Visual Neuroscience ~2006!, 23, 833–843. Printed in the USA. Copyright © 2006 Cambridge University Press 0952-5238006 $16.00 DOI: 10.10170S0952523806230219
In vivo development of retinal ON-bipolar cell axonal terminals visualized in nyx::MYFP transgenic zebrafish
ERIC H. SCHROETER,1 RACHEL O.L. WONG,1 * and RONALD G. GREGG 2 * 1
Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, Missouri Department of Biochemistry and Molecular Biology, and Center for Genetics and Molecular Medicine, University of Louisville, Louisville, Kentucky 2
(Received February 13, 2006; Accepted May 12, 2006!
Abstract Axonal differentiation of retinal bipolar cells has largely been studied by comparing the morphology of these interneurons in fixed tissue at different ages. To better understand how bipolar axonal terminals develop in vivo, we imaged fluorescently labeled cells in the zebrafish retina using time-lapse confocal and two photon microscopy. Using the upstream regulatory sequences from the nyx gene that encodes nyctalopin, we constructed a transgenic fish in which a subset of retinal bipolar cells express membrane targeted yellow fluorescent protein ~MYFP!. Axonal terminals of these YFP-labeled bipolar cells laminated primarily in the inner half of the inner plexiform layer, suggesting that they are likely to be ON-bipolar cells. Transient expression of MYFP in isolated bipolar cells indicates that two or more subsets of bipolar cells, with one or two terminal boutons, are labeled. Live imaging of YFP-expressing bipolar cells in the nyx::MYFP transgenic fish at different ages showed that initially, filopodial-like structures extend and retract from their primary axonal process throughout the inner plexiform layer ~IPL!. Over time, filopodial exploration becomes concentrated at discrete foci prior to the establishment of large terminal boutons, characteristic of the mature form. This sequence of axonal differentiation suggests that synaptic targeting by bipolar cell axons may involve an early process of trial and error, rather than a process of directed outgrowth and contact. Our observations represent the first in vivo visualization of axonal development of bipolar cells in a vertebrate retina. Keywords: Zebrafish, Bipolar cell, Nyctalopin, Axonal development
Cepko, 2005!, Bhlhb4 ~Bramblett et al., 2004!, Vsx1 ~Chow et al., 2004!, and Irx5 ~Cheng et al., 2005!, affect the differentiation of bipolar cells. Immunolabeling for vesicular glutamate transporters also provided interesting insights into when ON and OFF bipolar cell axonal terminals differentiate ~Sherry et al., 2003!. Ultrastructural studies across many species have revealed when bipolar cells make synapses in the OPL and IPL ~e.g., Olney, 1968; Dubin, 1970; Nishimura & Rakic, 1987; Crooks et al., 1995; Schmitt & Dowling, 1999!. Although much is known about bipolar cell development across many species, how immature bipolar cells target their axons to the appropriate ON or OFF sublamina requires further study. To do so, complete labeling of bipolar axonal terminals across development is necessary. This can be achieved in part, by immunostaining for various proteins specific to bipolar cells, but such an approach generally leads to labeling of populations of cells, which limit resolution of the morphology of individual terminals ~e.g., Miller et al., 1999; Gunhan-Agar et al., 2000, 2002; Kay et al., 2004!. Also the axonal terminals of developing bipolar cells are already laminated at the earliest ages when immunolabeling reveals their morphology, making it difficult to assess bipolar cell structure prior to axonal stratification. Golgi techniques applied to fixed retinas at different ages have, however, enabled comparison of the
Introduction Retinal bipolar interneurons form the essential link between photoreceptors and the output layer of the retina, the ganglion cell layer. Synaptic connections in the inner retina between bipolar cells and the retinal ganglion cells are organized broadly into two major laminae ~reviewed by Wassle, 2004!. Connectivity between retinal cells that are depolarized by increased illumination ~ON-center cells! is restricted approximately to the inner half to two-thirds of the inner plexiform layer ~IPL!. Conversely, connections between retinal neurons that are hyperpolarized by increased illumination ~OFF-center cells! occupy the outer third to half of the IPL. Axon terminals of ON and OFF bipolar cells thus stratify in distinct layers within the IPL. Studies in the past have investigated the molecular and cellular factors regulating bipolar cell development. For example, loss of transcription factors Chx10 ~Burmeister et al., 1996; Rowan &
Address correspondence and reprint requests to: R.O.L. Wong, Department of Biological Structure, University of Washington, Seattle, WA 98125. E-mail:
[email protected] *The authors contributed equally.
833
834 axonal and dendritic morphology of bipolar cells across development ~Quesada et al., 1981; Quesada & Genis-Galvez, 1985!. But, direct comparison of developmental changes of individual cells or within a subtype of bipolar cells is difficult with this approach. While much insight has been gained from studies utilizing fixed tissue, live imaging approaches are required to reveal the dynamic behaviors underlying structural changes resulting in the mature morphology. In recent years, it has become feasible to label and visualize live retinal cells by driving expression of fluorescent proteins using ubiquitous or cell-specific promoters ~reviewed by Lohmann et al., 2005; Morgan et al., 2005; Mumm et al., 2005!. Most recently, bipolar cell development has been studied in retinal explants from transgenic mice in which ON bipolar cells express green fluorescent protein ~GFP! under the control of the mGluR6 promoter ~Morgan et al., 2006!. But, for technical reasons, it is not yet possible to follow the in vivo development of retinal bipolar cells in mammals. Such observations, however, are readily achieved using zebrafish. The combination of rapid embryonic development of the zebrafish retina and the transparency of the embryos permit visualization, and time-lapse imaging of retinal cells marked by fluorescent proteins during the period when their circuitry is forming. For example, using stable transgenic zebrafish lines in which subsets of amacrine cells express various spectral variants of green fluorescent protein, recent studies have determined how amacrine cell neurites ramify within the IPL early in development ~Kay et al., 2004; Godinho et al., 2005!. Here, we explored how retinal bipolar cells in zebrafish obtain their appropriate stratification level in the IPL and form bouton-like terminals with maturation. To label bipolar cells, we searched for a suitable promoter to drive expression of the fluorescent proteins. The nyx gene encodes a small leucine rich proteoglycan that is mutated in human X-linked Congenital Stationary Night Blindness ~CSNB1, Bech-Hansen et al., 2000; Pusch et al., 2000!. Loss of nyctalopin in mice results in loss of the ERG b-wave ~Gregg et al., 2003!, which is derived from signaling through ON bipolar cells. We show here that sequences from the zebrafish nyx promoter are able to drive expression in a subset of ON bipolar cells. We generated a transgenic line in which morphologically defined ON-bipolar cells express membrane targeted yellow fluorescent protein ~MYFP! and used this line, in combination with transient expression experiments, to follow the dynamic development of the axonal terminals of ON-bipolar cells in vivo. Materials and methods Zebrafish ~Danio rerio! were maintained on a 14:10 light dark cycle at 288C. Experimental protocols were approved by the Washington University Institutional Animal Care and Use Committee. Unless otherwise noted, zebrafish homozygous for the roy orbison ~roy! mutation ~Ren et al., 2002! were used for all experiments. Homozygous roy fish have reduced numbers of iridophores, a highly birefringent pigment cell that is responsible for the characteristic iridescence found in fish skin and eyes. Using this more transparent line, it was possible to image much deeper into the retina in vivo and at much older ages ~ⱖ2 weeks or more, post-fertilization!. Generation of the nyctalopin-directed transgene and reporter plasmids In human and mouse, nyctalopin is encoded by the nyx gene, which is composed of 3 exons ~Bech-Hansen et al., 2000; Pusch
E.H. Schroeter et al. et al., 2000; Gregg et al., 2003!, although only exons 2 and 3 contain coding sequence. In silico analyses of zebrafish sequences also identified a gene that generates a predicted cDNA sequence encoding the zebrafish nyctalopin protein ~Accession # XM_692177!. Experimental analyses of cDNA clones from zebrafish indicate the nyx gene in this species also contains 3 exons ~data not shown! encoding a predicted protein of 449 amino acids that shares 51% identity with the mouse protein. A DNA fragment that extended 1482 bp upstream of the 3 ' end of exon 2 ~position 25 in the ORF, Acc # XM_692177! was cloned by PCR ~primers: AC-CGGCAATATTGATGATGA; GAAACGCAAGAAATAAGCATGA! from genomic DNA. This fragment was cloned into a modified pCS2⫹ Gal4/VP16 plasmid ~Koster & Fraser, 2001! resulting in pZNYX-GalVP16. The final construct is shown schematically in Fig. 1A. Intron 1 was included in the hope that providing a splice site would improve in vivo expression of the Gal-VP16 protein. The Gal40VP16 expression system was used to amplify expression levels since nyx mRNA levels in mouse retina are low ~Gregg et al., 2003!. This driver plasmid is also modular, allowing us to use it with reporter plasmids containing the 14X UAS E1b promoter ~Koster & Fraser, 2001!. Three different reporter plasmids expressing different fluorescent proteins were used in the present study. pUASMYFP and pUAS-MCFP express membrane-targeted versions of EYFP and ECFP respectively and were created by cloning the 14XUAS E1b promoter ~Koster & Fraser, 2001! into pEYFP-N1 or pECFP-N1 ~Clontech!, replacing the CMV promoter, along with the first 20 amino acids of the zebrafish GAP43 gene fused to the amino terminus of the FP coding sequence. pUASDsRedExpress was a generous gift from Martin Meyer ~Stanford University! and has the 14XUAS E1b promoter cloned into pDsRed-Express-1 ~Clontech!. Injections Injections of DNA and imaging were performed essentially as described previously ~Lohmann et al., 2005!. Briefly, DNA was diluted in 1X Danieau’s solution ~58 mM NaCl, 7 mM KCl, 0.6 mM Ca~NO3 !2 , 0.4 mM MgSO4 , 5 mM HEPES, pH 6.8! at a final concentration of 10–20 ng0ml. Phenol Red ~;0.1%! was added to aid in visualization of the injection bolus. 1.0 mm capillaries with filament ~WPI! were pulled on a Model P-87 needle puller ~Sutter Inst.!. Tips were trimmed to a diameter of 15–20 mm and backfilled with DNA solution. Eggs were collected from population tanks, beginning at light onset, at intervals of 15–20 min. Eggs in the chorion were oriented cell side up on a silicone tray and injected using a picospritzer. Eggs at the single cell stage were injected with 0.5–2 nl of DNA solution. Injected eggs were maintained in 0.3X Danieau’s in an incubator at 28.58C. At 24 hpf, the medium was replaced with that containing 0.2 mM PTU ~Phenyl-thiourea! to prevent melanin synthesis, and fish were maintained in this medium until all imaging experiments were completed. Generation of TG(nyx::Gal4V16; UAS::MYFP) Q16 Fish were collected and injected as described for imaging. Supercoiled pZNYX-GalVP16 and pUAS-MYFP were co-injected into one cell stage eggs. F0 larvae showing especially high numbers of bipolar cells expressing YFP were reared to adulthood and mated with un-injected roy/roy adults. F1 progeny were screened for YFP expression using an Olympus SZX12 fluorescence stereomicroscope fitted with appropriate excitation and emission filters. One founder was identified that produced offspring with YFP
Zebrafish Bipolar Cell Development
835 low melting temperature agarose on a coverslip. After solidification of the agarose, the coverslip was transferred to a 60 mm culture dish and covered with 0.3⫻ Danieau’s solution containing 0.2 mM PTU and 0.02% tricaine. In some experiments, prior to mounting, embryos were incubated for 1 h in 100 mM “BodipyTexas Red” ~CellTrace Bodipy TR methyl ester, Molecular Probes C34556! and 2% DMSO in 0.3⫻ Danieau’s solution. This lipophilic dye accumulates in the plasma membrane of retina cells and is a useful counter stain for live imaging in zebrafish ~Cooper et al., 2005!. For time-lapse imaging the culture dish was placed in a custom made ITO glass heating system and maintained at 28.58C using a temperature controller ~TC2 bip, Cell Micro Controls!. Laser scanning confocal microscopy was performed using either an Olympus FV1000, FV500 or FV300 upright microscopes. Most images were acquired using an Olympus LUMFL 60X 1.1NA water immersion objective with refractive index correction collar. Multiphoton microscopy was performed using an in-house modified FVX microscope, using a Ti:Sapphire laser ~Tsunami, SpectraPhysics! at 840 nm ~CFP excitation! and 880 nm ~YFP-excitation!. For both confocal and two photon reconstructions, images were typically acquired with XY resolution of 0.1 mm and 0.5 mm Z-resolution for low magnification images. Higher magnification images ~e.g., Fig. 4G!, were typically acquired with XY resolution of 0.06 mm and Z-resolution 0.3 mm. Optical sections typically encompassed a depth of 10 to 50 mm of tissue. Three-dimensional ~3D! analysis of acquired image stacks were performed using Metamorph ~Universal Imaging! and AMIRA ~TGS Inc.!, and final figures were prepared using Photoshop and Illustrator ~Adobe!. To quantify the distribution of axonal tips for each age-group, confocal or two photon image stacks of the bipolar cells in the background of Bodipy-Texas Red labeling were reconstructed in three dimensions using AMIRA. The 3D stacks were rotated until the boundaries of the IPL appeared parallel to each other. The distance of each axonal tip to the inner boundary of the IPL at that location, was measured. Live slice preparation of adult zebrafish retina was performed as described previously ~Miller et al., 1999!. Briefly, retinas were removed from the eye-cup, flattened onto a piece of black filter paper ~Millipore!, placed in zebrafish Ringer’s solution ~Westerfield, 2000!, and slices cut using a razor-blade.
Fig. 1. ~A! Schematic diagram showing the major features of the pZNYXGalVP16 construct. The nyx gene fragment includes exons 1 and 2, and intron 1, and extends 1459 bp upstream of the predicted translation start site. ~B! Bipolar cells transiently expressing YFP under the control of the nyx promoter at 4.5 dpf after injecting nyx::Gal4VP16 and pUAS-MYFP into one-cell stage embryos. ~C! YFP-expressing bipolar cells at 5.5 dpf in the background of TG(Pax6DF4::mCFP) Q01 , revealing the depth at which terminals of these cells stratify in the IPL. ~D! Example of a bistratified bipolar cell in the TG(Pax6DF4::mCFP) 220 background. IPL, inner plexiform layer; OPL, outer plexiform layer.
expression in the retina. These progeny were selected and used to establish the transgenic line TG(nyx::Gal4VP16; UAS::MYFP) Q16 , hereafter referred to as nyx::MYFP. When the F1-F4 generation transgenic fish were crossed to roy/roy fish, transgenic offspring were generated at the expected frequency of ;50%, consistent with co-integration of both plasmids at a single site in the genome.
Immunohistochemistry Fish were euthanized in Tricaine ~2% in 0.3⫻ Danieau’s solution!. Eyes were removed and retinas dissected in 0.1M phosphate buffered saline ~PBS!, pH 7.4, and then fixed in 4% paraformaldehyde in PBS for 2 h. Tissue was equilibrated in 30% sucrose overnight, and embedded and frozen in OCT ~Tissue-Tek!. Cryosections were incubated overnight in rabbit anti-PKC ~AB1610 Chemicon! diluted 1:1000 in PBS containing 5% normal donkey serum ~NDS! and 0.5% Triton X-100. Sections were then rinsed twice for 10 min in PBS and incubated for 1 h with secondary antibody, Alexa Fluor 568 Goat anti-rabbit ~A11036 Molecular Probes! diluted 1:1000 in 5% NDS in PBS. After two 10 min rinses in PBS, sections were cover-slipped with Vectashield mounting medium ~Molecular Probes!. Results
Imaging
Transient expression driven by the nyx promoter is specific to ON bipolar cells
Embryos at various stages were anaesthetized with tricaine ~0.02% in 0.3⫻ Danieau’s solution! and mounted in a drop of molten 1%
Coinjection of pZNYX-GalVP16 and pUAS-MYFP consistently resulted in sparse labeling of cells within the inner nuclear layer of
836
E.H. Schroeter et al.
the retina, with expression starting at around 3 days post fertilization ~dpf !. For a given set of injections, 1–50% of injected embryos showed expression, although the level of expression of YFP in individual cells was highly variable even within the same fish. Ectopic transient expression was also seen in various other tissues although this was infrequent and highly variable between embryos. Careful analyses of the expression of MYFP in the eye showed that there was mosaic expression in cells with the classic morphology of bipolar cells ~Fig. 1B!. Cell bodies were found in the outer half of the INL with dendrites ramifying in the OPL and axons extending into the IPL. The cells showed various axonal morphologies suggesting that more than one subtype of bipolar cell was being labeled ~Fig. 1B!. Several techniques were used to determine if all the YFPexpressing bipolar cells were stratified within the presumptive “ON” or “OFF ” sublayers of the IPL. In the TG(pax6::MCFP) Q01 transgenic fish line, CFP is ubiquitously targeted to cellular membranes, allowing the boundaries of the IPL to be readily discerned ~Godinho et al., 2005!. Eggs from TG(pax6::MCFP) Q01 injected with pZNYX-GalVP16 and pUAS-MYFP confirmed that YFP-expressing bipolar cells had axons that terminated within the lower half of the IPL ~Fig. 1C!. Line TG(pax6::MCFP) Q02 and TG(pax6::MCFP) 220 express membrane-targeted CFP or GFP specifically in amacrine cells that stratify their arbors into two major bands: an inner ~presumed ON! and an outer ~presumed OFF! band ~Kay et al., 2004; Godinho et al.,
2005!. Injection of pZNYX-GalVP16 and either pUAS-MYFP or pUAS-DsRed Express into eggs from TG(pax6::MCFP) Q02 and TG(pax6::MCFP) 220 , respectively, allowed easy separation of the cell types during confocal imaging of live embryos. In all instances observed ~33 cells!, bipolar axon terminals were found proximal to the outer ~OFF! lamina of the GFP-positive amacrine substrata ~example, Fig. 1D!. ON bipolar cells are labeled in nyx::MYFP transgenic fish YFP expression in the transgenic embryos ~Fig. 2A! was first detected in the pineal gland at 2 dpf. Retinal expression began at 2.5–3 dpf, in one or a few cells immediately adjacent to the ventral furrow, with more weakly expressing cells subsequently appearing mainly within the dorsal half of the retina ~Fig. 2B!. The number of cells expressing YFP gradually increased until around 4 dpf, at which time expression is observed throughout the retina ~Fig. 2C!. Examination of isolated retina from adult nyx::MYFP fish showed that YFP expression persists, and remains specific to bipolar cells. The density of YFP expressing cells was highest in central retina and declined towards the retinal periphery ~Fig. 2D!. At higher magnification it was evident that the YFP-expressing cells resembled ON bipolar cells, based both on the location of their soma and the morphology and strata in which their axons ramified ~Fig. 2E!. These cells had somata within the INL, termi-
Fig. 2. ~A! YFP expression in the 7 dpf nyx::MYFP fish. Expression is evident in the eye and in the pineal gland. ~B, C! Confocal sections of live nyx::MYFP embryos at 3 and 14 dpf, respectively. N, nasal; V, ventral. Arrowhead marks location of the ventral furrow. ~D! Distribution of YFP-positive cells across the retina of a 3 month old nyx::MYFP fish imaged in a live slice preparation by confocal microscopy. The region indicated as central retina was located approximately 0.5 mm from the optic nerve head. ~E-G! Immunolabeling of a retinal cross-section from nyx::MYFP fish with ~E! anti-PKC, a marker for ON bipolar cells, ~F! anti-YFP and ~G! both anti-PKC and anti-YFP. Note that not all PKC-positive cells contain YFP. Arrow 1 shows a tip positive for both PKC and YFP. Arrow 2 indicates an example of a tip that was PKC-positive but YFP-negative.
Zebrafish Bipolar Cell Development nal processes or dendrites in the OPL, and axon-like projections that stratified in the inner half of the IPL. Collectively, these features suggested that they were likely to be ON bipolar cells ~Connaughton & Nelson, 2000!. The majority of cells also were positive for both YFP and PKC ~Figs. 2E–G! a marker for ON bipolar cells in zebrafish ~Yazulla & Studholme, 2001!. However, some PKC positive cells were YFP negative, suggesting that the nyx::MYFP expression pattern was mosaic in ON bipolar cells. The inclusion of GAL4/VP16 in nyx::MYFP to amplify expression from the nyx promoter should also allow specific expression of any genetic construct containing a UAS promoter. To test this functionality, eggs from nyx::MYFP positive fish were injected with pUAS::MCFP. As expected, bipolar cells expressing CFP were present in a mosaic pattern typical of transient expression experiments ~Fig. 3A!. Not surprisingly, most CFP-expressing cells co-expressed YFP ~Figs. 3B–D!. However, some cells only expressed CFP ~Figs. 3E–G!. The number of cells expressing only CFP was variable from retina to retina, and they tended to be found
Fig. 3. ~A! Confocal reconstruction of a 7 dpf retina demonstrating in vivo expression of CFP in bipolar cells after injection of pUAS-MCFP into the nyx::MYFP transgenic line. ~B–D! Higher magnification image of a bipolar cell ~arrows! expressing both YFP and CFP. ~E–G! Examples of cells at the peripheral margin that express CFP but not YFP.
837 mostly in the immature peripheral margin of the retina ~5 fish sampled; 32 cells co-expressing CFP and YFP, 12 expressing CFP only!.
Immature ON bipolar cell axonal terminals show exploratory behavior throughout the IPL Both the transgenic line and transient expression of fluorescent reporters driven by the nyx promoter enabled us to visualize and follow the development of ON bipolar cells in vivo. Imaging the nyx::MYFP transgenic line at different days suggests that the axons of ON bipolar cells undergo highly dynamic changes as they form axonal terminals. The earliest detectable expression of MYFP by the nyx promoter reveals that by 3 dpf, bipolar cells have acquired typical bipolar cell morphology ~Fig. 1B!. Axons of these cells have filopodia that appear to originate at one or two specific sites along the axon shaft. To determine if we could find cells at a more immature stage we took advantage of the fact that as the retina grows, newly differentiating cells appear in the peripheral margin. In this region the density of labeled cells in the nyx::MYFP transgenic is very low, permitting us to image individual cells at the very earliest stages of differentiation. In contrast to cells found away from the marginal zone, these bipolar cells had filopodia extending at many sites along the primary axonal process ~Figs. 4A and 4B!. Higher magnification images also showed filopodia have no strong foci or point of origin and are distributed throughout the depth of the IPL ~Figs. 4C and 4D!. A bias in the distribution, however, was apparent at this early stage. The majority ~66 %!, of the terminals were located within the inner half of the IPL and the outer 10% were devoid of processes. ~3 animals, 11 cells; 180 tips.! Comparison of this measured distribution with a normal distribution generated using a random generator ~180 tips, 100,000 iterations; MatLab! suggested that these two distributions were statistically different ~p ⬍ 2.0 ⫻ 10⫺9, t-test!. Also, the measured distribution was skewed towards the inner half of the IPL ~p ⬍ 0.0001!. Although functional separation of the IPL into ON and OFF sublaminae cannot be determined without electrophysiology, especially at 3 dpf, previous studies suggest that the IPL can be roughly divided into inner and outer halves at this early age. Expression of GFP in subpopulations of amacrine cells in the TG(pax6::MGFP) 220 line ~Fig. 1D! is restricted to two major bands as early as 3 dpf ~Kay et al., 2004!. Thus, even at 3 dpf, a larger proportion of tips appeared to be distributed in the presumed ON sublamina. By 6 dpf, the axonal terminals of the YFP-positive bipolar cells were clearly restricted to the inner half of the IPL ~Fig. 4E!. At this age, the density of bipolar cells expressing YFP in the peripheral regions we imaged was too high to allow us to assign filopodia to individual bipolar axons. Therefore we transiently expressed MCFP ~see Fig. 3! to visualize individual bipolar cells at this age, and then measured their axonal filopodial tip distribution ~Fig. 4F!. Statistical analyses confirmed that at 6 dpf the tips were biased towards the inner half of the IPL ~p ⬍ 0.0001!. Low magnification images at 6 dpf also revealed that the major foci along the primary axon appeared as discrete terminals ~Figs. 1C, 1D, 4E!. Many filopodia, however, still extended from these foci and were readily seen at higher magnification ~Fig. 4G!. In addition, serial confocal sections revealed that the central portion of these terminals developed areas devoid of YFP labeling that are not evident in terminals from younger fish ~Supplemental Movie 1!. Note also that at 6 dpf, despite the high density of cell labeling,
838
E.H. Schroeter et al.
Fig. 4. ~A! Morphology of immature YFP-expressing bipolar cells at the retinal periphery at 3 dpf. ~B! Distribution of axonal filopodial tips in the developing IPL at 3 dpf ~3 animals, 11 cells, 180 tips!. ~C, D! Higher magnification view of individual axonal terminals from a 3 dpf nyx::MYFP fish. Filopodia are distributed along the primary axon throughout most of the depth of the IPL. ~E! Confocal reconstruction of bipolar cells in the nyx::MYFP fish at 6 dpf. Axon terminal branches are strongly biased to the lower half of the IPL. Arrows mark gaps in YFP-expression consistent with mosaic expression of the transgene. ~F! Distribution of axonal filopodial tips in the developing IPL at 6 dpf ~2 animals, 22 cells, and 237 tips! ~G! High magnification two-photon reconstruction of axon terminals from a 6 dpf nyx::MYFP fish. Arrow marks a single discrete terminal.
there were occasional gaps ~Fig. 4E, arrows!, consistent with mosaic expression of the transgene, as suggested by immunolabeling with anti-PKC ~Fig. 2E–2G!. Using time-lapse imaging, we next examined the dynamic behavior of the axonal filopodia in individual YFP-expressing cells from 3 to 7 dpf. Eighty cells were recorded at 1–2 h time intervals for up to 12 h at different points during this 5 day period. At 3 dpf ~n ⫽ 25 cells!, axonal filopodia were observed to extend and retract largely from individual foci along the axon shaft ~Fig. 5A!. To capture the highly dynamic nature of the filopodia at this age, we acquired images at 15 min intervals ~Fig. 5B!. At this higher
magnification, the irregular shape of the immature axonal terminal from which filopodia extended and retracted is apparent. At 5 dpf ~n ⫽ 38 cells!, the exploratory behavior of the axonal filopodia is still evident ~Fig. 5C!. This particular cell also demonstrates that although changes occurred largely at the terminal, ectopic filopodia occasionally extended and retracted from the axonal shaft outside of the terminal structure ~Fig. 5C, arrows!. These rapid structural changes were detected even at 7 dpf ~n ⫽ 17 cells; Supplemental Movie 2!, an age at which the developing fish are free swimming and able to actively hunt live food, and well past when the retina is first responsive to light at 3 dpf ~Branchek, 1984; Easter & Nicola,
Supplemental Movies 1 and 2 Supplemental Movies 1 and 2 can be viewed in this issue of VNS by visiting journals.cambridge.org Supplemental Movie 1: High magnification serial confocal sections ~0.5 mm steps! through the IPL of a 6 dpf nyx::MYFP fish. Axon terminals display many filopodia but contain a core within which YFP is absent. Scale bar ⫽ 5 mm. Supplemental Movie 2: Time-lapse series of an individual axon terminal from 7 dpf nyx::MYFP fish ~15 minute intervals!, showing rapid extension and retraction of filopodia in an immature terminal. Scale bar ⫽ 5 µm.
Zebrafish Bipolar Cell Development
839
Fig. 5. Time-lapse recording of individual bipolar cells showing dynamic changes in morphology ~A! Cell at 3 dpf from fish injected with pZNYX-GalVP16 and pUAS-MYFP and imaged at 2 hour intervals. Arrows point to two foci from which filopodia extended and retracted. ~B! Axon terminal imaged every 15 minutes from a 3 dpf nyx::MYFP transgenic fish. ~C! Cell expressing YFP at 5.5 dpf from a TG(Pax6DF4::mCFP) Q01 fish injected with pZNYX-GalVP16 and pUAS-MYFP and imaged at 2 hour intervals. Arrow indicates extension of a filopodia towards the outer half of the IPL. YFP, yellow; CFP blue.
1996!. Time-lapse imaging of populations of cells in the nyx::MYFP transgenic performed at 3 and 7 dpf ~data not shown! shows that the motility and exploratory behavior of the individual cells imaged is typical of all labeled axon terminals. Axonal bouton-like structures emerge as filopodial activity diminishes Axonal terminals at 3 to 7 dpf showed a very different structure to that of bipolar cells in adults. In mature animals, immunostaining with anti-PKC revealed large bouton-like structures at the axon terminals, which were localized to the inner half of the IPL ~Fig. 6A!. These large boutons are a characteristic feature of ON bipolar cell axonal terminals in both zebrafish and goldfish ~Sherry & Yazulla, 1993; Connaughton et al., 2004!. Individual axon terminals with distinct bouton-like endings were detectable in
central retina as early as 7 dpf, but they were difficult to visualize with confocal microscopy because of the depth of tissue. To overcome this limitation we used two-photon microscopy, to image central retina in vivo up to 14 dpf. At 14 dpf, mature bouton-like axonal terminals were readily apparent throughout most of the retina, although terminals with irregular shapes and filopodial extensions were still present ~Fig. 6B!. To capture the developmental time course of bouton formation, we used time-lapse recordings of individual cells at 7 dpf. By imaging at 15 min intervals, we observed the transition from a structure with many filopodia to the smoother mature terminal bouton ~Fig. 6C!. Thus, the foci along axonal shafts of immature bipolar cells are likely to represent the sites where terminal boutons are established upon maturation. In addition, the boutons had a “hol low” appearance, similar to that observed from PKC immunostaining ~Fig. 6A!. This hollow appearance may indicate that the
840
E.H. Schroeter et al.
Fig. 6. ~A! PKC-immunolabeling of bipolar cells in a fixed section from a 28 dpf zebrafish showing the mature ball-like endings of the axons characteristic of this cell type. ~B! Two-photon image of bipolar axon terminals of a 14 dpf nyx::MYFP fish in vivo, demonstrating ~b! the presence of ball-like endings and ~f ! terminals that have not yet attained this morphology. ~C! Time-lapse confocal imaging of an axon terminal ~7 dpf ! in the nyx::MYFP fish acquired every 15 min from a 7 dpf axon terminal showing the transition of a terminal with many filopodia to the mature bouton like structure. ~D! Summary of morphological stages of ON bipolar cell axonal differentiation in the zebrafish retina.
cytoplasm is increasing in volume at the terminal with age, because YFP is targeted to the plasma-membrane. Fig. 6D illustrates the sequence of morphological changes that occur as ON bipolar cell axonal terminals develop in vivo. Our recordings suggest that initially, axonal filopodia are distrib-
uted throughout the IPL, although there is a bias to the inner half of the IPL ~Fig. 4!. With ensuing development, filopodia become more restricted to discrete foci from which they extend and retract, until eventually filopodia are lost and bouton-like structures are established.
Zebrafish Bipolar Cell Development Discussion Nyctalopin promoter sequences drive expression in subsets of retinal bipolar cells Injection of two plasmids, pZNYX-GalVP16 and pUAS-MYFP into one-cell stage zebrafish embryos resulted in the generation of a stable transgenic line in which YFP is expressed specifically by a subset of retinal bipolar interneurons. This result suggests that the two plasmids may have co-integrated into the same site in the genome. To our knowledge, the nyx::MYFP fish is the first example of a transgenic fish created by injecting two separate DNA elements to form a functional transgene. Although transgenic lines expressing Gal4 have been established ~Scheer et al., 2001!, this fish represents the first reported line using a Gal40VP16 fusion protein as a transcriptional activator. Inclusion of Gal40VP16 in this line, also allows it to be used to express any gene of interest in retinal bipolar cells by using a separate UAS promoter construct ~Koster & Fraser, 2001!. In addition, the pUAS-MYFP cassette used in generating the transgenic may make nyx::MYFP useful as a MYFP reporter line. The expression pattern of nyctalopin in the retina has been inferred from in situ hybridization studies and from the physiological defects associated with its absence in mice ~Gregg et al., 2003! and humans ~Bech-Hansen et al., 2000; Pusch et al., 2000!, where it is thought to be involved in visual processing by ON bipolar cells. In addition to expression in ON bipolar cells, expression of nyctalopin has been described in ganglion cells and the outer nuclear layers, as well as in several non-retinal tissues. However, our studies using the entire intergenic region upstream of the nyx gene plus intron 1 and part of exon 2 showed expression restricted to ON bipolar cells in the retina. In addition, the transgenic line expresses MYFP in the pineal. The role of nyctalopin in this tissue is unknown, but it may be associated with ribbon synapses as is thought to be the case at photoreceptor synapses. Our studies found that in the retina, the zebrafish nyx promoter drove expression of MYFP only in morphologically classified ON bipolar cells, even in transiently expressing embryos, consistent with the possibility that nyctalopin is present in ON bipolar cells. The lack of YFP expression in other retinal cells, however, does not preclude the possibility that nyctalopin could be expressed more extensively than in bipolar cells. The mosaic labeling patterns when nyx::MYFP was transiently expressed allowed us to identify multiple types of ON bipolar cells. Comparison of the morphology of the YFP-expressing bipolar cells with those described in previous reports using intracellular fills ~Connaughton et al., 2004!, suggests that at least two subclasses of bipolar cells with axonal terminals stratifying in sublaminae S3 to S6 express YFP under the nyx promoter. Some YFP-positive bipolar cells were clearly monostratified whereas others possessed at least two terminals. When imaged under conditions that allowed determination of position within the IPL, the outer terminal of bistratified YFP-labeled bipolar cells was located above the middle of the IPL where the glycinergic amacrine plexus resides ~Connaughton et al., 1999!. This cell type most closely resembles the BON-s305 cell ~Connaughton et al., 2004!, which has an ON type physiology with a glutamate activated chloride conductance, but is not sensitive to 2-amino-4-phosphonobutyric acid ~Connaughton & Nelson, 2000!. Bipolar cells with similar morphology in the closely related species giant danio ~Danio aequipinnatus! display ON, OFF or both ~ON0OFF! responses ~Wong et al., 2005; Wong & Dowling, 2005!. However, further charac-
841 terization of the bipolar cell types labeled in the nyx::MYFP transgenic fish will require combined physiological and anatomical analyses. In vivo maturation of ON bipolar cell axonal terminals Previous studies of the morphological development of bipolar cells have relied on immunolabeling methods or dye-filling approaches to visualize cells ~Connaughton & Nelson, 2000; Connaughton et al., 2004!. However, common markers of bipolar cells often label these interneurons late in development, when they have already developed a stratified terminal arbor in the IPL. More recently, genetic approaches have enabled bipolar cells in the mouse retina to be labeled and their development in retinal culture monitored prior to the appearance of a stratified axonal terminal ~Morgan et al., 2006!. Here, we have created transgenic zebrafish that allowed us to perform the first in vivo visualization of bipolar cell axonal development in a vertebrate retina. Early in development axon terminals of ON bipolar cells generate filopodial-like structures that transiently explore the entire depth of the IPL. However, our analyses indicate that at all ages studied ~3–14 dpf !, the distribution of axonal filopodia is biased towards the inner half of the IPL. Therefore, while ON bipolar cell axons do not immediately target their appropriate sublaminae, the bias in filopodia distribution indicates that there may be signals important for their eventual targeting to the appropriate synaptic sublaminae and cellular partners. This finding is consistent with recent observations of ON bipolar cell development in the Grm6GFP mouse retina ~Morgan et al., 2006!. In these transgenic mice the axonal terminals of ON bipolar cells are observed to originate from epithelial-like processes that contact the internal limiting membrane. Observations of Golgi stained retina also suggest that this interesting mechanism may also be occurring in rat ~Morest, 1970! and chick ~Quesada et al., 1981; Quesada & Genis-Galvez, 1985!. Whether bipolar cells in zebrafish show a similar morphological pattern at early stages of development could not be determined since YFP expression in the nyx::MYFP transgenic fish does not occur early enough to allow live imaging prior to the appearance of an axonal process. Thus, in zebrafish, it remains possible that ON bipolar cells, like those of the mouse, may also undergo a stage of development whereby their primary axonal process extends beyond the IPL. Whether Off bipolar cells follow a similar sequence of axonal differentiation remains to be elucidated. The first visually-evoked responses in zebrafish are detected at 3 dpf ~Branchek, 1984; Easter & Nicola, 1996!, corresponding to the formation of the first bipolar cell ribbon synapses ~Schmitt & Dowling, 1999!. Like dendritic filopodia ~Ziv & Smith, 1996; Jontes & Smith, 2000; Wong & Wong, 2000!, the exploratory behavior of zebrafish bipolar cell axonal filopodia at this age may serve to increase the likelihood of contact with their postsynaptic targets. One of our more surprising observations was that bipolar cells continue to show considerable filopodial activity even at 14 dpf, suggesting that synaptogenesis may not yet be completed even though the overall structure of the retina appears adult-like. It is currently unclear what mechanisms are responsible for organizing the stratification and morphological arrangement of the bipolar cell axonal terminals during development. Studies in mammals show that depletion of retinal ganglion cells as a consequence of optic nerve section does not prevent the formation of ON and OFF bipolar axonal terminals ~Gunhan-Agar et al., 2000!. Likewise, ablation of cholinergic amacrine cells in mammals does not perturb bipolar axonal stratification ~Reese et al., 2001; Gunhan-
842 Agar et al., 2002!. However, in the lakritz zebrafish mutant in which ganglion cells are absent, regions of perturbed amacrine cell lamination coincides with abnormalities in bipolar cell axonal stratification ~Kay et al., 2004!. It will be interesting in the future to utilize the nyx::MYFP line for identifying other mutants in which bipolar axonal stratification is perturbed. Finally, in contrast to mammals, the axonal terminals of fish ON bipolar cells form large axonal boutons at maturity. Our in vivo imaging observations suggest that this terminal structure in teleosts arises only after a period of filopodial exploration located at discrete levels within the IPL. Although our observations suggest that axonal filopodia may play a developmental role, these thin processes may also have other functions. Specifically, filopodia extend from the giant terminals of goldfish ON bipolar axons in response to dark adaptation ~Yazulla & Studholme, 1992; Behrens & Wagner, 1996; Job & Lagnado, 1998!. The nyx::MYFP transgenic line will enable future investigations into how zebrafish bipolar cell terminals respond dynamically to changes in illumination. In addition, it will be possible to monitor in vivo how bipolar cell morphology is altered in response to perturbations occurring during development. Acknowledgments We thank Amy Koerber for providing assistance with construction and maintenance of fish lines and Josh Morgan for help with Monte Carlo analysis. This work was supported by a Keck foundation fellowship to E.H.S., by NIH grant EY14358 to R.O.W. and by NIH grant EY12354 to R.G.G.
References Bech-Hansen, N.T., Naylor, M.J., Maybaum, T.A., Sparkes, R.L., Koop, B., Birch, D.G., Bergen, A.A., Prinsen, C.F., Polomeno, R.C., Gal, A., Drack, A.V., Musarella, M.A., Jacobson, S.G., Young, R.S. & Weleber, R.G. ~2000!. Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness. Nature Genetics 26, 319–323. Behrens, U.D. & Wagner, H.J. ~1996!. Adaptation-dependent changes of bipolar cell terminals in fish retina: Effects on overall morphology and spinule formation in Ma and Mb cells. Vision Research 36, 3901–3911. Bramblett, D.E., Pennesi, M.E., Wu, S.M. & Tsai, M.J. ~2004!. The transcription factor Bhlhb4 is required for rod bipolar cell maturation. Neuron 43, 779–793. Branchek, T. ~1984!. The development of photoreceptors in the zebrafish, brachydanio rerio. II. Function. Journal of Comparative Neurology 224, 116–122. Burmeister, M., Novak, J., Liang, M.Y., Basu, S., Ploder, L., Hawes, N.L., Vidgen, D., Hoover, F., Goldman, D., Kalnins, V.I., Roderick, T.H., Taylor, B.A., Hankin, M.H. & McInnes, R.R. ~1996!. Ocular retardation mouse caused by Chx10 homeobox null allele: Impaired retinal progenitor proliferation and bipolar cell differentiation. Nature Genetics 12, 376–384. Cheng, C.W., Chow, R.L., Lebel, M., Sakuma, R., Cheung, H.O., Thanabalasingham, V., Zhang, X., Bruneau, B.G., Birch, D.G., Hui, C.C., McInnes, R.R. & Cheng, S.H. ~2005!. The Iroquois homeobox gene, Irx5, is required for retinal cone bipolar cell development. Journal of Developmental Biology 287, 48– 60. Chow, R.L., Volgyi, B., Szilard, R.K., Ng, D., McKerlie, C., Bloomfield, S.A., Birch, D.G. & McInnes, R.R. ~2004!. Control of late off-center cone bipolar cell differentiation and visual signaling by the homeobox gene Vsx1. Proceedings of the National Academy of Sciences 101, 1754–1759. Connaughton, V.P., Behar, T.N., Liu, W.L. & Massey, S.C. ~1999!. Immunocytochemical localization of excitatory and inhibitory neurotransmitters in the zebrafish retina. Visual Neuroscience 16, 483– 490. Connaughton, V.P., Graham, D. & Nelson, R. ~2004!. Identification and morphological classification of horizontal, bipolar, and amacrine
E.H. Schroeter et al. cells within the zebrafish retina. Journal of Comparative Neurology 477, 371–385. Connaughton, V.P. & Nelson, R. ~2000!. Axonal stratification patterns and glutamate-gated conductance mechanisms in zebrafish retinal bipolar cells. Journal of Physiology 524, 135–146. Cooper, M.S., Szeto, D.P., Sommers-Herivel, G., Topczewski, J., Solnica-Krezel, L., Kang, H.C., Johnson, I. & Kimelman, D. ~2005!. Visualizing morphogenesis in transgenic zebrafish embryos using BODIPY TR methyl ester dye as a vital counterstain for GFP. Developmental Dynamics 232, 359–368. Crooks, J., Okada, M. & Hendrickson, A.E. ~1995!. Quantitative analysis of synaptogenesis in the inner plexiform layer of macaque monkey fovea. Journal of Comparative Neurology 360, 349–362. Dubin, M.W. ~1970!. The inner plexiform layer of the vertebrate retina: a quantitative and comparative electron microscopic analysis. Journal of Comparative Neurology 140, 479–505. Easter, S.S., Jr. & Nicola, G.N. ~1996!. The development of vision in the zebrafish ~Danio rerio!. International Journal of Developmental Biology 180, 646– 663. Godinho, L., Mumm, J.S., Williams, P.R., Schroeter, E.H., Koerber, A., Park, S.W., Leach, S.D. & Wong, R.O.L. ~2005!. Targeting of amacrine cell neurites to appropriate synaptic laminae in the developing zebrafish retina. Development 132, 5069–5079. Gregg, R.G., Mukhopadhyay, S., Candille, S.I., Ball, S.L., Pardue, M.T., McCall, M.A. & Peachey, N.S. ~2003!. Identification of the gene and the mutation responsible for the mouse nob phenotype. Investigative Ophthalmology and Visual Science 44, 378–384. Gunhan-Agar, E., Choudary, P.V., Landerholm, T.E. & Chalupa, L.M. ~2002!. Depletion of cholinergic amacrine cells by a novel immunotoxin does not perturb the formation of segregated on and off cone bipolar cell projections. Journal of Neuroscience 22, 2265–2273. Gunhan-Agar, E., Kahn, D. & Chalupa, L.M. ~2000!. Segregation of on and off bipolar cell axonal arbors in the absence of retinal ganglion cells. Journal of Neuroscience 20, 306–314. Job, C. & Lagnado, L. ~1998!. Calcium and protein kinase C regulate the actin cytoskeleton in the synaptic terminal of retinal bipolar cells. Journal of Cell Biology 143, 1661–1672. Jontes, J.D. & Smith, S.J. ~2000!. Filopodia, spines, and the generation of synaptic diversity. Neuron 27, 11–14. Kay, J.N., Roeser, T., Mumm, J.S., Godinho, L., Mrejeru, A., Wong, R.O.L. & Baier, H. ~2004!. Transient requirement for ganglion cells during assembly of retinal synaptic layers. Development 131, 1331–1342. Koster, R.W. & Fraser, S.E. ~2001!. Tracing transgene expression in living zebrafish embryos. International Journal of Developmental Biology 233, 329–346. Lohmann, C., Mumm, J.S., Morgan, J., Godinho, L., Schroeter, E.H., Stacy, R., Wong, W.T., Oakley, D. & Wong, R.O.L. ~2005!. Imaging the developing retina. In Imaging in Neuroscience and Development. eds. Yuste, R. & Konnerth, A., pp. 171–183. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Miller, E.D., Tran, M.N., Wong, G.K., Oakley, D.M. & Wong, R.O. ~1999!. Morphological differentiation of bipolar cells in the ferret retina. Visual Neuroscience 16, 1133–1144. Morest, D.K. ~1970!. The pattern of neurogenesis in the retina of the rat. Zeitschrift F ür Anatomie Und Entwicklungsgeschichte 131, 45– 67. Morgan, J., Huckfeldt, R. & Wong, R.O. ~2005!. Imaging techniques in retinal research. Experimental Eye Research 80, 297–306. Morgan, J.L., Dhingra, A., Vardi, N. & Wong, R.O. ~2006!. Axons and dendrites originate from neuroepithelial-like processes of retinal bipolar cells. Nature Neuroscience 9, 85–92. Mumm, J.S., Godinho, L., Morgan, J.L., Oakley, D.M., Schroeter, E.H. & Wong, R.O. ~2005!. Laminar circuit formation in the vertebrate retina. Progress in Brain Research 147, 155–169. Nishimura, Y. & Rakic, P. ~1987!. Development of the rhesus monkey retina: II. A three-dimensional analysis of the sequences of synaptic combinations in the inner plexiform layer. Journal of Comparative Neurology 262, 290–313. Olney, J.W. ~1968!. Centripetal sequence of appearance of receptor-bipolar synaptic structures in developing mouse retina. Nature 218, 281–282. Pusch, C.M., Zeitz, C., Brandau, O., Pesch, K., Achatz, H., Feil, S., Scharfe, C., Maurer, J., Jacobi, F.K., Pinckers, A., Andreasson, S., Hardcastle, A., Wissinger, B., Berger, W. & Meindl, A. ~2000!. The complete form of X-linked congenital stationary night blindness is caused by mutations in a gene encoding a leucine-rich repeat protein. Nature Genetics 26, 324–327.
Zebrafish Bipolar Cell Development Quesada, A. & Genis-Galvez, J.M. ~1985!. Morphological and structural study of Landolt’s club in the chick retina. Journal of Morphology 184, 205–214. Quesada, A., Prada, F., Armengol, J.A. & Genis-Galvez, J.M. ~1981!. Early morphological differentiation of the bipolar neurons in the chick retina. A Golgi analysis. Anatomia Histologia Embryologia 10, 328–341. Reese, B.E., Raven, M.A., Giannotti, K.A. & Johnson, P.T. ~2001!. Development of cholinergic amacrine cell stratification in the ferret retina and the effects of early excitotoxic ablation. Visual Neuroscience 18, 559–570. Ren, J.Q., McCarthy, W.R., Zhang, H., Adolph, A.R. & Li, L. ~2002!. Behavioral visual responses of wild-type and hypopigmented zebrafish. Visional Research 42, 293–299. Rowan, S. & Cepko, C.L. ~2005!. A POU factor binding site upstream of the Chx10 homeobox gene is required for Chx10 expression in subsets of retinal progenitor cells and bipolar cells. Developmental Biology 281, 240–255. Scheer, N., Groth, A., Hans, S. & Campos-Ortega, J.A. ~2001!. An instructive function for Notch in promoting gliogenesis in the zebrafish retina. Development 128, 1099–1107. Schmitt, E.A. & Dowling, J.E. ~1999!. Early retinal development in the zebrafish, Danio rerio: Light and electron microscopic analyses. Journal of Comparative Neurology 404, 515–536. Sherry, D.M., Wang, M.M., Bates, J. & Frishman, L.J. ~2003!. Expression of vesicular glutamate transporter 1 in the mouse retina reveals temporal ordering in development of rod vs. cone and ON vs. OFF circuits. Journal of Comparative Neurology 465, 480– 498.
843 Sherry, D.M. & Yazulla, S. ~1993!. Goldfish bipolar cells and axon terminal patterns: A Golgi study. Journal of Comparative Neurology 329, 188–200. Wassle, H. ~2004!. Parallel processing in the mammalian retina. Nature Reviews of Neuroscience 5, 747–757. Westerfield, M. ~2000!. The Zebrafish Book. Eugene, OR: University of Oregon Press. Wong, K.Y., Cohen, E.D. & Dowling, J.E. ~2005!. Retinal bipolar cell input mechanisms in giant danio. II. Patch-clamp analysis of ON bipolar cells. Journal of Neurophysiology 93, 94–107. Wong, K.Y. & Dowling, J.E. ~2005!. Retinal bipolar cell input mechanisms in giant danio. III. ON-OFF bipolar cells and their coloropponent mechanisms. Journal of Neurophysiology 94, 265–272. Wong, W.T. & Wong, R.O. ~2000!. Rapid dendritic movements during synapse formation and rearrangement. Current Opinion in Neurobiology 10, 118–124. Yazulla, S. & Studholme, K.M. ~1992!. Light-dependent plasticity of the synaptic terminals of Mb bipolar cells in goldfish retina. Journal of Neurophysiology 320, 521–530. Yazulla, S. & Studholme, K.M. ~2001!. Neurochemical anatomy of the zebrafish retina as determined by immunocytochemistry. Journal of Neurocytology 30, 551–592. Ziv, N.E. & Smith, S.J. ~1996!. Evidence for a role of dendritic filopodia in synaptogenesis and spine formation. Neuron 17, 91–102.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
