Mullingan,M.E., Hawley,D.K., Entriken,R. and Mc Clure,W.R. (1984) Nucleic. Acids Res., 12, 789-800. 6. Sarmientos,P., Sylvester,J.E., Contente,S. and Cashel ...
Volume 13 Number 24 1985
Nucleic Acids Research
In vitro transcription initiation of the spinach chloroplast 16S rRNA gene at two tandem promoters
Anne-Marie Lescure*, Cordelia Bisanz-Seyer, H6lne Pesey and Regis Mache
Laboratoire de Biologie Mol&culaire Veggtale, CNRS-UA 571, Universite de Grenoble I, BP 68, F-38402 Saint Martin d'H&res Cedex, France Received 7 October 1985; Revised and Accepted 26 November 1985
ABSTRACT Two potential prokaryotic promoters, P1 and P2, are characterized 164 and 114 bp upstream of the spinach chloroplast 16S rRNA gene. The strengths of these promoters, calculated according to an homology score established for E. coli RNA-polymerase, are identical. Experiments performed with a Taq I-DNA fragment, containing 16 bp of the 16S rDNA and 243 bp upstream of the gene, give evidence that in vitro, E. coli RNA-polymerase starts transcription at these two promoters. ihese results are based on both the size of the transcripts and their nucleotide sequences. A possible regulation by differential control of these dual promoters is suggested. S1 mapping with RNAs extracted either from green or from etiolated spinach plants, indicates that, at these two steps of plastid development, transcription in vivo starts at P1. Surprisingly only P2 appears to be conserved in the homoTog`ousi sequences reported for maize, mustard and Spirodela.
INTRODUCTI ON Plastids in higher plants are submitted to various processes of differentiation according to the development of the plant and its physical environment (1, 2). It is likely that the amount of functional ribosomes necessary for protein synthesis inside the organelles at these various steps, must vary considerably. However, nothing is known about the mechanisms which regulate the biogenesis of ribosomes in higher plant chloroplasts. In order to elucidate the regulation of the rDNA gene transcription in spinach chloroplasts, a cloned fragment of cpDNA (Bgl II- Pvu II) carrying 140 bp of the 16S rRNA gene and 691 bp upstream of this gene has been previously sequenced (3). A Pribnow box (TATATT) and a consensus "minus 35" hexamer (TTGACG) have been detected respectively between position minus 125-120 and minus 151-146 upstream of the beginning of the gene. In vitro transcription studies of the Bgl II-Pvu II fragment led us to suggest that transcription would start at this promoter, 114 bases upstream of the first nucleotide of the gene. Since this work, the search for the existence of other promoters on the © I RL Press Limited, Oxford, England.
8787
Nucleic Acids Research Bgl II-Pvu II fragment allowed to identify other consensus sequences between position minus 181-176, Pribnow box (TTGAAT) and position minus 203-198, "minus 35" hexamer (TTGACT). This new potential promoter, called P1, is located about 50 bp upstream of the transcription initiation point of promoter P2 (4 and Figure 1). The in vitro homology scores of these promoters, for E. coli polymerase, calculated according to Mulligan et al. (5) are 57.4 and 58 for Pl and P2 respectively. These scores are significant since the lower limit for effective promoters is 45. In E. coli (6, 7) the expression of the rrn A operon has been shown to be directed by two tandem promoters, governed by distinct regulatory mechanisms. The existence of dual promoters in the leader sequence of the spinach chloroplast 16S rRNA gene suggests that a related mechanism might be implicated in the expression of the rRNA operon in spinach chloroplasts. The experiments reported in this paper give evidence that in vitro, E.coli RNA-polymerase initiates the transcription at both promoters P1 and P2. Sl mapping with RNAs extracted either from chloroplasts or from etioplasts indicates that in vivo, only the most distal promoter is used, at least at these two steps of the plastid development. MATERIALS AND METHODS Cloning of the Taq I-fragment The physical map of restriction sites of the Bgl II-Pvu II DNA fragment has been previously published (3). This map shows that digestion of this fragment by the restriction enzyme Taq I gives 5 fragments of 343, 36, 70, 258 and 124 bp. The 258-bp fragment contains the first 16 bp of the 16S rDNA and 242-bp upstream, including the two promoters P1 and P2. This subfragment has been subcloned in the Sma I site of the plasmid pHP34 (8) by blunt-end ligation, after filling in the single stranded termini in the presence of the dNTPs and of the Klenow fragment of E. coli DNA-polymerase (9). Transformation of HB 101 E. coli cells and selection of the transformed clones were then performed as previously described (3). The recovery of the Taq I insert from the plasmids was realized by Eco RI digestion, since the Sma sites of pHP34 is *surrounded by two symmetric Eco RI sites (8). Therefore the Taq I fragment recovered by this procedure, is flanked by 7-bp at its two extremities, corresponding to the Eco RI and Sma I sequences of the pHP34 vector. The sequence of the resulting fragment is reported on Figure 1. PLasmids were extracted by the alkaline procedure and then purified in ethidium bromide-CsCl gradient (10). 8788
Nucleic Acids Research In vitro transcription After digestion of the plasmid by Eco RI, the insert was separated by electrophoresis on a 4% polyacrylamide gel and eluted from the gel (10). All the transcription experiments described in this paper were performed with E. coli RNA-polymerase (Boehringer, Mannheim). The reaction mixture contained 50 mM Tris-HCl pH 7.9, 20 mM MgC12 , 50 mM KC1, 2% glycerol, 40 pg per ml acetylated bovine serum albumin, 0.1 mM dithiothreitol, 0.1 mM EDTA and 150 PM cold nucleoside triphosphates. The radioactive nucleotide was added at the concentration and specific activity indicated in the legends. The amounts of DNA and enzyme are also reported in the legends. Transcriptions were allowed to proceed for 30 min at 30° C. Samples were then prepared for analysis by gel electrophoresis as described (11). Analysis of transcripts Radioactive transcripts were analyzed on 8% polyacrylamide gels containing 7 M urea, (10). Transcripts for RNase-Tl (Boehringer, Mannheim) analysis were eluted from polyacrylamide gels by cutting out the appropriate region of the gel, mincing the gel and eluting overnight at 40 C in 0.5 M ammonium acetate, pH 5.2, 1 mM EDTA, 0.1% SDS. Eluted RNAs were precipitated with ethanol, submitted to alkaline or RNase-Tl digestion and analyzed by gel
electrophoresis (12). Isolation of total cellular RNAs Spinach leaves were purchased from local markets and frozen in liquid nitrogen until use. To get etiolated plants, spinachs were grown for 9 days in the dark at 95% relative atmospheric humidity and 220 C. Cotyledons were harvested under green light and frozen. Isolation of total cellular RNAs was as described (13) with the following modifications: after ethanol precipitation, the nucleic acids were dissolved in a small volume of 80 mM Tris-borate, pH 8.3, 1 mM EDTA. After addition of LiCl to a final concentration of 2M, RNAs were precipitated overnight at 0° C. S1 nuclease protection assays Mapping of the start sites of the in vivo transcripts was done by hybridization of RNAs to each separated 5' labeled DNA strand of the Bgl II-Pvu II DNA fragment prepared from pSoc B1O (3). Nuclease S1 mapping was performed as described (14).
8789
Nucleic Acids Research 11-35"
"-10
AATTCCCCGAGCCTGATTATCCCTAAACCCAACGTCAGTTTTTCTATTTTGACTTGCTCCCCCGCCGTGATTGAAT Start P1
"-35"
"-10" Start P2
100
GAGAATGAATAAGAGGCTCGTGGGATTGACGTGAGGGGGTAGGGATGGCTATATTTCTGGGAGCGAACTCCAGGCGAAT -50
ATGAAGCGCATGGATACAAGTTATGCCTTGGAATGAAAGACAATCCGAATCCGCTMTGTCTACGAACAAGGAAGCTATA
Hi
16 S rRNA
H2
H3
AGTAATGCAACTATGAATCTCATGGAGAGTTCGGGG 1-
Figure 1. Nucleotide sequence of the Taq I-DNA fragment according to (3). Boxed region corresponds to the 16S rRNA gene. Proposed starting positions for the two tandem promoters P1 and P2 are indicated by vertical arrows. Horizontal arrows indicate the position of 3 potential hairpin structures Hi, H2 and H3 (21). RESULTS Transcription of the Taq I DNA fragment. To determine more precisely the initiation sites of the transcription of the rDNA, a subfragment resulting from the digestion of the Bgl II-Pvu II fragment (3) by the Taq 1 restriction enzyme has been cloned. This fragment contains 16 bp of the 16S rRNA gene and 243 bp upstream (Figure 1). According to the nucleotide sequence, transcription initiated at the previously identified promoter P2 (starting point at position -114) and terminated at the free end of the DNA fragment, should result in a product of 133 bases. Initiation at promoter P1 would give a full-length transcript of about 190 b. Figure 2A shows the radioactive products obtained with E. coli RNA-polymerase (lane 2): four transcripts migrating at the same level are detected. The upper transcript corresponds to the size of the Taq I- fragment and is probably the end-to-end transcript. Two main products called a and b accumulate. Product b which migrates just below the 150 b fragment of the denatured DNA size marker, might correspond to the runoff transcript initiated at P2. Product a which migrates like the DNA marker 220b fragment, might correspond to the transcript initiated at P1 and terminated at the free end of the Taq I- fragment. The nature of the fourth lower transcript observed on this electrophoresis is not clear. It has been previously shown that transcription at P2 initiated with adenine (3). When y 32 P -ATP is used as radioactive marker, both products a 8790
Nucleic Acids Research
A
B
ORI
___ORI 517
517*
-
298_
298
220 4
220m Wa .....
a-b
150
iOa
4*.a .-b
75
75
1
2
1
2
Figure 2. Gel electrophoresis of the in vitro transcripts of the Taq I32 fragmeint. A. In vitro transcripts obtained with a P-GTP as radioactive substrate. Lanrel,7size markers: 5'-labelled fragments of pBR322 digested by Hinf I. Lane 7 2 pg of E. coli RNA-polymerase and 5 pg of Taq I-DNA were added to 2W-ip of final rieaction volume, including 10 pM a32 P GTP (10 iCi ). Exposure time was 2 h. B. In vitro transcripts obtained with yf2P -ATP as radioactive substrate. Tane -, size markers. Lane 2, 3 pg of Taq I-DNA and 2.5 pg of E. colifT4-6ymerase were addedCtr 25 ul of final volume, including i0T10F3 P -ATP (20 pCi). Exposure time was 12 h.
and b appear labeled, indicating that both products are initiated with adenine (Figure 2B, lane 2). Characterization of the transcripts a and b To specify the origin of initiation of the in vitro transcripts a and b, these products were labeled with y 32 P-ATP, eluted from acrylamide gel and submitted to limited alkaline and RNase Tl digestions. The limited alkaline hydrolysis provides a continuum of fragments derived from breaks at every phosphodiester bond. RNase Tl generates a pattern reflecting cleavages at guanines. The products resulting from the digestions were separated on a sequencing polyacrylamide-urea gel. 8791
Nucleic Acids Research Figure 3. Digestion patterns of transcription pr-ucts a and b by Ti RNase. a 32pATP labeled transcripts a and b were isolated from gels and submitted to alkaline and Tl RNase hydrolysis. In each case, lane 1 contains the product of partial alkaline hydrolysis; lane 2 and lane 3 contain RNA digest with 12and 5.10-l units of Tl RNase/ 5 pg RNA.
~
a
1
38-
ft
w3
43 31
30
.... ..
_4=, sa
26 *_---24 -** 22
2-
21
----32 _
mm_
_
vi w
No
2 0~
_a_m
12~~~~~~~~ 12
i*I
Results are presented on Figure 3. In this electrophoresis, 4 nucleotides migrated off the gel as deduced from other similar experiments. The pattern of digestion of the product a by RNase Ti corresponds exactly to that expected for a transcript initiated on P1 (position -164). The RNase Ti digest pattern of product b shows that this radioactive product is composite: the main RNase Ti digest fits well with that expected for a product initiated on P2 '(position -114). This digest appears to be contaminated by that of
8792
Nucleic Acids Research _0M
510-396- OD 344 'M
4ab
296-
_
220-
_
154-
_-145 t ~~-1540 1 2 3 4 5
300
Figure 4. SI nuclease mapping of 5'-termini of the spinach 16S rRNA in vivo transcripts. Lane 1, 5' end labeled pW 32T2- Hinf I DNA fragments. Lane 2, Si nuclease resistant fragment after hyWridization with RNAs from chloroplasts. Lane 3, SI nuclease resistant fragments after hy5rTiization with RNAs from etioplasts. Lane 4, Bgl II-Pvu II fragment 5' labeled at itTe Pvu II extremity. Lane 5, control: 200 ug of yeast tRNA were hybriWfzed with the 16S rRNA coding strand (Bgl II-Pvu II fast strand) prior to Sl nuclease digestion.
another transcript, mainly observable in the lower part of the pattern. The contaminating digest pattern corresponds to that of the product initiated at P1. SI mapping of in vivo transcripts from spinach chloroplasts and etioplasts To test the hypothesis of the promoters P1 and P2 being under a differential control at different steps of plastid development, RNAs were extracted from green or etiolated spinach leaves. These RNAs were hybridized to the 5' end labeled rRNA coding strand of the Bgl II-Pvu II DNA fragment (3). This DNA fragment contains 140 bp of the 16S rDNA and 691 bp of the upstream sequence. The starting site of P1 and P2 promoters are located respectively 304 and 256 bp upstream of the labeled Pvu II extremity. After digestion with Sl nuclease and electrophoresis, three protected fragments of about 300, 145 and 140 b were detected in both plastid types (Figure 4, lanes 2 and 3). The 140 b protected fragment corresponds to the length of the mature 16S rRNA as previously found (3). The 300 b fragment corresponds to the size of a precursor molecule of the 16S rRNA, initiated at the P1 promoter. The nature of the 145 b protected fragment is not yet clear. These results show that, at these two steps of plastid development, in vivo transcription would start essentially at the P1 promoter. No initiation at P2 is observed. 8793
Nucleic Acids Research DISCUSSION In order to specify rDNA in vitro transcription in spinach chloroplasts, we have used as template a Taq I-DNA fragment which contains 16 bp of the 16S rRNA gene and 243 bp upstream. Two typical prokaryotic promoters P1 and P2, separated by 50 bp, are present in the 5' upstream region of this gene. The in vitro transcription of this fragment by E. coli RNA-polymerase yields two major transcripts called a and b . These transcript. respective sizes fit well with those expected for run off products initiated at P1 and P2. Digestion patterns by RNase Tl of products a and b clearly show that product a is initiated at the P1 promoter (position -164) and that product b is initiated at the P2 promoter (position -114). The presence of dual promoters in the leader region of the spinach 16S rRNA gene and their in vitro recognition by the E. coli RNA polymerase led us to compare the sequence of the upstream region of the spinach rRNA gene with those established for several other plant species. The results of this comparison are summarized in Figure 5. A sequence coding for a tRNAVal GAG is always present about 300 bp upstream of the 16S rRNA gene. In the case of tobacco (15) the transcription would start at a promoter located upstream of this tRNAGAC gene (Pr on Figure 5), resulting in a co-transcription of this
rPi
Pr
%,
t RNA Val
Spinach
-
e
Tobacco
Mustard
a6
Pr
I.,
_T4
m * "I 1
(5S)
^~ ~P
P2
pi
P2
lBS rRNA
(ss)
p'~ 4
Maize
Pr Spi rodela
- ~~~~~~ l-
Figure 5. Schematic representation of the rRNA promoter region in: spinach (3), toicco (15), maize (17, 19), mustard (16) and Spirodela (18). "Encircled P": promoters which have been shown to be utilized in vivo. Numbers within brackets: "homology scores" of the promoter5 calculaftedas in (5). Pr: promoter region located upstream of the tRNAKC gene. 8794
Nucleic Acids Research gene with the 16S rRNA gene. However, the promoters P1 and P2 are present in tobacco, with significant homology scores of 50.3 and 57. Such co-transcripton of the tRNA Val GAG with the 16S rRNA has not been reported in other plants (3, 18, 19). In the sequences reported for mustard (16), maize (17) and Spirodela (18), no typical P1 promoters are detected whereas P2 promoters appear highly conserved. Furthermore it has been shown for maize and Spirodela that in vivo transcription starts at P2. Surprisingly, the SI mapping of the RNA extracted from spinach chloroplasts and etioplasts reported here, indicate that in this material, the transcription in vivo would start only at the P1 promoter. The fact that no transcript initiated at P2 is detected in the SI mapping experiments is intriguing. Our present data show that in the spinach operon both promoters P1 and P2 have the same "homology scores" for E. coli polymerase and are both used in vitro by this enzyme. In our previous work (3) we have shown that a poorly purified fraction of spinach chloroplast RNA-polymerase was able to initiate transcription at the same sites as E. coli polymerase. More recently, Lerbs et al. (20) have reported immunochemical similarities between E. coli and spinach chloroplast RNA-polymerase subunits, strongly suggesting a prokaryotic nature for the spinach chloroplast enzyme. Recent experiments (not shown) indicate that transcription of the Taq I-DNA fragment by the chloroplast RNA-polymerase purified according to Lerbs (20), yields two main products co-migrating with transcripts a and b , indicating that in vitro the homologous enzyme could also initiate transcription at both promoters. Further experiments are necessary to understand why in chloroplasts and etioplasts in vivo initiation does not appear to occur at P2 and to test whether this promoter is functional at other physiological steps.
ACKNOWLEDGEMENTS We thank Dr. J.-F. Briat for his help with initial experiments and for useful suggestions during this work. This work was supported by grants from C.N.R.S. and ATP " Organisation et Expression du Genome '.
*To whom reprint requests should be sent REFERENCES 1. Schnepf,E. (1980) in Results and Problems in Cell Differentiation, Reinert,J. Ed., Springer Verlag, Berlin, Heidelberg, New York, 1-27. 2. Sundqvist,C., Bjorn,L.O. and Virgin,H.I. (1980) Results and Problems in Cell Differentiation, Springer Verlag, Berlin, Heidelberg, New York, pp. 201 -218. 8795
Nucleic Acids Research 3. Briat,J.F., Dron,M., Loiseaux,S. and Mache,R. (1982) Nucleic Acids Res., 10, 6865-6878. 4. MaEhe,R., Briat,J.F., Dorne,A.M., Guitton,C., Lescure,A.M. and Rozier,C. (1985) in Molecular Form and Function of the Plant Genome, van Vloten-Doting,L., Groot,G.S.P. and Hall,T.C. Eds, Plenum Press, New York, 257-266. 5. Mullingan,M.E., Hawley,D.K., Entriken,R. and Mc Clure,W.R. (1984) Nucleic Acids Res., 12, 789-800. 6. Sarmientos,P., Sylvester,J.E., Contente,S. and Cashel,M. (1983) Cell, 32, 1337-1346. 7. Kajitani, M. and Ishihama, A. (1984) J. Biol. Chem., 259, 1951-1957. 8. Prentki,P. and Krisch,H.M. (1982) Gene, 17, 189-196. 9. Wu,R. (1970) J. Mol. Biol., 51, 501-521. 10. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) in Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, New Yo6rkF. 11. Kingston, R.E. and Chamberlin, M.J. (1981) Cell, 27, 523-531. 12. Donis-Keller,H., Maxam,A.M. and Gilbert,W. (1977)Thiicleic Acids Res., 4, 2527-2538. 13. Westhoff,P., Nelson,N., BUnemann,H. and Herrmann,R.G. (1981) Curr. Gen., 4, 109-120. 14. ETnk,G. and Langridge,U. (1984) Nucleic Acids Res. 12, (2), 945-958. 15. Tohdoh,N., Shinozaki,K. and Sugiura,M. (1981) NuclelcAcids Res., 9, 5399-5406. 16. Przybyl,D., Fritzsche,E., Edwards,K., Kossel,H., Falk,H., Thompson,J.A. and Link,G. (1984) Plant Mol. Biol., 3 147-158. 17. Schwarz,Z., Kbssel,H., Schwarz,E. andc*ogorad,L. (1981) Proc. Natl. Acad. Sci. USA, 78, 4748-4752. 18. Keus,R.J.AITDekker,A.F., van Roon,M.A. and Groot,G.S.P. (1983) Nucleic Acids Res., 11, 6465-6474. 19. StrittmatterWF?, Gozdzicka-Jozefiak,A. and Kbssel,H. (1985) EMBO J., 4, 599-604. 20. Lerbs, S., Brautigam, E. and Parthier, B. (1985) The EMBO Journal, 4, 1661-1666. 21. Briat,J.F., Dron,M. and Mache, R. (1983) FEBS Lett., 163, 1-5.
8796