In vivo imaging of colorectal cancer growth and ... - Springer Link

Clin Exp Metastasis (2012) 29:573–583 DOI 10.1007/s10585-012-9472-6

RESEARCH PAPER

In vivo imaging of colorectal cancer growth and metastasis by targeting MACC1 with shRNA in xenografted mice Andreas Pichorner • Ulrike Sack • Dennis Kobelt • Inken Kelch • Franziska Arlt • Janice Smith • Wolfgang Walther • Peter M. Schlag • Ulrike Stein

Received: 23 August 2011 / Accepted: 22 March 2012 / Published online: 7 April 2012 Ó Springer Science+Business Media B.V. 2012

Abstract We previously identified the gene metastasisassociated in colon cancer-1 (MACC1) and demonstrated its important role for metastasis prediction in colorectal cancer. MACC1 induces cell motility and proliferation in vitro as well as metastasis in several mouse models. Here we report non-invasive real time imaging of inhibition of colorectal tumor progression and metastasis in xenografted mice by MACC1 shRNA. First, we demonstrated reduction of tumors and liver metastases by endpoint imaging of mice transplanted with MACC1 endogenously high expressing colorectal cancer cells and treated with shRNAs acting on MACC1 or Met. Next, we generated a novel bicistronic IRES vector simultaneously expressing the reporter gene firefly luciferase and MACC1 to ensure a direct correlation of bioluminescence signal with MACC1 expression. We transfected MACC1 endogenously low expressing colorectal cancer cells with this luciferase-IRES-MACC1 construct, transplanted them intrasplenically, and monitored MACC1 induced tumor growth and metastasis by in vivo imaging over time. Transfection of an IRES construct harboring the

A. Pichorner I. Kelch F. Arlt W. Walther U. Stein (&) Experimental and Clinical Research Center, Charite´ University Medicine Berlin, at the Max-Delbru¨ck-Center for Molecular Medicine, Robert-Ro¨ssle-Straße 10, 13125 Berlin, Germany e-mail: [email protected] U. Sack D. Kobelt J. Smith Max-Delbru¨ck-Center for Molecular Medicine, Robert-Ro¨ssle-Straße 10, 13125 Berlin, Germany P. M. Schlag Charite´ Comprehensive Cancer Center, Invalidenstraße 80, 10117 Berlin, Germany

firefly luciferase reporter gene together with MACC1 lacking the SH3-domain reduced tumor growth and metastasis. Finally, we counteracted the luciferase-IRES-MACC1 induced effects by shRNA targeting MACC1 and monitored reduced tumor growth and metastasis by in vivo imaging over weeks. In summary, the new bicistronic luciferaseIRES-MACC1 construct is suitable for in vivo imaging of tumor progression and metastasis, and moreover, for imaging of therapy response such as treatment with MACC1 shRNA. Thereby, we provide proof-of-concept for employment of this MACC1-based in vivo model for evaluating therapeutic intervention strategies aiming at inhibition of tumor growth and metastasis. Keywords Colorectal cancer In vivo imaging MACC1 Metastasis Real time monitoring shRNA treatment Abbreviations CRC DMSO FBS HGF IRES Luc MACC1 MACC1DSH3 MAPK PBS PCR PXXP RT-PCR SCID SH3 shRNA

Colorectal cancer Dimethylsulfoxide Fetal bovine serum Hepatocyte growth factor Internal ribosomal entry site Luciferase Metastasis-associated in colon cancer-1 MACC1 with a deleted SH3-domain Mitogen-activated protein kinase Phosphate buffered saline Polymerase chain reaction Proline-rich motif Reverse-transcriptase polymerase chain reaction Severe combined immune deficient Src-homology 3 Small hairpin RNA

123

574

Introduction The prognosis of colorectal cancer (CRC) strongly depends on the occurrence of metastases [1]. In the TNM-stages I, II, and III the 5-year survival rate ranges between 93 and 44 % [2]. However, it rapidly drops to about 8 % with the occurrence of distant metastases (TNM stage IV) [2]. Although metastasis is the leading cause of death in CRC there are neither sufficient molecular markers to predict metastases formation before they become evident, nor efficient therapeutic options for curative treatment of metastatic dissemination [3–5].Our group previously identified the novel gene metastasis-associated in colon cancer-1 (MACC1). MACC1 expression in the primary tumor correlates with formation of metachronous metastasis and with metastasis-free survival in colon cancer [6]. Meanwhile correlations between MACC1 expression, tumor progression, metastasis and survival were confirmed for CRC [7, 8] and were also found in other cancer entities like gastric, lung and hepatocellular cancer [9–13]. These findings qualify MACC1 as an important prognostic indicator for tumor progression and metastasis formation in different cancer entities. MACC1 encodes a protein of 852 amino acids that harbors, besides of other motifs, a Src-homology 3 (SH3)domain together with a proline-rich motif (PXXP) enabling MACC1 for protein-specific interactions [6, 14, 15]. SH3domains, firstly described in the protooncogene Src, are involved in assembling protein complexes for signal transduction and SH3-domain-containing proteins are, e.g., tyrosine kinases or substrates of protein kinases [16]. Thus, the development of SH3 inhibitors as anticancer agents is currently of growing interest [17]. SH3-domain-mediated protein–protein interactions are mainly facilitated via proline-rich motifs of the protein binding partners. The simultaneous occurrence of an SH3-domain together with a PXXP motif predestines MACC1 as signal transduction molecule. Based on this domain constellation a bidirectional interaction of MACC1 with other signaling molecules is very likely. In order to address the impact of the SH3-domain in MACC1 for tumorigenesis and metastases formation we established here SW480-derived transfectants lacking the SH3-domain (SW480/luc-MACC1DSH3), analyzed its ability for cell motility in cell culture, and monitored development of tumors and metastases in mice. The hepatocyte growth factor (HGF)/Met pathway is one of the major signaling cascades in the context of CRC tumorigenesis and metastasis [18]. We recently showed that MACC1 plays a key role in activating the HGF/Met pathway by transcriptionally controlling the expression of the gene encoding the receptor tyrosine kinase Met [6, 19]. Furthermore MACC1 expression itself is increased by activation of the MAPK signaling pathway. This leads to a

123

Clin Exp Metastasis (2012) 29:573–583

positive feedback loop with respect to MACC1 induced cell motility, tumor growth and metastasis [20]. Recently it was shown that MACC1 contributed to tumor progression in CRC even more efficiently than Met by acting through other or additional mechanisms apart from the already known enhanced expression of Met [8]. Since the prognostic biomarker MACC1 is causal for metastasis induction, targeting MACC1 will not only broaden our knowledge concerning the process leading to metastases formation, but also represents a promising strategy for the treatment of CRC metastasis. So far, no suitable in vivo model exists that enables efficient evaluation of therapeutic MACC1-based intervention strategies [21]. Here we report non-invasive real time imaging of MACC1 induced CRC growth and metastasis in xenografted mice as well as their inhibition by targeting MACC1 with shRNA. As a first step, we demonstrated reduction of tumor growth and liver metastasis by end point imaging in mice transplanted with MACC1 endogenously high expressing CRC cells and treated with shRNAs acting on MACC1 or Met. Next, we generated a novel bicistronic IRES vector simultaneously expressing the reporter gene firefly luciferase and MACC1 in order to ensure a direct correlation of the bioluminescence signal with the MACC1 expression level. We stably transfected MACC1 endogenously low expressing CRC cells with this luciferase-IRES-MACC1 construct, transplanted them intrasplenically into mice. Subsequently, we monitored MACC1 induced tumor growth and metastasis formation by in vivo imaging over time. Additionally, we addressed the role of the SH3-domain by generating an IRES construct harboring the firefly luciferase reporter gene together with MACC1 lacking the SH3-domain. Thereby, tumor growth and metastasis formation was reduced, again documented by in vivo imaging over time. Finally, we counteracted the luciferase-IRES-MACC1 induced in vivo effects by shRNA targeting MACC1 and monitored the reduced tumor growth and metastasis formation by in vivo imaging over weeks. Thus, by using this bicistronic MACC1 vector, we provide proof-of-concept for MACC1based intervention strategies such as RNAi technology in xenografted in vivo models monitored by in vivo imaging.

Materials and methods Cell lines The human colorectal cell lines SW480 (low endogenous MACC1 expression) and SW620 (high endogenous MACC1 expression) (ATCC, Manassas, VA) were maintained in RPMI 1640 (PAA Laboratories GmbH, Co¨lbe, Germany) supplemented with 10 % fetal bovine serum (FBS) (PAA


Laboratories GmbH, Co¨lbe, Germany) in a humidified incubator at 37 °C and 5 % CO2. Cells were analyzed for potential contamination and were found to be free of mycoplasm. Authentification of cell lines was performed by short tandem repeat (STR) genotyping. STR genotypes were consistent with published genotypes for these cell lines. Cloning and transfection The pSilencerTM 4.1-CMV neo vector (Ambion, Darmstadt, Germany) was used for generating the shRNA plasmids pSil/ control shRNA, pSil/MACC1 shRNA, and pSil/Met shRNA. E. coli DH5a competent cells (GIBCO BRL, Karlsruhe, Germany) were used for transformation according to manufacturer’s instructions. Plasmid preparations were performed using Jetstar plasmid purification kit (Genomed, Lo¨hne, Germany). Cloning was confirmed by sequencing (Agowa, Berlin, Germany). SW620 cells were first transfected with the firefly luciferase reporter vector pGL4 (Promega Corporation, Madison, WI) generating SW620/luc. In addition SW620/luc cells were transfected with the shRNA plasmids pSil/control shRNA, pSil/MACC1 shRNA or pSil/ Met shRNA generating SW620/luc ? control shRNA, SW620/luc ? MACC1 shRNA, or SW620/luc ? Met shRNA cells. Transfections were carried out using Lipofectin (Invitrogen GmbH, Karlsruhe, Germany) according to manufacturer’s instructions. The pIRES vector (Clontech Laboratories, Mountain View, CA) was used for cloning the reporter gene firefly luciferase (pIRES/luc, control) together with MACC1 (pIRES/luc-MACC1) or MACC1DSH3 (pIRES/lucMACC1DSH3). Following DNA gel electrophoresis (Electrophoresis grade agarose, Invitrogen) DNA fragments were eluted with Invisorb spin DNA extraction kitÒ (Invitek GmbH, Berlin, Germany). E. coli DH5a competent cells (Subcloning efficiencyTM DH5aTM chemically competent cells, Invitrogen, Karlsruhe, Germany) were used for transformation according to manufacturer’s instructions. Mini and maxi plasmid preparations were performed using Invisorb spin plasmid mini two kit (Invitek GmbH, Berlin, Germany) and Jetstar plasmid purification kit (Genomed, Lo¨hne, Germany). Cloning was confirmed by sequencing (Invitek GmbH, Berlin, Germany) and control digests with enzymes from New England Biolabs (Frankfurt am Main, Germany) and from Fermentas (St. Leon-Rot, Germany). Transfections of the bicistronic IRES constructs pIRES/luc, pIRES/luc-MACC1DSH3 and pIRES/luc-MACC1 were carried out using Metafectene pro (Biontex Laboratories GmbH, Planegg, Germany) generating the following transfectants: SW480/luc (control), SW480/luc-MACC1DSH3 and SW480/luc-MACC1. SW480/luc-MACC1 cells were then transfected with the previously used pSil-plasmids harboring control shRNA (pSil/control shRNA), or MACC1

575

shRNA (pSil/MACC1 shRNA) generating the following transfectants: SW480/luc-MACC1 ? control shRNA and SW480/luc-MACC1 ? MACC1 shRNA. Single cell colonies were picked 10 days after transfection. In order to obtain stably expressing clones, cells were selected with the antibiotic G418 (5 mg/ml) (Invitrogen GmbH, Karlsruhe, Germany) for 8 passages. Cells were stored at -80 °C in freezing medium (FBS supplemented with 10 % DMSO). Luciferase activity assay Cells were washed with PBS (PAA Laboratories GmbH, Co¨lbe, Germany), trypsinized and resolved in culture medium. Cells were counted using CountessÒ automated cell counter (Invitrogen GmbH, Karlsruhe, Germany). Two 9 105 cells/well were seeded into a 96 well plate with 50 ll culture medium and 50 ll luciferase assay reagent (Promega Corporation, Madison, WI). After incubation for 20 min bioluminescence measurements were performed using the Spectrafluor plus reader (Tecan Deutschland GmbH, Berlin, Germany). Experiments were performed in duplicate and repeated at least 3 times. Data were normalized to the parental cell line SW480 and means and SE values were calculated. Quantitative real time RT-PCR RNA was extracted using Trizol RNA extraction reagent (Invitrogen GmbH, Karlsruhe, Germany). RNA was quantified with NanoDropTM 2000 (Thermo Fisher Scientific Inc., Wilmington, NC). Quantitative real time RT-PCR was carried out using the LightCyclerÒ 480 device and the LightCyclerÒ DNA master hybprobe kit (Roche Diagnostics, Mannheim, Germany). For MACC1 cDNA quantification the following primers and probes were used: forward primer 50 –ttcttttgattcctccggtga–30 , reverse primer 50 –actctga tgggcatgtgctg–30 , FITC probe 50 –gcagacttcctcaagaaattct ggaagatcta–30 , LC-Red 640 probe 50 –agtgtttcagaacttctggac attttagacga–30 as described previously [6]. Samples were measured in duplicate and normalized to the housekeeping gene G6PDH using the LightCyclerÒ h-G6PDH Housekeeping Gene Set (Roche Diagnostics, Mannheim, Germany). Data are given as mean and standard error of at least 3 independent experiments. Western blot Protein extraction was accomplished by cell lysis with RIPA buffer. Protein concentrations were measured according to Bradford using Coomassie plus (Pierce-Perbio, Bonn, Germany). Western blotting and detection of V5-tagged MACC1 was performed with a horseradish peroxidase

123

576

labeled V5 specific antibody (Invitrogen GmbH, Karlsruhe, Germany). b-Tubulin (antibody from BD Bioscience, Heidelberg, Germany) served as loading controls. Migration and invasion assay Cell migration was evaluated by adding 2.5 9 105 cells to transwell membrane chambers (pore size 12 lm; Millipore, Schwalbach, Germany) and allowed them to accommodate. No additional HGF was added. After 24 h the number of cells which migrated through the membrane to the lower chamber was counted in a Neubauer chamber. For the invasion assays, 70 ll 1:3 diluted Matrigel (BD Biosciences, Franklin Lakes, NJ) was added to the transwell membrane chambers and after an incubation period of 15 min 5 9 105 cells were seeded. The number of invaded cells in the lower chamber was counted after 72 h as described in the migration assay. Migration and invasion assays were performed in quadruplicate and normalized to the parental cell line SW480. Data are given as mean and standard error of at least 2 independent experiments. In vivo imaging First, reduction of tumor growth and metastasis in vivo was approached by using shRNA acting on MACC1 or Met in endogenously high MACC1 expressing SW620 cells and was demonstrated by endpoint in vivo imaging. Thus, SW620 cells were transfected with the reporter gene firefly luciferase (SW620/luc) and treated in vitro either with control shRNA, MACC1 shRNA or Met shRNA. Three 9 106 SW620/luc ? control shRNA, SW620/luc ? MACC1 shRNA or SW620/luc ? Met shRNA were transplanted intrasplenically into 6 week old female nude mice randomly assigned to groups of 3 animals. The animals were killed on day 25 for ethical reasons. Endpoint measurements were performed using NightOwl LB 981 systems (Berthold Technologies GmbH & Co. KG, Bad Wildbad, Germany). For this, mice were anesthetized and intraperitoneally injected with 150 ll luciferin (27 mg/ml, 200 mg/ kg) (Biosynth, Staad, Switzerland). Measurements started 20 min after luciferin injection. For all images an exposition time of 5 min was chosen. The imaging was quantified using ImageJ software (version 1.42q). The abdomens in the ventral pictures were defined as region of interest. A region of interest was manually drawn always using the same standardized size and diameters. After completion of in vivo imaging animals were sacrificed, spleen and liver were removed and imaging of the isolated organs was performed. The intensity of the bioluminescence signal was color coded and overlayed with bright field picture.

123


Next, a MACC1 metastasis imaging model based on coupled firefly luciferase and MACC1 expression was established. This was ensured by using the bicistronic pIRES/luc-MACC1 vector, thereby allowing the in vivo imaging of MACC1-induced tumor growth and metastasis. Severe combined immune deficient (SCID) 6 weeks old female mice (Harlan Laboratories GmbH, Indianapolis, IN) were randomly assigned to groups of at least 3 animals. Mice were intrasplenically transplanted with 5 9 106 SW480/luc, SW480/luc-MACC1DSH3 or SW480/luc-MACC1 cells. Seven days after transplantation bioluminescence imaging was started using NightOwl LB 981 systems, performed twice per week, and terminated due to ethical reasons on day 49. In 2 animals of the SW480/luc-MACC1 group imaging was terminated on day 35 due to enhanced tumor growth. Imaging was performed as described. Quantification of bioluminescence signals was performed as described above. Finally, the newly established MACC1 metastasis imaging model was used for therapeutic intervention using shRNA as proof-of-principle. Six week old SCID mice were randomly assigned to groups of 3 animals. Transplantation was performed by intrasplenic injection of 5 9 106 SW480/lucMACC1 cells, SW480/luc-MACC1 ? control shRNA cells or SW480/luc-MACC1 ? MACC1 shRNA cells. Tumor growth and metastasis formation were monitored by in vivo imaging twice per week. On day 35, mice were sacrificed due to ethical reasons. In vivo and ex vivo imaging of the organs and the following quantification was done as described before. All animal experiments were performed in accordance with the UKCCCR guidelines and approved by the responsible local authorities (State Office of Health and Social Affairs, Berlin, Germany). Statistics A one-way-test (ANOVA) was performed to compare the transfected clones to the control group. In order to determine the significance, the P value was calculated with the software GraphPad prism version 4.01. A P value \0.05 was defined as statistically significant for all analyses.

Results Reduction of tumor growth and metastasis formation in SW620 cells-xenografted mice by using MACC1 shRNA First, we evaluated the effect of MACC1 shRNA on tumor growth and metastasis formation in xenografted nude mice by endpoint bioluminescence imaging. SW620/luc ? control shRNA, SW620/luc ? MACC1 shRNA and SW620/ luc ? Met shRNA cells were intrasplenically injected. On


577

signals when comparing mice of the SW620/luc ? control shRNA group with mice of the SW620/luc ? MACC1 shRNA or SW620/luc ? Met shRNA group (P = 0.029 or P = 0.011, respectively) (Fig. 1b). The signal intensities of SW620/luc ? MACC1 shRNA or SW620/luc ? Met shRNA mice were not significantly different. These findings of reduction of tumor growth and metastasis by MACC1 shRNA here demonstrated by in vivo imaging are in line with our previous endpoint results describing reduced metastases numbers and sizes in mice intrasplenically transplanted with parental SW620 cells following treatment with MACC1 shRNA or Met shRNA [6].

day 25 after transplantation mice were killed due to ethical reasons. SW620/luc ? control shRNA transplanted mice developed extensive primary tumors in the spleen and metastases in the liver (Fig. 1). Transfection of MACC1 shRNA and Met shRNA, however, resulted in reduced tumor growth and liver metastasis formation. Remarkably SW620/ luc ? MACC1 shRNA transplanted mice developed only moderate splenic tumors and no visible liver metastases. We performed in vivo quantification of the bioluminescence signals of the groups SW620/luc ? control shRNA, SW620/ luc ? MACC1 shRNA and SW620/luc ? Met shRNA. We found significant differences of the quantified bioluminescence

A SW620/ luc + control shRNA

SW620/ luc + MACC1 shRNA

signal intensity (x106)

B10

SW620/ luc + Met shRNA

SW620/ luc + control shRNA

8 6

SW620/ luc + Met shRNA

4 2 0

SW620/ luc + MACC1 shRNA 1

2

3

4

time (in weeks) Fig. 1 In vivo metastases reduction by shRNAs targeting MACC1 or Met. a SW620 cells were transfected in vitro with the reporter gene firefly luciferase (SW620/luc) and were subsequently co-transfected with plasmids harboring control shRNA or shRNAs acting on MACC1 or Met generating SW620/luc ? MACC1 shRNA or SW620/luc ? Met shRNA cells. After intrasplenic transplantation of 3 9 106 stable transfected cells into nude mice randomly assigned to groups of 3 animals an endpoint analysis using bioluminescence imaging was performed on day 25. Mice were anesthetized and intraperitoneally injected with 150 ll luciferin. After 20 min of incubation lateral and ventral bioluminescence images were taken.

Then, abdomen of the mice were opened and pictured again. Spleens and livers were removed and ex situ images were taken. The whole imaging was performed with the same exposure time of 5 min. The intensity of the bioluminescence signal was color coded and overlayed with bright field picture. b Quantification of in vivo imaging. The graph presents the quantified bioluminescence signals of the groups SW620/luc ? control shRNA, SW620/luc ? MACC1 shRNA and SW620/luc ? Met shRNA. Quantification was performed using ImageJ software (version 1.42q). The region of interest was standardized using always the same size and diameters and was manually drawn over the abdomens of the mice in the ventral pictures

123

578

Luciferase activity and MACC1 expression in SW480 cells transfected with bicistronic IRES constructs In order to generate an in vivo model of MACC1 induced tumor growth and metastasis for therapeutic intervention, a bicistronic IRES vector was used to ensure the correlated

Fig. 2 Luciferase and MACC1 expression and cell motility in SW480 cells harboring the newly generated IRES constructs a luciferase activity. SW480 cells were transfected with a bicistronic IRES vector harboring the reporter gene firefly luciferase (pIRES/luc, control) together with MACC1 (pIRES/luc-MACC1) or MACC1DSH3 (pIRES/luc-MACC1DSH3). For bioluminescence detection of luciferase activity 2 9 105 SW480, SW80/luc, SW480/ luc-MACCDSH3 or SW480/luc-MACC1 cells/well were seeded into a 96 well plate. 50 ll cell culture medium was mixed with 50 ll luciferase assay reagent. Bioluminescence measurements were performed after 20 min of incubation. Measurements were done in duplicate and normalized to the parental cell line SW480. Comparisons of the parental SW480 cell line versus SW480/luc-MACC1 cells were analyzed by one-way-test (ANOVA). Data represent mean and standard error of at least 3 independent experiments per group each performed in duplicate. b MACC1 expression. MACC1 mRNA/ G6PDH mRNA ratios of SW480, SW480/luc, SW480/lucMACCDSH3 or SW480/luc-MACC1 cells were analyzed by quantitative real time RT-PCR. Comparisons of cells transfected with MACC1 versus parental cell line SW480 were analyzed by one-way-

123


expression of firefly luciferase and MACC1 in the transfected cells. All generated cell clones had a significantly increased luciferase activity compared to the parental cell line SW480. These stable bioluminescence signals were sufficient for subsequent imaging analysis (Fig. 2a). Overexpression of MACC1 mRNA and protein was found

test (ANOVA). Data represent mean and standard error of at least 3 independent experiments per group each performed in duplicate. MACC1 protein was detected by western blot with b-tubulin as loading control. c Cell migration driven by MACC1. Cell migration was evaluated using Boyden chamber assay. 2.5 9 105 SW480, SW480/luc, SW480/luc-MACCDSH3 or SW480/luc-MACC1 cells were seeded into each transwell (12 lm pores) and dissolved in 400 ll culture medium. After an incubation period of 24 h migrated cells were counted 4 times/well. Comparisons of parental SW480 cell line versus SW480/MACC1 were analyzed by one-way-test (ANOVA). Data represent mean and standard error of at least 3 independent experiments per group. d Cell invasion driven by MACC1. For measurements of cell invasion 5 9 105 SW480, SW480/luc, SW480/luc-MACCDSH3 or SW480/luc-MACC1 cells were seeded into Matrigel coated transwells (12 lm pores). After 72 h incubation invaded cells were counted as described before. Comparisons of parental cell line SW480 versus SW480/MACC1 were analyzed by one-way-test (ANOVA). Data represent mean and standard error of at least 2 independent experiments per group


in SW480/luc-MACC1 and in SW480/luc-MACC1DSH3 cells, compared to the parental cell line SW480 and to SW480/luc cells (Fig. 2b). One representative clone of each group is shown. In addition, we also analyzed these cell clones for expression of Met, a transcriptional target of MACC1. We found increased Met levels in SW480/lucMACC1 cells, when compared SW480/luc and SW480/ luc-MACC1DSH3 cells (data not shown). Cell motility of SW480 cells transfected with bicistronic IRES constructs

579

(P \ 0.001) as well as threefold increased invasion (P \ 0.05) compared to the parental cell line SW480 (Fig. 2c, d). SW480/luc and SW480/luc-MACC1DSH3 cells demonstrated nearly equal amounts of migrated or invaded cells compared to the parental cell line SW480. Monitoring of MACC1 induced tumor growth and metastasis formation by in vivo imaging using bicistronic constructs

To ensure the biological functionality of MACC1 when cloned into the bicistronic IRES vector system, cell migration and invasion was analyzed due to the fact that MACC1 is a main regulator of cell motility [6]. SW480/ luc-MACC1 cells ectopically overexpressing wild-type MACC1 showed significantly fivefold increased migration

SW480 cells transfected either with firefly luciferase only (SW480/luc), with wild-type MACC1 (SW480/luc-MACC1) or mutated MACC1 (SW480/luc-MACC1DSH3) were intrasplenically injected into SCID mice. Fastest increase in signal intensities was monitored for mice transplanted with SW480/ luc-MACC1 cells (Fig. 3a). Thus, the newly generated IRES construct harboring firefly luciferase and MACC1 cDNA is sufficient for imaging of MACC1 induced tumor growth and

Fig. 3 Increased metastasis formation by using the newly generated IRES vector. a Bioluminescence imaging using the new bicistronic IRES vector system. Pictures were taken over the duration of 7 weeks showing consistently one representative mouse per group. Intrasplenic transplantation of 5 9 106 SW480/luc, SW480/luc-MACC1DSH3 or SW480/luc-MACC1 cells was performed into SCID mice randomly assigned to groups of at least 3 animals. Images were taken after the mice were anesthetized and intraperitoneally injected with 150 ll Luciferin. After 20 min of incubation bioluminescence pictures were taken from lateral and ventral. Bright field pictures were then overlayed with the color coded bioluminescence signal.

b Quantification of in vivo imaging. The graph presents the quantified bioluminescence signals of the groups SW480/luc, SW480/lucMACC1DSH3 and SW480/luc-MACC1 over the complete in vivo imaging. Quantification was performed using ImageJ software (version 1.42q). The region of interest was standardized using always the same size and diameters and was manually drawn over the abdomens of the mice in the ventral pictures. c Growth of the primary tumor in the spleen and of metastases in the liver tissue. The imaging was completed by performing ex vivo imaging using an exposure time of 5 min for all measurements. Bright field pictures were overlayed with the color coded bioluminescence signal

123

580

metastasis formation in mice. In contrast to the control group (SW480/luc), mice with tumors expressing MACC1 on a high level developed liver metastases in nearly all animals (80 %). Next, we performed in vivo quantification of the bioluminescence signals of the groups SW480/luc, SW480/lucMACC1DSH3 and SW480/luc-MACC1 over time. We found a clear difference of the quantified bioluminescence signals when comparing mice of the SW480/luc-MACC1 group with those of the SW480/luc and SW480/MACC1DSH3 groups (Fig. 3b). The signal intensity of SW480/luc-MACC1 mice was more than threefold increased compared to the SW480/ luc control mice in week 7, although not significant (P = 0.126). Representative ex vivo images of spleens and livers for each group, SW480/luc, SW480/luc-MACC1DSH3, SW480/luc-MACC1, underline the induction of liver metastases by MACC1 (Fig. 3c). Monitoring of MACC1 shRNA induced reduction of tumor growth and metastasis by in vivo imaging using bicistronic constructs The first set of endpoint imaging experiments proved a clear reduction of tumor growth and metastasis formation by using MACC1 shRNA. The next set of imaging experiments approved the application of the new bicistronic vector system for monitoring tumor growth and metastasis formation in vivo. Referring to these promising results we aimed at inhibition of MACC1 induced metastasis formation in SW480/luc-MACC1 transplanted mice. Therefore SW480/luc-MACC1 cells were treated with the previously used plasmids either harboring control shRNA (pSil/control shRNA) or MACC1 shRNA (pSil/ MACC1 shRNA). The following in vivo imaging was performed using SCID mice by measurements over 5 weeks. Ventral images showed rapidly increasing bioluminescence intensities in mice transplanted with SW480/ luc-MACC1 and SW480/luc-MACC1 ? control shRNA cells starting from week 4 (Fig. 4a, b). Metastases could be observed in nearly all animals—only one mouse in the group SW480/luc-MACC1 did not develop detectable liver metastases after forming a splenic tumor during the experiment. Quantification analyzes proved more than fivefold increased signal intensities on week 5 in the group treated with control shRNA compared to the group treated with MACC1 shRNA, although significance could not be determined (P = 0.086; Fig. 4b). Next, we removed the spleens and the livers of all groups, and performed ex vivo imaging (Fig. 4c). After developing detectable primary tumors in the spleen, these MACC1 shRNA treated mice showed no liver metastases, besides in one case, where a low bioluminescence signal was detected from a macroscopically invisible metastasis. In summary, the new bicistronic IRES construct provides a suitable model for

123


investigating therapeutic intervention approaches for inhibition of MACC1 induced tumor growth and metastasis.

Discussion In this study we succeeded in monitoring MACC1 induced tumor and metastases development through non invasive bioluminescence in vivo imaging and in therapeutic targeting of MACC1 for inhibition of tumor growth and metastasis. We confirmed the crucial role of MACC1 for tumor progression and metastasis formation in xenografted mice bearing tumors from MACC1 overexpressing SW620 cells by inhibiting tumor growth and metastasis with shRNA targeting MACC1 or Met. Thus, we underlined our previous findings on liver metastases reduction using shRNA against MACC1 and Met in an in vivo model by real time imaging [6]. However, the overriding goal of this study was the generation of a MACC1-based in vivo model, which is suited for monitoring both tumor growth and metastasis formation as well as therapeutic intervention strategies by bioluminescence imaging. Therefore we created a novel construct harboring the reporter gene firefly luciferase and MACC1 in one single IRES vector to ensure a correlated expression of both genes in the transfected cells (pIRES/luc-MACC1). In addition, an IRES construct harboring firefly luciferase and mutated MACC1 lacking the SH3-domain (pIRES/luc-MACC1DSH3) was transfected to examine the impact of the SH3-domain on MACC1 protein functionality. We demonstrated tumorigenesis and liver metastasis in SW480/luc-MACC1 mice by in vivo imaging, whereas SW480/luc-MACC1DSH3 animals showed lower metastasis rates. Furthermore, treatment with shRNA acting on MACC1 reduced tumor growth and metastasis formation in the SW480/luc-MACC1 xenografted mouse model. Taken together, the new bicistronic luciferase-IRES-MACC1 construct was shown to be applicable for in vivo imaging of tumor induction and progression as well as metastasis, and moreover, for imaging of therapy response to treatments such as MACC1 shRNA. Thereby, we provide proof-of-concept for employment of this MACC1-based in vivo model for evaluating further intervention strategies for metastasis prevention or inhibition. The basic finding of this study was the reduction of tumor growth and metastasis in mice xenografted with MACC1 endogenously high expressing SW620 cells achieved with MACC1 shRNA as shown by endpoint bioluminescence imaging. Thus, the crucial role of MACC1 for metastasis formation was further supported. However, SW620 cells are known to have a very high metastatic potential, which might be caused by additional proteins besides MACC1 [6, 22]. In order to establish a


581

Fig. 4 Proof-of-concept: metastasis reduction by targeting MACC1 in the new MACC1-specific in vivo model. a Inhibition of metastasis formation in mice transplanted with SW480/luc-MACC1 ? MACC1 shRNA cells. In vivo monitoring was performed over 5 weeks presenting 2 independent measurements per week represented by one representative mouse per group which is demonstrated consistently over the whole time of imaging. SCID mice were randomly assigned to groups of 3 animals and intrasplenically transplanted with 5 9 106 SW480/luc-MACC1, SW480/luc-MACC1 ? control shRNA or SW480/luc-MACC1 ? MACC1 shRNA cells. After anesthetizing of the animals 150 ll luciferin was intraperitoneally injected and an incubation of 20 min was performed. Detection of the bioluminescence signal was done using an exposure time of 5 min for all

measurements. Bright field pictures were then overlayed with the color coded bioluminescence signal. b Quantification of in vivo imaging. The graph presents the quantified bioluminescence signals of the groups SW480/luc-MACC1, SW480/luc-MACC1 ? control shRNA and SW480/luc-MACC1 ? MACC1 shRNA over the complete in vivo imaging. Quantification was performed using ImageJ software (version 1.42q). The region of interest was standardized using always the same size and diameters and was manually drawn over the abdomens of the mice in the ventral pictures. c Growth of the primary tumor in the spleen and of metastases in the liver tissue. Ex vivo imaging was performed using an exposure time as described before. Bright field pictures were overlayed with the color coded bioluminescence signal

MACC1-specific in vivo model, we employed SW480 cells known to express MACC1 on a hardly detectable low level associated with a very low metastatic potential [23]. The bicistronic IRES vector we used for in vivo imaging provides major advantages. It ensures a correlated expression of 2 different genes, is well accepted for in vivo application and has already been used in other cancer models [24–26]. Firefly luciferase is widely used for in vivo imaging because it is highly sensitive and well standardized for qualitative as well as for quantitative analyses compared to other reporter genes such as variants of green fluorescent protein [27–29]. A sufficient and stable bioluminescence signal is also a basic requirement to generate an animal model for real time in vivo imaging of MACC1

induced tumor growth and metastasis. The emitted bioluminescence signal monitored during the disease course is directly correlated to the growth of the primary tumor and possible metastases, increases the information compared to an endpoint analysis, and makes even macroscopically invisible metastases detectable [30–34]. To verify the biological activity of MACC1 protein encoded by pIRES/luc-MACC1 for cell motility, we performed migration and invasion assays as important in vitro read outs for metastatic abilities [35, 36]. Cell migration as well as invasion was found to be significantly increased in SW480/luc-MACC1 transfectants compared to the parental SW480, SW480/luc or SW480/luc-MACC1DSH3 cells. Met expression was also induced by transfection of pIRES/

123

582

luc-MACC1, but not when employing pIRES/lucMACC1DSH3. Thus, the biological function of MACC1 is not affected by this bicistronic vector system. All experimental sets of in vivo imaging showed a sufficient and stable bioluminescence signal in all animal groups. It was remarkable that animals which were intrasplenically transplanted with MACC1 overexpressing cells (and not treated with MACC1 shRNA) had an almost comparable signal intensity of the bioluminescence signal in the very beginning of imaging which rapidly increased after a few weeks in contrast to the other groups. By deleting the SH3domain of MACC1 the function of the protein is impaired, reflected by decreased tumor growth and metastasis formation compared to SW480/luc-MACC1 animals. Since inhibitors targeting the MACC1 protein are not available so far, we used MACC1 shRNA as proof-of-concept for metastasis intervention. We transfected SW480/lucMACC1 cells in vitro with MACC1 shRNA prior to intrasplenic transplantation. Remarkably, targeting MACC1 specifically decreased formation of liver metastases. This was confirmed by lateral and ventral pictures imaged over a time period of 5 weeks and by picturing the spleen and the liver on the last day of imaging. Thus, we provided this proof-of-concept of a MACC1-specific intervention for primary tumor and metastases reduction not only in MACC1 endogenously high expressing SW620 cells, but also in ectopically MACC1 overexpressing SW480 cells. We are conscious about the experimental design of this approach since the reportergene luciferase and MACC1 are part of the same transcript and as a consequence both of them are affected by the shRNA targeting the downstream gene. Therefore, we cloned the reportergene luciferase located upstream to the IRES-site knowing that the upstream gene is expressed up to fivefold higher compared to the gene located downstream of the IRES-site [37]. Our in vitro analyses ensured a fivefold more effective knock-down of the MACC1 mRNA expression compared with the reduction in luciferase activity. Confirming both the tumorigenic and metastatic potential of MACC1 as well as restricting tumor growth and metastasis formation by targeting MACC1 provides the rationale for further investigations intervening in the MACC1-induced processes. Application of MACC1 antibodies, small molecule inhibitors or other molecular biological options such as targeting regulatory molecules needed for MACC1 protein activity might contribute to reduction or even prevention of tumor growth and metastasis formation. This MACC1 in vivo model based on the newly generated luciferase-IRES-MACC1 construct allows real time monitoring by bioluminescence imaging and represents a suitable tool for evaluating novel treatment approaches for CRC and possibly also for other cancer entities.

123

Clin Exp Metastasis (2012) 29:573–583 Acknowledgments We are very grateful to Pia Hermann and Jutta Aumann for their technical assistance and to Mathias Dahlmann, Felicitas Schmid, Clara Lemos, Anne Enders and Patrick Tauscher for their methodological and scientific advice. Conflict of interest

The authors declare no conflict of interest.

References 1. Stein U, Schlag PM (2007) Clinical, biological, and molecular aspects of metastasis in colorectal cancer. Recent Results Cancer Res 176:61–80 2. O’Connell JB, Maggard MA, Ko CY (2004) Colon cancer survival rates with the new American Joint Committee on cancer sixth edition staging. J Natl Cancer Inst 96:1420–1425 3. Di Costanzo F, Doni L (2005) Adjuvant therapy in colon cancer: which treatment in 2005? Ann Oncol 16 (Suppl 4): iv69–iv73 4. Macdonald JS (1997) Adjuvant therapy for colon cancer. CA Cancer J Clin 47:243–256 5. Morris EJ, Forman D, Thomas JD et al (2010) Surgical management and outcomes of colorectal cancer liver metastases. Br J Surg 97:1110–1118 6. Stein U, Walther W, Arlt F et al (2009) MACC1, a newly identified key regulator of HGF-MET signaling, predicts colon cancer metastasis. Nat Med 15:59–67 7. Shirahata A, Shinmura K, Kitamura Y et al (2010) MACC1 as a marker for advanced colorectal carcinoma. Anticancer Res 30:2689–2692 8. Galimi F, Torti D, Sassi F et al (2011) Genetic expression analysis of MET, MACC1, and HGF in metastatic colorectal cancer: response to Met inhibition in patient xenografts and pathologic correlations. Clin Cancer Res 17:3146–3156 9. Shirahata A, Sakata M, Kitamura Y et al (2010) MACC1 as a marker for peritoneal-disseminated gastric carcinoma. Anticancer Res 30:3441–3444 10. Shimokawa H, Uramoto H, Onitsuka T et al (2011) Overexpression of MACC1 mRNA in lung adenocarcinoma is associated with postoperative recurrence. J Thorac Cardiovasc Surg 141: 895–898 11. Chundong G, Uramoto H, Onitsuka T et al (2011) Molecular diagnosis of MACC1 status in lung adenocarcinoma by immunohistochemical analysis. Anticancer Res 31:1141–1145 12. Shirahata A, Fan W, Sakuraba K et al (2011) MACC1 as a marker for vascular invasive hepatocellular carcinoma. Anticancer Res 31:777–780 13. Qiu J, Huang P, Liu Q et al (2011) Identification of MACC1 as a novel prognostic marker in hepatocellular carcinoma. J Transl Med 9:166 14. Stein U, Dahlmann M, Walther W (2010) MACC1–more than metastasis? Facts and predictions about a novel gene. J Mol Med 88:11–18 15. Kokoszyn´ska K, Kryn´ski J, Rychlewski L et al (2009) Unexpected domain composition of MACC1 links MET signaling and apoptosis. Acta Biochim Pol 56:317–323 16. Martin GS (2001) The hunting of the Src. Nat Rev Mol Cell Biol 2:467–475 17. Lu XL, Cao X, Liu XY et al (2010) Recent progress of Src SH2 and SH3 Inhibitors as anticancer agents. Curr Med Chem 17: 1117–1124 18. Birchmeier C, Birchmeier W, Gherardi E et al (2003) Met, metastasis, motility and more. Nat Rev Mol Cell Biol 4:915–925 19. Stein U, Smith J, Walther W et al (2009) MACC1 controls Met: what a difference an Sp1 site makes. Cell Cycle 8:2467–2469

Clin Exp Metastasis (2012) 29:573–583 20. Arlt F, Stein U (2009) Colon cancer metastasis: MACC1 and Met as metastatic pacemakers. Int J Biochem Cell Biol 41:2356–2359 21. Servais EL, Colovos C, Bograd AJ et al (2011) Animal models and molecular imaging tools to investigate lymph node metastases. J Mol Med 89:753–769 22. Albini A, Iwamoto Y, Kleinman HK et al (1987) A rapid in vitro assay for quantitating the invasive potential of tumor cells. Cancer Res 47:3239–3245 23. Marquet RL, van den Tol MP, Jeekell J (2001) Sodium hyaluronate enhances colorectal tumour cell metastatic potential in vitro and in vivo. Br J Surg 88:246–250 24. Zumsteg A, Strittmatter K, Klewe-Nebenius D et al (2010) A bioluminescent mouse model of pancreatic {beta}-cell carcinogenesis. Carcinogenesis 31:1465–1474 25. McNally LR, Welch DR, Beck BH et al (2010) KISS1 overexpression suppresses metastasis of pancreatic adenocarcinoma in a xenograft mouse model. Clin Exp Metastasis 27:591–600 26. Shin JH, Chung JK, Kang JH et al (2004) Noninvasive imaging for monitoring of viable cancer cells using a dual-imaging reporter gene. J Nucl Med 45:2109–2115 27. Naylor LH (1999) Reporter gene technology: the future looks bright. Biochem Pharmacol 58:749–757 28. Contag CH, Jenkins D, Contag PR et al (2000) Use of reporter genes for optical measurements of neoplastic disease in vivo. Neoplasia 2:41–52 29. Welsh S, Kay SA (1997) Reporter gene expression for monitoring gene transfer. Curr Opin Biotechnol 8:617–622

583 30. Jenkins DE, Oei Y, Hornig YS et al (2003) Bioluminescent imaging (BLI) to improve and refine traditional murine models of tumor growth and metastasis. Clin Exp Metastasis 20:733–744 31. Dinca EB, Sarkaria JN, Schroeder MA et al (2007) Bioluminescence monitoring of intracranial glioblastoma xenograft: response to primary and salvage temozolomide therapy. J Neurosurg 107:610–616 32. Rehemtulla A, Stegman LD, Cardozo SJ et al (2000) Rapid and quantitative assessment of cancer treatment response using in vivo bioluminescence imaging. Neoplasia 2:491–495 33. Paroo Z, Bollinger RA, Braasch DA et al (2004) Validating bioluminescence imaging as a high-throughput, quantitative modality for assessing tumor burden. Mol Imaging 3:117–124 34. Sack U, Walther W, Scudiero D et al (2011) S100A4-induced cell motility and metastasis is restricted by the Wnt/{beta}-catenin pathway inhibitor calcimycin in colon cancer cells. Mol Biol Cell 22:3344–3354 35. Yamaguchi H, Wyckoff J, Condeelis J (2005) Cell migration in tumors. Curr Opin Cell Biol 17:559–564 36. Suresh S (2007) Biomechanics and biophysics of cancer cells. Acta Biomater 3:413–438 37. Mizuguchi H, Xu Z, Ishii-Watabe A et al (2000) IRES-dependent second gene expression is significantly lower than cap-dependent first gene expression in a bicistronic vector. Mol Ther 1:376–382

123