

Amplicon (bp)

ALP BSP C1QTNF3 COL1A1 FGF2 GPC3 OC WIF1 18S

CGTGGCTAAGAATGTCATCATGTT TTTCTGCTACAACACTGGGCTATG CTTTGGAGGCAGCTCATCTATTG CGAAGACATCCCACCAATCAC AGAAGAGCGACCCTCACATCA CTTCCTTGCAGAACTGGCCTATG CCACCGAGACACCATGAGAGC CCTCTGTTCAAAGCCTGTCTGC TATCAGATCAAAACCAAC

TGGTGGAGCTGACCCTTGA TTGAGAAAGCACAGGCCATTC CCGGTTTGTGGAGACTCCATG TTGTCGCAGACGCAGATCC GCCAGGGTAACGGTTAGCACAC GGTTGTGAAAGGTGCTTATCTCG CCAGCGATGCAAAGTGCG GTGTCTTCCATGCCAACCTTC CGAAAGTTGATAGGGCAG

90 102 95 99 91 101 69 100 151

JOURNAL OF CELLULAR PHYSIOLOGY

186

COUSSENS ET AL.

the developmental stage of the tissue from which the cells were derived (i.e. suture mesenchyme vs. mineralised bone) rather than to any background genetic differences. It was also noted that at day 16, cells from both unfused and fused lambdoid sutures responded better to media supplements than those from coronal sutures. This is consistent with our previous findings that suture tissues obtained from different anatomical sites in humans display different gene expression profiles (Coussens et al., 2007). Despite the formation of an ECM, unfused coronal suture cells did not form nodules in either media and fused cells only formed mineralised bone nodules in OM þ D (Fig. 1). Cells were therefore cultured for a further 6 days to determine if coronal cells would mineralise in OM. After 22 days in culture (16 days of osteogenic media supplementation), unfused coronal suture cells mineralised in both OM and OM þ D but not to the same extent as unfused lambdoid suture cells. Furthermore, cells from fused coronal sutures remained unmineralised under OM, despite the formation of an extensive collagenous ECM, with mineralisation again only occurring under OM þ D. It would therefore seem that this population of fused suture cells represents the more immature osteoprogenitor-like cell population that requires steroid stimulation for mineralisation, as has been previously described (Turksen and Aubin, 1991). Fig. 1. Von Kossa (mineralisation, black) and van Gieson (ECM, orange) staining of cells derived from unfused and fused coronal (C) and lambdoid (L) sutures from three patients: NS, non-syndromic sagittal synostosis; PF, Pfeiffer syndrome (FGFR2 Exon 9 splice mutation); AP, Apert syndrome (FGFR2 S252W). Cells were grown in minimal medium (Min), standard osteogenic medium (OM; 0.05 mM ascorbic acid and 10 mM b-glycerophosphate) and standard osteogenic medium with 100 nM dexamethasone (OM R D). Unfused suture-derived cells exhibit less mineralisation than fused suture-derived cells at day 16, but show similar matrix mineralisation at day 22, irrespective of patient of origin and aetiology. Lambdoid suture-derived cells respond better to osteogenic supplements than coronal-derived cells. Fused coronal suture-derived cells only mineralised in the presence of dexamethasone, while all other cells mineralised in both osteogenic media at day 22. No mineralisation was observed under minimal medium. Images are sample representations of three individual cultures (see Supplementary Material Fig. 1).

between cells isolated from unfused and fused sections of the same sutures from a Pfeiffer syndrome patient (PF) with an FGFR2 mutation. Therefore, it is likely that the differential response observed in Figure 1 between unfused and fused suture-derived cells are due to cellular differences related to

Each osteogenic media induces unique gene expression profiles

While there was only minimal phenotypic difference between cells grown in the different osteogenic media, the gene expression induced by each media was largely different. Moreover, the induced gene expression profiles differed between cells isolated at different stages of development and from different cranial sites (Table 2). In cells derived from unfused coronal and lambdoid sutures, after 16 days of culture (10 days post-supplementation), both OM and OM þ D media significantly decreased expression of FGF2, OC and WIF1 compared to minimal medium, and there was a further decrease in FGF2 and OC at day 22. There was a significant increase in expression of GPC3 at day 16 which was further increased at day 22. Contrastingly, OM alone increased expression of C1QTNF3 and BSP, while OM þ D medium decreased expression of C1QTNF3, RBP4, and COL1A1 and increased expression of ALP. Interestingly, neither supplement affected the expression of RUNX2 compared to that under minimal medium. For fused suture-derived cells, in general, a greater difference in gene modulation was induced by OM þ D medium compared

TABLE 2. Effect of supplementation on in vitro gene expression compared to minimal medium UNFUSED Mediuma Day RUNX2 COL1 ALP BSP OC FGF2 C1QTNF3 GPC3 RBP4 WIF1

FUSED OM R D

OM d16

d22

d16

d22

U U U

U

U

U

d16 CU

d22 L

d16 CU

U

U U

U

U

U U

OM R D

OM

d22 L U

U C

L

CU

L

CU C

L U

CU

L

U U

C U

U

LU U

U U

U

Unfused cells are from patient NS and fused suture cells are from patient AP. Fused coronal (C) cells did not mineralise and have a different expression profile to fused lambdoid (L) cells. a OM, standard differentiation media; OM þ D, standard differentiation media plus dexamethasone. , increased expression; , decreased expression; ¼, no change in expression.



to standard osteogenic medium (Table 2). Furthermore, fused suture-derived cells from coronal and lambdoid sutures from the same patient had differing responses at day 16 to each medium for 5 genes analysed (RUNX2, C1QTNF3, RBP4, WIF1, OC). The only consistent patterns observed for both media for both cell types was the similar decrease in expression of FGF2 as was seen in unfused sutures and an increase in expression of BSP (at both time points), RUNX2 (day 22) and GPC3 (day 22). This up-regulation of RUNX2 was in contrast to the lack of response of RUNX2 in unfused cells to both osteogenic media. The only other similarity between unfused and fused cells was the consistent difference between media seen for C1QTNF3 expression, with increased expression induced by OM and decreased, or unchanged (fused coronal cells) expression induced by OM þ D. Other differences seen between osteogenic media in fused suture cells were decreased expression of COL1A1 and OC (only in coronal cells at day 16), and increased expression of ALP, WIF1 (only in coronal cells), and OC (only in lambdoid cells at day 16) caused by OM þ D, but not OM. Neither media induced in vivo-like expression levels

We have previously shown that for short-term culture under proliferative conditions in vitro gene expression is severely modulated compared to that in vivo and that after the first passage calvarial suture cells adopt a relatively stable in vitro specific expression profile that is maintained until at least passage 4, irrespective of the fusion state of the explant tissue (Coussens et al., 2008). We therefore wanted to see if common differentiation media stimulate expression back to the levels observed in vivo after long-term culture. Only fused suture tissue-derived cells were compared to their corresponding tissues as fused sutures are mostly comprised of fully differentiated cells unlike unfused suture tissues which are comprised of cells at varying stages of differentiation. In this study, after long-term culture in minimal medium (16 and 22 days) we observed a similar dramatic modulation of gene expression compared to that in vivo (Fig. 2). Most genes were significantly down-regulated under minimal medium at both time points. The exceptions were FGF2 which was significantly up-regulated at both time points and C1QTNF3 which displayed in vivo expression levels in fused coronal cells at day 16 and was significantly up-regulated compared to in vivo levels in fused lambdoid cells at day 16 and in fused coronal cells at day 22. GPC3 also showed expression levels similar to in vivo expression levels after 22 days in culture in minimal medium (Fig. 2). Surprisingly after long-term culture in either osteogenic media a number of key differentiation markers were still expressed at levels markedly different from than that in vivo. For example, while BSP and OC expression was induced towards that seen in vivo by both osteogenic media, expression levels still remained 100- to 1,000-fold less. ALP was only induced to similar in vivo levels by OM þ D, while expression under OM remained up to 10-fold less than in vivo levels and at day 16 was lower than that under minimal media for both coronal and lambdoid suture-derived cells. Another striking observation was that the greater than 100-fold increase in FGF2 observed under minimal media was only slightly reduced by both osteogenic media, remaining about 100-fold higher than in vivo levels. One of the only genes that reached in vivo levels under both media was RUNX2, but this was only achieved at day 22. In vivo differential expression patterns are not maintained in vitro

Although neither osteogenic media was able to recapitulate the level of gene expression observed for fused suture tissue in vivo, JOURNAL OF CELLULAR PHYSIOLOGY

we were interested in investigating whether differential expression patterns observed in vivo between unfused and fused sutures tissues can be recapitulated in vitro using either osteogenic medium. We therefore then compared expression between unfused and fused suture-derived cells grown in both OM and OM þ D for 10 days (day 16), to the differential expression patterns observed for these two cell populations in vivo. Day 16 was chosen as this was the time point in which the greatest phenotypic difference in mineralisation was observed between the two cell populations; little mineralisation being observed in unfused cells compared to fused sutures cells, reflecting the phenotype of their respective tissue of origin. In such comparisons it is the differentiation markers COL1A1, RUNX2, ALP, BSP and OC which are usually taken as key indicators of differences between tissues. However, here we saw minimal difference in the expression of these genes between unfused and fused suture tissues (Fig. 3A). This may reflect the active remodelling nature of the unfused suture tissues which include the actively differentiating osteogenic fronts, compared to the terminally differentiated and less actively remodelling fused suture tissues. Furthermore, in all cases (except COL1A1), the fold change induced by either osteogenic medium was in a direction opposite to that observed in vivo. With respect to the genes which we have identified as being highly differentially expressed during premature suture fusion (Fig. 3B), again neither osteogenic supplement induced in vivo-like differential expression patterns. Only RBP4 and WIF1 had fold changes in the same direction, however, RBP4 was not induced to the same extent and WIF1 showed more than 100-fold greater fold change particularly under OM þ D compared to in vivo fold changes levels. Discussion

Media supplemented with ascorbic acid and b-glycerophosphate with and without dexamethasone are commonly used to induce osteoblast differentiation and mineralised bone nodule formation for cells cultured from rodent and human calvarial tissue (Nefussi et al., 1985; Bellows et al., 1987; Owen et al., 1990; de Pollack et al., 1997; Debiais et al., 1998; Malaval et al., 1999; Igarashi et al., 2004; Ratisoontorn et al., 2005). While this in vitro environment produces a bone-like ECM matrix, in vitro mineralisation studies continue to be undertaken using conditions that are dramatically different from those in vivo. Interaction with other tissue types, such as the dura mater, regulates suture cell fate (Opperman, 2000; Spector et al., 2002), while gradients of factors such as FGF2 within the suture complex regulate the proliferation and differentiation of osteoblastic cells (Iseki et al., 1999). It has also been shown that osteoprogenitors can achieve the same end-point of differentiation via different developmental routes (Madras et al., 2002), suggesting that an in vitro development path could be very different to that which occurs in vivo. Finally, there appear to exist at least two distinct populations of osteoprogenitor cells which, when explanted, respond differently to osteogenic supplements, the more primitive of these only forming a mineralised matrix with the addition of specific inductive stimuli, such as dexamethasone (Turksen and Aubin, 1991). This poses the question whether osteoprogenitor differentiation induced by osteogenic media with and without dexamethasone occurs via the same pathway or whether the different supplements produce the same endpoint via the activation of different genes/pathways? Furthermore, and most importantly, does either media stimulate gene expression and subsequent cellular differentiation as they occur in vivo? We hypothesised that any differences in the nature of differentiation produced by various osteogenic media would be

187

188

COUSSENS ET AL.

Fig. 2. Expression profiles for 10 genes analysed in cells grown from fused suture tissue from Patient AP under minimal medium, standard osteogenic medium, and standard differentiation medium with 100 nM dexamethasone. Compared to in vivo expression (tissue) all genes were generally down-regulated in cells cultured in minimal medium. The exceptions were FGF2 and C1QTNF3 which were up-regulated or unchanged. Neither osteogenic media were able to induce expression to levels seen in tissues. Scale is log10 amplicon copy number per ng cDNA. Significant differential expression (MP < 0.05 Bonferroni corrected; RP < 0.05 uncorrected) is compared to minimal medium at each time point and for minimal medium at day 22 compared to that at day 16. See Materials and Methods Section for corrected P-values.



Fig. 3. Differential expression of 10 genes between fused and unfused sutures tissue samples from coronal and lambdoid sutures and expression in the corresponding cell cultures grown in either osteogenic medium or osteogenic medium with dexamethasone. Unfused suture samples are from patient NS and fused suture samples are from patient AP. Osteodifferentiation marker genes (A) and genes which are known to be highly differentially expressed during premature suture fusion (B) show, in general, a similar decreased expression in both coronal and lambdoid fused sutures tissues compared to unfused sutures tissues. However, both osteogenic media only recapitulated the direction of differential expression, as observed in vivo for COL1A1, OC and RBP4, and even then this was not to a level which reflected that in vivo.

reflected in the gene expression profiles of the cells. We confirmed the differentiation of cells grown in each osteogenic medium by staining for the formation of a collagenous ECM and mineralised bone nodules, generally used as phenotypic markers of mature osteoblasts (Ecarot-Charrier et al., 1983; Bellows et al., 1986; Owen et al., 1990). While both osteogenic media stimulated the formation of a mineralised ECM, in general, the gene expression profiles induced by the two media were different and varied depending on the stage of morphogenesis of the tissue from which the cells originated (Table 2). Furthermore, none of the induced profiles reflected those seen in vivo. Amongst the 10 genes analysed there were only two genes which both osteogenic media consistently modulated: FGF2 and C1QTNF3. FGF2 was dramatically up-regulated in minimal medium compared to that in vivo, with no change in expression over time. Under differentiating conditions, FGF2 expression was reduced, although neither osteogenic medium succeeded in reducing it to in vivo levels. This observation is of particular importance as FGF2 is a common supplement used in in vitro experiments to analyse the effects of FGF signalling on proliferation and differentiation (Debiais et al., 1998; Kalajzic et al., 2003; Choi et al., 2005; Fakhry et al., 2005). Under differentiating conditions, the addition of FGF2 to culture medium would therefore negate the suppression of FGF2 by osteogenic supplements and potentially result in FGF2 levels equal to or greater than observed for minimal media which are already well in excess of that observed in vivo. The other consistent pattern of gene modulation observed for both unfused and fused suture-derived cells was an increase in C1QTNF3 expression by standard osteogenic medium and, in general, a decrease in expression compared to minimal medium with the addition of dexamethasone. The inhibition of C1QTNF3 expression by dexamethasone favours the hypothesis that these two osteogenic supplements promote differentiation via activating different gene expression cascades. Differences in gene expression induced by osteogenic media supplemented with dexamethasone and other osteogenic JOURNAL OF CELLULAR PHYSIOLOGY

factors has been carried out for a variety of human and rodent primary cells (Bellows et al., 1987; Turksen and Aubin, 1991; de Pollack et al., 1997; Ogston et al., 2002; Igarashi et al., 2004; Zhou et al., 2006). However, our study is the first to compare the effects of media supplementation on human calvarial suture derived cells in comparison to the in vivo expression seen for the explant tissue of origin. The cellular heterogeneity of calvarial tissues is an important factor to consider when interpreting observations from in vitro calvarial cell experiments. There is increasing evidence from in vivo and in vitro studies that different sub-populations of osteoblasts exist that have unique proliferative and differentiative capacities and that these may be reflected by their gene expression profiles (Turksen and Aubin, 1991; Liu et al., 1997; Candeliere et al., 2001; Madras et al., 2002). The phenotypic and molecular effects of craniosynostosis-causing mutations are often studied by comparing cultured cells derived from prematurely fused calvarial tissue and unaffected calvarial tissues (unfused sutures or bone) from control patients (Lomri et al., 1998; Yousfi et al., 2002; Guenou et al., 2005; Ratisoontorn et al., 2005). As these tissues are comprised of differing proportions of cells at various stages of osteoblastic differentiation, conclusions from such experiments should be viewed with caution. It is extremely unlikely that the relative proportions of these cells and their physical relationship will be maintained in vitro and thus the two tissue-specific cell populations are liable to respond differently to osteogenic media, irrespective of the existence of an underlying mutation. We analysed the differential effect of supplementation on cells isolated from prematurely fused and unfused calvarial tissues from both the same syndromic craniosynostosis patient and from patients with different aetiologies. Previously, we found no difference in gene expression between suture tissues at the same stage of morphogenesis from patients with different aetiologies of craniosynostosis (Coussens et al., 2007). Here, we observed faster mineralisation of cells derived from fused sutures compared to those from unfused sutures, and this was consistently seen even when they were derived from different

189

190

COUSSENS ET AL.

sections of the same suture. This suggests that the differences observed between unfused and fused suture-derived cells are due to the fused/unfused nature of the tissue of origin rather than genetic backgrounds or underlying pathologic mutations. While both fused and unfused cell populations are de-differentiated to a similar level under short term culture in minimal medium, fused-suture derived cells responded phenotypically more quickly to both osteogenic media. Furthermore, fused suture-derived cells had differing gene expression responses to osteogenic media compared to unfused suture-derived cells. In particular, RUNX2 was up-regulated by both osteogenic media in fused suture-derived cells but not in unfused suture-derived cells. This unresponsive nature of RUNX2 to osteogenic supplements has been noted previously for particular subclones of the MC3T3-E1 mouse calvarial cell line (Wang et al., 1999). Additionally, WIF1, which is up-regulated during premature suture fusion, is significantly up-regulated by osteogenic media in cells from fused sutures and down-regulated in those from unfused sutures (Table 2). Consistent with these observations is the recent suggestion that WIF1 has an essential role in initiating terminal osteoblast differentiation (Vaes et al., 2005). We suggest that the increased responsiveness to osteogenic media of fused suture-derived cells is due to the fact that the majority of the isolated cells were fully differentiated in vivo before being caused to de-differentiate in vitro. Consequently, these cells retain a genetic ‘memory’; that is, genes expressed in vivo retain epigenetic markers of expression such as hypomethylation or a characteristic chromatin structure allowing them to respond more quickly to subsequent activation (for review, see Levenson and Sweatt, 2006; Wu and Sun, 2006). Conversely, cells isolated from unfused sutures may represent a population of cells at various stages of the osteoblast lineage, including a significantly large number of progenitor cells that have yet to be stimulated to differentiate by the in vivo environment. Consequently, it takes longer for unfused suture-derived cells to respond to osteogenic supplements but given sufficient time in culture (e.g. 22 days) there is little phenotypic difference between cells isolated from unfused and prematurely fused sutures (Fig. 1). Although comparison of cells derived from different calvarial tissue sources is useful for studying molecular mechanisms in craniosynostosis, our data highlight the need for caution in interpreting in vitro observations and in reliance on an in vitro mineralisation phenotype as an indicator of an in vivo-like osteoblastic phenotype. In conclusion, our results highlight the variability that exists in in vitro osteoblast differentiation experiments and the limitation of relating in vitro observations to the in vivo situation; that the molecular pathway of osteoblastic differentiation stimulated by dexamethasone is distinct from that stimulated by osteogenic media without dexamethasone; that the same osteogenic medium induces different gene expression in cells isolated from calvarial sutures at different stages of morphogenesis; and that the induced profile and level of gene expression does not directly relate to that seen in vivo. Additional media supplements need to be explored to identify those that can adjust the gene expression profiles of cultured cells to reflect that of cells in comparable in vivo situations. Acknowledgments

We thank Prof DJ David who provided patients included in this study and Dr L Smithers for assistance with cell culture. Literature Cited Anderson PJ, Cox TC, Roscioli T, Elakis G, Smithers L, David DJ, Powell BC. 2007. Somatic FGFR and TWIST mutations are not a common cause of isolated non-syndromic single suture craniosynostosis. J Craniofac Surg 18:312–314.


Aubin JE, Triffitt J. 2002. Mesenchymal stem cells and the osteoblast lineage. In: Bilezikian JP, Raisz LG, Rodan GA, Principles of bone biology editors. Academic Press. New York: pp 59–81. Bellows CG, Aubin JE, Heersche JN. 1987. Physiological concentrations of glucocorticoids stimulate formation of bone nodules from isolated rat calvaria cells in vitro. Endocrinology 121:1985–1992. Bellows CG, Sodek J, Yao KL, Aubin JE. 1986. Phenotypic differences in subclones and longterm cultures of clonally derived rat bone cell lines. J Cell Biochem 31:153–169. Candeliere GA, Liu F, Aubin JE. 2001. Individual osteoblasts in the developing calvaria express different gene repertoires. Bone 28:351–361. Candeliere GA, Rao Y, Floh A, Sandler SD, Aubin JE. 1999. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes. Nucleic Acids Res 27:1079–1083. Choi KY, Kim HJ, Lee MH, Kwon TG, Nah HD, Furuichi T, Komori T, Nam SH, Kim YJ, Ryoo HM. 2005. Runx2 regulates FGF2-induced Bmp2 expression during cranial bone development. Dev Dyn 233:115–121. Coussens AK, Hughes IP, Wilkinson CR, Morris CP, Anderson PJ, Powell BC, van Daal A. 2008. Identification of genes differentially expressed by prematurely fused human sutures using a novel in vivo–in vitro approach. Differentiation 76:531–545. Coussens AK, Wilkinson CR, Hughes IP, Morris CP, van Daal A, Anderson PJ, Powell BC. 2007. Unravelling the molecular control of calvarial suture fusion in children with craniosynostosis. BMC Genomics 8:458. de Pollack C, Arnaud E, Renier D, Marie PJ. 1997. Age-related changes in bone formation, osteoblastic cell proliferation, and differentiation during postnatal osteogenesis in human calvaria. J Cell Biochem 64:128–139. de Pollack C, Renier D, Hott M, Marie PJ. 1996. Increased bone formation and osteoblastic cell phenotype in premature cranial suture ossification (craniosynostosis). J Bone Miner Res 11:401–407. Debiais F, Hott M, Graulet AM, Marie PJ. 1998. The effects of fibroblast growth factor-2 on human neonatal calvaria osteoblastic cells are differentiation stage specific. J Bone Miner Res 13:645–654. Ecarot-Charrier B, Glorieux FH, van der Rest M, Pereira G. 1983. Osteoblasts isolated from mouse calvaria initiate matrix mineralization in culture. J Cell Biol 96:639–643. Fakhry A, Ratisoontorn C, Vedhachalam C, Salhab I, Koyama E, Leboy P, Pacifici M, Kirschner RE, Nah HD. 2005. Effects of FGF-2/-9 in calvarial bone cell cultures: Differentiation stage-dependent mitogenic effect, inverse regulation of BMP-2 and noggin, and enhancement of osteogenic potential. Bone 36:254–266. Franceschi RT. 1992. The role of ascorbic acid in mesenchymal differentiation. Nutr Rev 50:65–70. Franceschi RT, Iyer BS. 1992. Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3-E1 cells. J Bone Miner Res 7:235–246. Gerber I, Gwynn I. 2001. Influence of cell isolation, cell culture density, and cell nutrition on differentiation of rat calvarial osteoblast-like cells in vitro. Eur Cell Mater 2:10–20. Guenou H, Kaabeche K, Mee SL, Marie PJ. 2005. A role for fibroblast growth factor receptor-2 in the altered osteoblast phenotype induced by Twist haploinsufficiency in the Saethre-Chotzen syndrome. Hum Mol Genet 14:1429–1439. Hughes FJ, Collyer J, Stanfield M, Goodman SA. 1995. The effects of bone morphogenetic protein-2, -4, and -6 on differentiation of rat osteoblast cells in vitro. Endocrinology 136:2671–2677. Igarashi M, Kamiya N, Hasegawa M, Kasuya T, Takahashi T, Takagi M. 2004. Inductive effects of dexamethasone on the gene expression of Cbfa1, Osterix and bone matrix proteins during differentiation of cultured primary rat osteoblasts. J Mol Histol 35:3–10. Iseki S, Wilkie AO, Morriss-Kay GM. 1999. Fgfr1 and Fgfr2 have distinct differentiation- and proliferation-related roles in the developing mouse skull vault. Development 126:5611– 5620. Ishida Y, Heersche JN. 1997. Progesterone stimulates proliferation and differentiation of osteoprogenitor cells in bone cell populations derived from adult female but not from adult male rats. Bone 20:17–25. Kalajzic I, Kalajzic Z, Hurley MM, Lichtler AC, Rowe D. 2003. Stage specific inhibition of osteoblast lineage differentiation by FGF2 and noggin. J Cell Biochem 88:1168– 1176. Levenson JM, Sweatt JD. 2006. Epigenetic mechanisms: A common theme in vertebrate and invertebrate memory formation. Cell Mol Life Sci 63:1009–1016. Liu F, Malaval L, Aubin JE. 1997. The mature osteoblast phenotype is characterized by extensive plasticity. Exp Cell Res 232:97–105. Liu F, Malaval L, Aubin JE. 2003. Global amplification polymerase chain reaction reveals novel transitional stages during osteoprogenitor differentiation. J Cell Sci 116:1787–1796. Lomri A, Lemonnier J, Hott M, de Parseval N, Lajeunie E, Munnich A, Renier D, Marie PJ. 1998. Increased calvaria cell differentiation and bone matrix formation induced by fibroblast growth factor receptor 2 mutations in Apert syndrome. J Clin Invest 101:1310– 1317. Madras N, Gibbs AL, Zhou Y, Zandstra PW, Aubin JE. 2002. Modeling stem cell development by retrospective analysis of gene expression profiles in single progenitorderived colonies. Stem Cells 20:230–240. Malaval L, Liu F, Roche P, Aubin JE. 1999. Kinetics of osteoprogenitor proliferation and osteoblast differentiation in vitro. J Cell Biochem 74:616–627. Meisinger C, Zeschnigk C, Grothe C. 1996. In vivo and in vitro effect of glucocorticoids on fibroblast growth factor (FGF)-2 and FGF receptor 1 expression. J Biol Chem 271:16520– 16525. Morriss-Kay GM, Wilkie AO. 2005. Growth of the normal skull vault and its alteration in craniosynostosis: Insights from human genetics and experimental studies. J Anat 207:637– 653. Naderi A, Ahmed AA, Barbosa-Morais NL, Aparicio S, Brenton JD, Caldas C. 2004. Expression microarray reproducibility is improved by optimising purification steps in RNA amplification and labelling. BMC Genomics 5:9. Nefussi JR, Boy-Lefevre ML, Boulekbache H, Forest N. 1985. Mineralization in vitro of matrix formed by osteoblasts isolated by collagenase digestion. Differentiation 29: 160–168. Ogston N, Harrison AJ, Cheung HF, Ashton BA, Hampson G. 2002. Dexamethasone and retinoic acid differentially regulate growth and differentiation in an immortalised human clonal bone marrow stromal cell line with osteoblastic characteristics. Steroids 67:895– 906. Opperman LA. 2000. Cranial sutures as intramembranous bone growth sites. Dev Dyn 219:472–485. Owen TA, Aronow M, Shalhoub V, Barone LM, Wilming L, Tassinari MS, Kennedy MB, Pockwinse S, Lian JB, Stein GS. 1990. Progressive development of the rat osteoblast phenotype in vitro: Reciprocal relationships in expression of genes associated with


osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J Cell Physiol 143:420–430. Ratisoontorn C, Seto ML, Broughton KM, Cunningham ML. 2005. In vitro differentiation profile of osteoblasts derived from patients with Saethre-Chotzen syndrome. Bone 36:627–634. Rice DP, Rice R, Thesleff I. 2003. Molecular mechanisms in calvarial bone and suture development, and their relation to craniosynostosis. Eur J Orthod 25:139–148. Spector JA, Greenwald JA, Warren SM, Bouletreau PJ, Crisera FE, Mehrara BJ, Longaker MT. 2002. Co-culture of osteoblasts with immature dural cells causes an increased rate and degree of osteoblast differentiation. Plast Reconstr Surg 109:631–642; discussion 643– 644. Turksen K, Aubin JE. 1991. Positive and negative immunoselection for enrichment of two classes of osteoprogenitor cells. J Cell Biol 114:373–384.


Vaes B, Dechering K, van Someren E, Hendriks J, van de Ven C, Feijen A, Mummery C, Reinders M, Olijve W, van Zoelen E, Steegenga W. 2005. Microarray analysis reveals expression regulation of Wnt antagonists in differentiating osteoblasts. Bone 36:803–811. Wang D, Christensen K, Chawla K, Xiao G, Krebsbach PH, Franceschi RT. 1999. Isolation and characterization of MC3T3-E1 preosteoblast subclones with distinct in vitro and in vivo differentiation/mineralization potential. J Bone Miner Res 14:893–903. Wu H, Sun YE. 2006. Epigenetic regulation of stem cell differentiation. Pediatr Res 59:21R– 25R. Yousfi M, Lasmoles F, El Ghouzzi V, Marie PJ. 2002. Twist haploinsufficiency in SaethreChotzen syndrome induces calvarial osteoblast apoptosis due to increased TNFalpha expression and caspase-2 activation. Hum Mol Genet 11:359–369. Zhou YS, Liu YS, Tan JG. 2006. Is 1, 25-dihydroxyvitamin D3 an ideal substitute for dexamethasone for inducing osteogenic differentiation of human adipose tissue-derived stromal cells in vitro? Chin Med J (Engl) 119:1278–1286.

191