Inactivation of farnesyltransferase and ... - Nature

ã

Oncogene (2001) 20, 358 ± 366 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc

Inactivation of farnesyltransferase and geranylgeranyltransferase I by caspase-3: Cleavage of the common a subunit during apoptosis Ki-Woo Kim1,5, Hyun-Ho Chung2,5, Chul-Woong Chung1, In-Ki Kim1, Masayuki Miura3, Suyue Wang4, Hong Zhu4, Kyung-Duk Moon2, Geun-Bae Rha2, Jy-Hyun Park2, Dong-Gyu Jo1, Ha-Na Woo1, Yu-Hyun Song1, Byung Ju Kim1, Junying Yuan4 and Yong-Keun Jung*,1 1

Department of Life Science, Kwangju Institute of Science and Technology, Puk-gu, Kwangju 500-712, Korea; 2Biotech Research Institute, LG Chem./Research Park, Taejeon, Korea; 3Department of Neuroanatomy, Osaka University Medical School, Osaka 565, Japan; 4Department of Cell Biology, Harvard Medical School, 240 Longwood Avenue, Boston, Massachusetts, MA 02115, USA

Caspase plays an important role in apoptosis. We report here that farnesyltransferase/geranylgeranyltransferase (FTase/GGTase)-a, a common subunit of FTase (a/ bFTase) and GGTase I (a/bGGTase), was cleaved by caspase-3 during apoptosis. FTase/GGTase-a (49 kDa) was cleaved to 35 kDa (p35) in the Rat-2/H-ras, W4 and Rat-1 cells treated with FTase inhibitor (LB42708), antiFas antibody and etoposide, respectively. This cleavage was inhibited by caspase-inhibitors (YVAD-cmk, DEVDcho). Serial N-terminal deletions and site-directed mutagenesis showed that Asp59 of FTase/GGTase-a was cleaved by caspase-3. The common FTase/GGTasea subunit, but not the b subunits, of the FTase or GGTase I protein complexes puri®ed from baculovirusinfected SF-9 cells was cleaved to be inactivated by puri®ed caspase-3. In contrast, FTase mutant protein complex [(D59A)a/bFTase] was resistant to caspase-3. Expression of either the cleavage product (60-379) or anti-sense of FTase/GGTase-a induced cell death in Rat2/H-ras cells. Furthermore, expression of (D59A)FTase/ GGTase-a mutant signi®cantly desensitized cells to etoposide-induced death. Taken together, we suggest that cleavage of prenyltransferase by caspase contributes to the progression of apoptosis. Oncogene (2001) 20, 358 ± 366. Keywords: apoptosis; caspase; farnesyltransferase; geranylgeranyltransferase Introduction Apoptosis is a highly regulated cellular suicide mechanism that controls development and homeostasis in multicellular organisms. Inappropriate onset or defects in sensitivity to an apoptotic stimulus can give rise to a number of clinical conditions, including neurodegenerative disorders, autoimmunity, and cancer

*Correspondence: Y-K Jung 5 These two authors contributed equally to this work Received 25 September 2000; revised 9 November 2000; accepted 9 November 2000

(O'Reilly and Strasser, 1999; Tatton and Olanow, 1999; Zhivotovsky et al., 1999). Caspases, a highly conserved family of cysteine proteases, play a critical role in mammalian cell death (Yuan et al., 1993). Thus far, 14 members of the caspase family have been identi®ed, each with distinct substrate recognition properties (Alnemri et al., 1996; Humke et al., 1998; Ahmad et al., 1998). The critical role of caspases in apoptosis has been shown in cell culture and animal models with inhibitors or caspase mutation. Caspase inhibitors have been shown to suppress apoptosis induced by various signals including Fas, tumor necrosis factor (TNF)-a, growth factor withdrawal, etoposide, or disruption of the extracellular matrix (Thornberry and Lazebnik, 1998; Nunez et al., 1998). In addition, caspase-3, -9, and -12 (7/7) mutant mice show decreased apoptosis, resulting in altered nervous system development (Kuida et al., 1996, 1998; Hakem et al., 1998; Nakagawa et al., 2000). Caspases are synthesized as inactive proenzymes and activated to speci®cally cleave both relevant cellular substrates and zymogens to progress apoptosis (Margolin et al., 1997; Thornberry and Lazebnik, 1998; Nicholson, 1999). Thus, a key to understand the molecular basis of apoptosis likely lies in the identi®cation and characterization of critical caspase substrates. Identi®ed caspase substrates include the ICAD (Sakahira et al., 1998), amyloid-b precursor protein (Gervais et al., 1999), the retinoblastoma gene product (Janicke et al., 1996) and gelsolin (Kothakota et al., 1997). While it is known that in some cases proteolysis activates caspase substrates and in others it inactivates or destroys them, the crucial substrate proteins that coordinate cell death are as yet uncharacterized. Protein prenylation, which is catalyzed by FTase and GGTase, modi®es and regulates the activity of many proteins important for cell proliferation and survival, including Ras, Rho, and brain type I inositol 1, 4, 5triphosphate 5-phosphatase (Zhang and Casey, 1996; De Smedt et al., 1996). Inhibition of prenylation with inhibitors including FTI, GGTI-298, or lovastatin has recently shown to cause growth arrest and promote apoptosis (Bernhard et al., 1996; Jansen et al., 1997;

Cleavage of protein prenyltransferase by caspase-3 K-W Kim et al

Suzuki et al., 1998; Stark et al., 1998; Du et al., 1999; Sun et al., 1999; Ghosh et al., 1999; Du and Prendergast, 1999; Feldkamp et al., 1999), suggesting that prenylation is an important step in the survival signaling cascade. Here we show that FTase/GGTasea, a common subunit of heterodimeric FTase (a/bFTase) and GGTase I (a/bGGTase), is cleaved by caspase-3 in vitro and in vivo to be inactivated during apoptosis, which may help us to understand how the prenylation signaling responds to apoptosis.

Results FTase/GGTase-a subunit is cleaved by caspase during apoptosis In order to evaluate FTase/GGTase-a as a potential caspase substrate, proteolytic cleavage of FTase/ GGTase-a was examined during apoptosis. W4 cells, a mouse lymphoma cell line expressing the Fas receptor, were induced to undergo apoptosis by treatment with anti-Fas antibody (Jo-2). After determining cell viability, cell lysates were prepared to examine the cleavage of FTase/GGTase-a by Western blot analysis (Figure 1). Viability of the W4 cells was 88% at 1 h and decreased to 18% at 4 h after treatment with anti-Fas antibody (Figure 1a). The cleavage of full-length (49 kDa) FTase/GGTase-a

protein into a 35 kDa fragment (DFT/GGT-a) was ®rst detected in cells showing 88% viability. The cleavage pattern of FTase/GGTase-a was further examined in Rat-1 and Rat-2 ®broblasts transformed with oncogenic H-ras (Rat-2/H-ras) (Figure 1b,c). Incubation of Rat-1 cells with etoposide readily induced cleavage of FTase/GGTase-a, which was already detectable in cells with 94% viability (Figure 1b). Exposure of Rat-2/H-ras cells to FTase inhibitor (FTI: LB42708, IC50=2.5 nM) produced a 35 kDa fragment in apoptotic cells (50% viability at 10 mM FTI) (Figure 1c). These results indicate that FTase/ GGTase-a subunit is cleaved during Fas-, etoposide-, and FTI-mediated apoptosis. To investigate whether FTase/GGTase-a was cleaved by caspase, W4 cells were incubated with Jo-2 antibody in the presence of YVAD-cmk or DEVD-cho (Figure 1a). Preincubation of W4 cells with caspase inhibitor suppressed Fas-mediated apoptosis (viability, 18 to 84 ± 87%) and the cleavage of FTase/GGTase-a in the cells, indicating that FTase/GGTase-a is cleaved by caspases in the apoptotic cells. Examination of proteolytic activation of caspase with Western blot analysis showed that caspase-3 was activated in W4 cells showing 88% viability (Figure 2) and preincubation of cells with YVAD-cmk inhibited proteolytic processing of caspase-3. In contrast, addition of DEVD-cho, which suppressed the cleavage of FTase/ GGTase-a (Figure 1a), did not inhibit the processing of

359

Figure 1 Cleavage of the a subunit of the prenyltransferase, FTase and GGTase I, by caspase during apoptosis. (a) FTase/ GGTase-a (FT/GGT-a) cleavage by caspase in W4 cells undergoing apoptosis. W4 cells were preincubated with or without 100 mM YVAD-cmk (YVAD) or DEVD-cho (DEVD) for 2 h and then treated with 300 ng/ml anti-mouse Fas antibody (Jo-2) for 0, 1, 2 and 4 h. Cell lysates were analysed by Western blot using anti-FTase/GGTase-a antibody. For each time point, the corresponding cell viability, as determined with trypan blue assay, is indicated at the top. DFT/GGT-a indicates the truncated 35 kDa fragment of FTase/GGTase-a. (b) Cleavage of FTase/GGTase-a in Rat-1 cells. Rat-1 cells were incubated for the times indicated at the top with etoposide (30 mM) and analysed for cell viability and cleavage of FTase/GGTase-a. (c) Rat-2/H-ras cells were treated with 5 or 10 mM FTase inhibitor (FTI: LB42708) for 8 h (lanes 2,3) and recombinant FTase/GGTase-a subunit was incubated with 10 nM caspase-3 (casp-3) (lane 5). The reaction products were examined for the cleavage of FTase/GGTase-a with Western blot analysis Oncogene


360

Figure 2 Proteolytic activation of caspase-3 in W4 cells undergoing apoptosis. W4 cells were treated with anti-Jo-2 antibody in the presence or absence of 100 mM caspase inhibitors (YVAD-cmk and DEVD-cho) and the cell lysates were examined for activation of caspase-3 by Western blot using anti-hamster caspase-3 and anti-tubulin antibodies. For each time point, the corresponding cell viability is indicated at the top. The size of the detected proteins is indicated (p32 and p18)

caspase-3, indicating that a YVAD-inhibitable protease may act upstream of caspase-3 to process caspase-3 into its active subunits. Mapping of FTase/GGTase-a cleavage site: Caspase-3 cleaves at Asp59 of FTase/GGTase-a To con®rm that a 35 kDa fragment (DFT/GGT-a) is a cleavage product of FTase/GGTase-a, COS-7 cells were transfected with rat FTase/GGTase-a tagged with hemagglutinin (HA) and exposed to etoposide or staurosporine (Figure 3). As shown in Figure 3b, anti-rat FTase/GGTase-a antibody only recognized the transfected rat FTase/GGTase-a and detected a 35 kDa fragment in the apoptotic COS-7 cells (Figure 3b, ®rst panel), indicating that a 35 kDa fragment is the cleavage product of rat FTase/GGTase-a. Whereas anti-HA antibody recognized only full-length FTase/ GGTase-a which was eciently cleaved (Figure 3b, second panel), no cleavage of FTase b subunit was observed (Figure 3b, third panel). Caspase cleavage requires an Asp residue at position+1 relative to the cleavage site in the recognition motif of caspase (Margolin et al., 1997). The antiFTase/GGTase-a antibody recognized the C-terminus of FTase/GGTase-a, indicating that cleavage occurred near the N-terminus. There are three Asp residues near the N-terminus of FTase/GGTase-a for the potential cleavage site. To determine the caspase cleavage site, three N-terminal deletions starting at each of these Asp residues in FTase/GGTase-a were constructed (Figure 3a). COS-7 cells were then transfected with these Nterminal deletions (DFT/GGT-a) and subsequently exposed to staurosporine or etoposide. Western blot analysis with anti-rat FTase/GGTase-a antibody showed that the 35 kDa fragment migrated between the Asp59 and Asp82 deletion constructs (Figure 3b). Because HA tag (16 amino acids) was attached at the N-terminus of the FTase/GGTase-a deletion, the HAtagged proteins were expected to migrate slower than the corresponding cleavage products. Oncogene

Figure 3 Determination of the FTase/GGTase-a cleavage site in COS-7 cells. (a) A schematic diagram of full size (FT/GGT-a), Nterminal deletions (DFT/GGT-a), and mutant (D59A)FT/GGT-a of FTase/GGTase-a containing HA at the N-terminus. Asp59 of FTase/GGTase-a was mutated to Ala in (D59A)FT/GGT-a. Numbers indicate Asp (D) positions in the primary sequence of FTase/GGTase-a and the arrow indicates the putative cleavage site (Asp59) of FTase/GGTase-a (54-GFLSLDS-60) by a caspase. (b) COS-7 cells were transfected with HA-pcDNA3 expressing either full size or serial N-terminal deletions of FTase/GGTase-a. After 24 h, cells were treated for 16 h with staurosporine (stauro. 1 mM) or etoposide (etopo. 60 mM) and then analysed for the cleavage of the transfected rat FTase/GGTase-a with Western blot: anti-rat FTase/GGTase-a antibody (®rst panel), anti-HA antibody (second panel), anti-rat FTase-b antibody (third panel), and anti-tubulin antibody (last panel). Asterisk (*) indicates the cleavage product (p35) of FTase/GGTase-a. (c) COS-7 cells transfected with FTase/GGTase-a or (D59A)FTase/GGTase-a mutant were exposed to staurosporine (1 mM) for 12 h and analysed for the cleavage with Western blot

We then replaced Asp59 with Ala using site-directed mutagenesis, and the resulting (D59A)FTase/GGTase-a mutant were expressed in COS-7 cells. Subsequent exposure to staurosporine failed to induce cleavage of the (D59A)FTase/GGTase-a mutant (Figure 3c). Therefore, Asp59 in FTase/GGTase-a may be the caspase cleavage site, though we could not observe apparent cleavage of D(1-53)FT/GGT-a. Incubation of 35Slabeled FTase/GGTase-a with bacteria extracts con-


taining activities of caspase-1, -3, -8, or -11 showed that caspase-3 substantially cleaved the 49 kDa FTase/ GGTase-a into 35 kDa fragment (Figure 4a). However, (D59A)FTase/GGTase-a mutant was found to be resistant to the cleavage by the puri®ed caspase-3 (Figure 4b), indicating that caspase-3 cleaves FTase/ GGTase-a at Asp59 in vitro. FTase and GGTase I enzymes are inactivated by caspase-3 In order to examine whether the cleavage aects FTase and GGTase I activities, FTase/GGTase-a subunit was co-expressed with FTase-b subunit (bFTase) or GGTase I-b subunit (bGGTase) in baculovirus infected SF-9 cells and puri®ed. The heterodimeric FTase (a/bFTase) and GGTase I (a/bGGTase) were incubated with caspase-3 and visualized with Coomassie blue staining after SDS ± PAGE (Figure 5a). Caspase-3 cleaved the common 49 kDa FTase/GGTase-a subunit into a 35 kDa fragment (lane 2 and 5), which was blocked by the caspase inhibitor DEVD-cho (lane 3 and 6). In contrast, the b subunits of FTase and GGTase I were not cleaved by caspase-3. The cleavage of FTase/ GGTase-a was con®rmed by Western blot analysis

Figure 4 Cleavage at Asp59 of FTase/GGTase-a by caspase-3 in vitro. (a) FTase/GGTase-a was translated in vitro in the presence of 35S-methionine and incubated with 4 ml (20 ± 25 mg) of E. coli extracts containing recombinant caspases (caspase-1, -3, -8 or -11). The reaction mixtures were separated by SDS ± PAGE and exposed to X-ray ®lm. The arrows indicate 35S-labeled cleavage product (p53 and N-terminal fragment). (b) Wild-type (FT/GGTa and mutant [(D59A)FT/GGT-a] of FTase/GGTase-a were labeled with 35S-methionine and incubated with puri®ed caspase-3 or -7 (10 nM)

using monoclonal antibodies to FTase/GGTase-a (data not shown). When enzyme activities of FTase and GGTase I were measured from the reaction mixtures, cleavage of FTase/GGTase-a subunit by caspase-3 abolished FTase and GGTase I activities in vitro (Figure 5b). FTase mutant [(D59A)a/bFTase] was then co-puri®ed by expressing (D59A)FTase/GGTase-a and FTase-b subunits together (Figure 6a). Incubation of the FTase mutant [(D59A)a/bFTase] with caspase-3 neither induced any cleavage of the (D59A)FTase/ GGTase-a mutant Figure 6b) and FTase-b subunit (Figure 6c) nor reduced FTase activity (Figure 6d).

361

Figure 5 Inactivation of FTase and GGTase I by caspase-3 in vitro. FTase (a/bFTase) and GGTase I (a/bGGTase) enzyme complexes were puri®ed from baculovirus-infected SF-9 cells as described in Materials and methods. (a) Caspase-3 cleaves only the shared a subunit of both FTase and GGTase I enzymes in vitro. After incubation with puri®ed caspase-3, reaction mixtures were subjected to SDS ± PAGE and visualized by Coomassie blue staining. Lane 1 and 4, FTase and GGTase I, respectively; lane 2 and 4, FTase and GGTase I incubated with 10 nM caspase-3; lane 3 and 6, FTase and GGTase I incubated with 10 nM caspase-3 in the presence of 500 nM DEVD-cho, respectively. (b) Caspase-3 inactivates the prenyltransferase. FTase and GGTase I were untreated or incubated with caspase-3 and each reaction mixture was assayed for prenyltransferase activity. Lane 1 and 3, FTase and GGTase I; lane 2 and 5, FTase and prenyltransferase activity. Lane 1 and 3, FTase and GGTase I; lane 2 and 4, FTase and GGTase I treated with 10 nM caspase-3. Bars represent means +s.d. from three independent experiments Oncogene


362

The notion that FTase/GGTase-a was cleaved in vitro and in vivo by caspase led us to investigate whether protein prenylation was reduced during apoptosis. We examined proteolytic processing of Ras at the C-terminal CAAX motif, which was induced by farnesylation, in Rat-2/H-ras cells upon treatment with etoposide (Figure 7). In the presence of lovastatin, which blocks Ras processing by inhibiting a rate limiting step in isoprenoid biosynthesis, unprocessed Ras protein migrated more slowly than the processed Ras of control cells. Treatment with 50 mM etoposide reduced Ras processing, indicating that Ras prenylation was reduced in cells undergoing apoptosis. Expression of the cleavage product or cleavage resistant mutant of FTase/GGTase-a affects cell viability We have then addressed whether overexpression of the cleavage product of the FTase/GGTase-a exerted eects on cell death (Figure 8a). While Rat-2/H-ras cells transfected with pcDNA3 (control), FTase/ GGTase-a (sense), or HA-tagged FTase/GGTase-a (sense) showed background levels of cell death (9 ±

11%), expression of FTase/GGTase-a (anti-sense) increased cell death twofold (22%). Interestingly, expression of D(1 ± 59)FTase/GGTase-a signi®cantly increased cell death rate to 18%. We then examined the eects of expression of the cleavage resistant mutant, (D59A)FTase/GGTase-a, on

Figure 7 Inhibition of Ras processing in cells undergoing apoptosis by treatment with etoposide. Rat-2/H-ras cells were incubated with lovastatin or etoposide for 2 h in the presence of 35 S-methionine. After additional incubation for 20 h, Ras was immunoprecipitated from cell extracts with monoclonal antibody (Y13-259), resolved by SDS ± PAGE, and then detected by autoradiography. P, processed; U, unprocessed; C, control; L, lovastatin (15 mM); lane 1, etoposide (50 mM); lane 2, etoposide (100 mM)

Figure 6 Resistance of the heterodimeric FTase mutant [mFTase: (D59A)a/bFTase)] to cleavage and inactivation by caspase-3. FTase (a/b/FTase) and FTase mutant [(D59A)a/bFtase)] were puri®ed and visualized with Coomassie-blue staining (a). Each protein complex was incubated with 10 nM caspase-3 and the reaction products were probed with Western blot using anti-FTase/GGTase-a antibody (b) and anti-FTase-b antibody (c). (d) Enzyme activities of FTase and FTase mutant exposed to caspase-3 were measured from three independent experiments and the activity obtained from wild-type FTase was set to 100 Oncogene


363

apoptosis. Rat-1 cells were transiently transfected with plasmids expressing FTase/GGTase-a or (D59A)FTase/ GGTase-a mutant and then exposed to etoposide (Figure 8b). Determination of cell viability showed that Rat-1 cells expressing (D59A)FTase/GGTase-a mutant became resistant to cell death compared to FTase/GGTase-a (21 and 31% of cell death, respectively). These results suggest that the cleavage of FTase/GGTase-a may contribute to progress of apoptosis. Discussion Inhibition of the protein prenylation step is known to cause tumor regression in transgenic mice (Barrington et al., 1998; Norgaard et al., 1999) and to induce apoptosis in vitro (Sun et al., 1995; Lebowitz et al., 1997; Miquel et al., 1997; Bernhard et al., 1998; Du et al., 1999) leading to development of a new class of anti-cancer drugs. In our results, prenylation appears to be required for prosurvival signals: While inhibition of prenylation activity with FTI or expression of antisense FTase/GGTase-a induced cell death, expression of the cleavage resistant FTase mutant attenuated cell death evoked by etoposide in Rat-1 and Rat-2/H-ras cells. We also observed inhibitory eects of apoptosis on the processing of Ras, caused probably by reducing the farnesylation, in apoptotic cells and inactivation of protein prenylation enzymes by caspase in vitro, implicating that in vivo cleavage of FTase/GGTase-a leads to inactivation of prosurvival function of prenylating enzymes and enhances or accelerates the apoptotic process. Of many substrates for prenylation, farnesylation and geranylgeranylation of Ras and Rho subfamily, respectively have been shown to exert survival eects on various apoptotic signals. For example, tumor cells and transformed cells expressing the ras oncogene are highly resistant to apoptosis induced by ionizing radiation, E1A, c-myc, or disruption of epithelial cellmatrix (anoikis) (Lin et al., 1995; McKenna et al., 1996; Kaumann-Zeh et al., 1997; Rosen et al., 2000), though Gulbins et al. (1996) reported that Ras is required for Fas-induced apoptosis. Inhibition of Ras prenylation may interfere with far down-stream apoptotic activities such as Bcl-2 family (Kinoshita et al., 1995; Scheid et al., 1999; Rosen et al., 2000). In addition, increasing numbers of evidences for the potential roles of the geranylgeranylated protein such as R-Ras, RhoA, Rac1 and Cdc42Hc in apoptosis have been accumulated (Miquel et al., 1997; Stark et al., 1998; Ghosh et al., 1999; Du et al., 1999). While both peptide inhibitors, YVAD-cmk and DEVD-cho, inhibited cleavage of FTase/GGTase-a during Fas-induced apoptosis of W4 cells, Western blot analysis showed that YVAD-cmk, but not DEVDcho, inhibited the proteolytic activation of caspase-3. This result suggests that YVAD-inhibitable protease is upstream of DEVD-sensitive caspase-3 (Figure 2), consistent with a delineation of caspase-cascade,

Figure 8 Eects of D(1 ± 59)FTase/GGTase-a and (D59A)FT/ GGT-a mutant expression on cell death. (a) Expression of the cleavage product, D(1 ± 59)FT/GGT-a, and anti-sense FTase/ GGTase-a induced apoptosis in Rat-2/H-ras cells. Rat-2/H-ras cells were transfected with both pbactgal expressing b-galactosidase and either pcDNA3 (control), FT/GGT-a, HA-FT/GGT-a, D(1 ± 59)FT/GGT-a, or FT/GGT-a (anti-sense). Cells were ®xed 2.5 days later, stained for b-galactosidase activity, and viability was determined based on cell morphology. Asterisk indicates the statistical signi®cance with respect to FT/GGT-a construct (F) (p50.05). (b) Expression of the cleavage-resistant (D59A)FT/ GGT-a mutant reduced cell death induced by etoposide. Rat-1 cells were transfected with both pbactgal and either pcDNA3 (control), FT/GGT-a, or (D59A)FT/GGT-a mutant. One day later, cells were treated with etoposide (60 mM) for 16 h and the viability of b-galactosidase-positive cells was determined based on cell morphology. Percentage of cell death is shown with mean+s.d. from four independent experiments and asterisk (*) indicates the statistical dierence with respect to FT/GGT-a construct (F) (P50.1) Oncogene


364

although the exact pathway of caspase cascade activation is not yet fully understood (Thornberry and Lazebnik, 1998; Nunez et al., 1998). DEVD-cho failed to suppress the proteolytic processing of caspase3 but might inhibit the cleavage of FTase/GGTase-a probably by inhibiting caspase-3 activity. Expression of the cleavage product of FTase/ GGTase-a (p35) increased cell death probably by interfering with the prenyl enzyme activities. The crystal structure of heterodimeric mammalian FTase determined at 2.25AÊ resolution showed that, although the Nterminal proline rich domain of the a-subunit (residue 1 to 54) is disordered in the crystal, two 310 helices (55 ± 69 and 70 ± 73) and a short b-strand (89 ± 91) are important for forming a stable heterodimeric complex (Park et al., 1997; Park and Beese, 1997), implying that cleavage of the common a subunit at the residue Asp59 results in disruption of heterodimerization and consequently inactivation of the enzymes. In addition, we have examined interaction between FTase and Ras and mapped the region of the FTase/GGTase-a subunit that is responsible for binding to Ras using peptide competition experiments (manuscript in preparation). Two peptides, including residues 25 ± 46 and 49 ± 70 of FTase/GGTase-a, inhibited farnesylation of Ras by FTase, suggesting that the N-terminal region containing these two peptide sequences may be involved in the binding to Ras. Although we cannot rule out the possibility that cleavage products of FTase/GGTase-a may interact with other unidenti®ed prenylationindependent signaling pathways, our results imply that the N-terminus of FTase/GGTase-a is important for catalytic activity of the enzyme complexes and thus, that cleavage of FTase/GGTase-a during apoptosis facilitates apoptosis by blocking a prenylation-dependent survival signal. An analysis of prenylation-downstream events will help to further clarify the biological signi®cance of these observations in apoptosis.

Materials and methods Reagents Acetyl-Tyr-Val-Ala-Asp-chloromethylketone (YVAD-cmk) and acetyl-Asp-Glu-Val-Asp-aldehyde (DEVD-cho) were obtained from Bachem (Torrance, CA, USA). Etoposide, staurosporine, and all others were purchased from Sigma (St. Louis, MO, USA). Anti-mouse Fas antibody (Jo-2) and FTase inhibitor (LB42708) were obtained from Pharmingen (San Diego, CA, USA) and LG Chem. (Taejeon, Korea), respectively. Plasmid construction cDNAs for the human FTase/GGTase-a, FTase-b and GGTase I-b subunits were cloned by reverse transcriptionpolymerization chain reaction (PCR) from human Colo205 cells. Full-length and N-terminal deletions of rat FTase/ GGTase-a were generated by PCR with the primers either one of CCCGAATTCATGGCGGCCACTGAG (fulllength), CCCGAATTCGGGTTTCTGAGCCTG (D1 ± 53), Oncogene

CCCGAATTCTCGCCCACCTATGTC (D1 ± 59), or CCCGAATTCGGCCCCAGTCCAGTG (D1 ± 82), respectively, and CGCTCTAGAGTCCACTTCTTCCAGCC. PCR products were subcloned into the EcoRI and XbaI sites of HApcDNA3 and pcDNA3 (Invitrogen) for transfection and in vitro transcription/translation. Full-length human FTase/ GGTase-a was also inserted between the NdeI and XhoI sites of pBacPAK8 (Clontech) for construction of a recombinant baculovirus (pBP8 ± FT/GGTa). FTase-b and GGTase-b were similarly inserted into pBacPAK8 to yield pBP8-FTb and pBP8-GGTb, respectively. A FTase/GGTasea (D59A) mutant was constructed by site-directed mutagenesis using Gene Editor mutagenesis system (Promega) and a synthetic oligonucleotide containing the mutation (GGTTTGTGAGCCTGGCCTCGCCCTCCTTATTC). Caspase cDNAs were ampli®ed by PCR using oligonucleotide primers CGCGGATCCTGGCACATTTCCAGGAC and CGCGGATCCTAAGGAAGTATTGGC for p30 domain of mouse caspase-1, CGCGGATCCGGAGAACACTGAAAACTC and CTCGGATCCTACCATCTTCTCACTTGG for full-length of human caspase-3, and CGGGATCCTAGTGAATCACAGACTTTG and CCGCAAGCTTATCAGAAGGGAGACAAG for p30 domain of human caspase-8. The PCR products were subcloned into the BamHI site (caspase-1 and -3) or the BamHI and HindIII sites (caspase-8) of pET15b (Novagen). The EcoRI fragment of caspase-11 cDNA derived from pBSNO12 was inserted into pTrcHis (Introgen). All PCR products were con®rmed by DNA sequencing. Cell culture, DNA transfection, and apoptosis assay Sf-9 cells were obtained from ATCC (American Type Culture Collection) and maintained in Grace's medium (GIBCO), supplemented with 3.3 mg/ml lactoalbumin hydrolysate (Difco), 3.3 mg/ml yeasttolate (Difco), 10% (v/v) fetal calf serum (FCS) (Hyclone Laboratories ), 50 mg/ml Gentamycin, and 0.1% Pluronic F-68 (GIBCO) in 125 ml Spinner ¯asks (Techne, Princeton, NJ, USA). W4 cells were grown in RPMI-1640 medium (Life Technologies, Inc.) supplemented with 10% FCS. Rat-1, Rat-2/H-ras, and Cos-7 cells were grown in Dulbecco's Modi®ed Eagle Medium (DMEM) (Life Technologies, Inc.) with 10% FCS. Cells were subcultured at a density of 26105 per well in 6 well dishes 1 day before transfection. For each well, 1 mg of DNA and 8 mg of lipofectamine reagent (Life Technologies, Inc.) were used following a protocol from Gibco. To induce apoptosis, cells were treated with 300 ng/ml anti-Fas antibody (Jo-2), etoposide (60 mM), staurosporine (1 mM), and FTI (LB42708), and cell viability was determined with 0.4% trypan blue staining or FACS analysis. Production of recombinant virus To generate recombinant baculovirus. Sf-9 cells (26106) were transfected with 0.5 mg/ml of BaculoGold wild-type viral DNA (Pharmingen) and each 2 mg of pBP8-FT/GGTa or pBP8-GGTb. The virus from each transfection was harvested after 4 days and screened using a plaque assay as described (Summers and Smith, 1998). Recombinant viruses obtained from this screen were subjected to two further rounds of plaque puri®cation. Expression and purification of prenyl protein transferases in Sf-9 cells Puri®ed recombinant viruses were used to infect Sf-9 cells at a multiplicity of infection of 2. Cells were harvested 48 h


post-infection by centrifugation at 8006g for 15 min, washed once with phosphate-buered saline (PBS), and the resulting cell pellet was ¯ash-frozen in a dry ice/ethanol bath. Cell extracts were prepared by thawing the cell suspension in 5 volumes of 20 mM Tris-HCl (pH 8.0), 1 mM EGTA, 1 mM DTT and by incubating the suspension on ice for 1 h, followed by homogenization in a Dounce homogenizer. The resulting extract was centrifuged for 1 h at 30 0006g, and the supernatant containing each prenyl protein transferase was subjected to column chromatography as described previously with minor modi®cations (Reiss et al., 1990). Both FTase and GGTase I were puri®ed to essential homogeneity. Preparation of cell lysates, antibodies, and Western blot anlaysis Cell lysates were prepared and analysed by Western blot as described previously (Jung et al., 1996) using anti-mouse (Y53) or anti-human (C-19) FTase/GGTase-a and anti-FTase-b antibodies (SC-137) (Santa Crutz). Human and hamster CPP32 monoclonal antibodies were from Transduction Laboratory (Lexington, KY, USA) and Dr J Goldstein (Cornell University), respectively. Anti-a-tubulin and anti-HA antibodies were purchased from Sigma and Boehringer Mannheim, respectively. In vitro caspase cleavage reaction For preparation of caspase extracts, bacterial plasmids expressing caspase were transformed into E. coli BL21(DE3). Exponentially growing cells were induced with 0.2 mM isopropyl-1-thio-a-D-galactopyranoside (IPTG) for 2 h, harvested, and lyzed by sonication in a buer containing 0.05% Nonidet P-40, 20 mM HEPES (pH 7.4) and 100 mM NaCl. The lysates were cleared by centrifugation and the protein concentration was determined with the Bio-Rad protein assay. When necessary, caspase-3 and -7 were puri®ed on Ni-agarose from bacterial extracts. Proteins from the plasmids were translated in vitro using the TNT system (Promega) in the presence of 35S-methionine (Amersham). In vitro cleavage assay reactions were performed in a buer

containing 0.5% Nonidet P-40, 20 mM HEPES (pH 7.4), 100 mM NaCl, and 20 mM DTT for 1 h at 378C and cleavage products were separated by SDS ± PAGE and detected by autoradiography.

365

FTase and GGTase I assay Prenyltransferase activity was determined by quantitating the amount of [3H]prenyl diphosphate, farnesyl diphosphate, or geranylgeranyl diphosphate incorporated into Ras proteins (Reiss et al., 1992). The standard reaction mixture contained the following components in a ®nal volume of 50 ml; 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 5 mM ZnCl2, 2 mM DTT, 4 mM Ras-CVLS (for FTase) or RAS-CVIL (for GGTase I) proteins, 2 mM [3H]prenyl diphosphate (typically at 2000 c.p.m./pmol), and the reaction mixtures containing 0.2 mg of FTase or GGTase I were incubated for 15 min at 378C with or without caspase-3.

Abbreviations FTase, farnesyltransferase; FTI, farnesyltransferase inhibitor; GGTase I, geranylgeranyltransferase I; YVAD-cmk, acetyl-Tyr-Val-Ala-Asp-chloromethylketone; DEVD-cho, acetyl-Asp-Glu-Val-Asp-aldehyde; DMEM, Dulbecco's Modi®ed Eagle Medium; FCS, fetal calf serum; PCR, polymerase chain reaction; SDS ± PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; PBS, phosphate buered saline; HA, hemagglutinin.

Acknowledgments We thank S Nagata and J Goldstein for W4 cells and hamster caspase-3 antibody, respectively. We thank N Spoerel for critical reading of this manuscript. This work was supported by Brain Korea 21 project and in part by grants from the KOSEF (97-0401-07-01-5) and Molecular Medicine Research.

References Ahmad M, Srinivasula SM, Hedge R, Mukattash R, Fernandes-Alnemri T and Alnemri ES. (1998) Cancer Res., 58, 5201 ± 5205. Alnemri ES, Livingston DJ, Nicholson DW, Salvesen G, Thornberry NA, Wong WW and Yuan J. (1996). Cell, 87, 171. Barrington RE, Subler MA, Rands E, Omer CA, Miller PJ, Hundley JE, Koester SK, Troyer DA, Bearss DJ, Conner MW, Gibbs JB, Hamilton K, Koblan KS, Mosser SD, O'Neil TJ, Schaber MD, Senderak ET, Windle JJ, Oli A and Kohl NE. (1998). Mol. Cell. Biol., 18, 85 ± 92. Bernhard EJ, Kao G, Cox AD, Sebti SM, Hamilton AD, Muschel RJ and McKenna WG. (1996). Cancer Res., 56, 1727 ± 1730. Bernhard EJ, McKenna WG, Hamilton AD, Sebti SM, Qian Y and Muschel RJ. (1998). Cancer Res., 58, 1754 ± 1761. De Smedt F, Boom A, Pesesse X, Schimann SN and Erneux C. (1996). J. Biol. Chem., 271, 10419 ± 10424. Du W, Lu A and Prendergast GC. (1999). Cancer Res., 59, 4208 ± 4212. Du W and Prendergast GC. (1999). Cancer Res., 59, 5492 ± 5496.

Feldkamp MM, Lau N and Guha A. (1999). Oncogene, 18, 7514 ± 7526. Gervais FG, Xu D, Robertson GS, Vailancourt JP, Zhu Y, Huang J, LeBlanc A, Smith D, Rigby M, Shearman MS, Clark EE, Zheng H, Van Der Poleg LH, Ryolo SC, Thornberry NA, Xanthodarkis S, Zamboni RJ, Roy S and Nicholson DW. (1999). Cell, 97, 395 ± 406. Ghosh PM, Ghosh-Choudhury N, Moyer ML, Mott GE, Thomas CA, Foster BA, Greenberg NM and Kreisberg JI. (1999). Oncogene, 18, 4120 ± 4130. Gulbins E, Coggeshall KM, Brenner B, Schlottman K, Linderkamp O and Lang F. (1996). J. Biol. Chem., 271, 26390 ± 26394. Hakem R, Hakem A, Duncan GS, Henderson JT, Woo M, Soengas MS, Elia A, de la Pompa JL, Kagi D, Khoo W, Potter J, Yoshida R, Kaufman SA, Lowe SW, Penninger JM and Mak TW. (1998). Cell, 94, 339 ± 352. Humke EW, Ni J and Dixit VM. (1998). J. Biol. Chem., 273, 15702 ± 15707. Janicke RU, Walker PA, Lin XY and Porter AG. (1996). EMBO J., 15, 6969 ± 6978. Oncogene


366

Oncogene

Jansen B, Schlagbauer-Wadl H, Eichler HG, Wol K, van Elsas A, Schrier PI and Pehamberger H. (1997). Cancer Res., 57, 1846 ± 1850. Jung Y-K, Miura M and Yuan J. (1996). J. Biol. Chem., 271, 5112 ± 5117. Kaumann-Zeh A, Rodriguez-Viciana P, Ulrich E, Gilbert C, Coer P, Downward J and Evan G. (1997). Nature, 385, 544 ± 548. Kinoshita T, Yokota T, Arai K and Miyajima A. (1995). Oncogene, 10, 2207 ± 2212. Kothakota S, Azuma T, Reinhard C, Klippel A, Tang J, Chu K, McGarry TJ, Kirschner MW, Koths K, Kwiatkowski DJ and Williams LT. (1997). Science, 278, 294 ± 298. Kuida K, Zheng TS, Na S, Kuan C-Y, Yang D, Karasuyama H, Rakic P and Flavell RA. (1996). Nature, 384, 368 ± 372. Kuida K, Haydar TF, Kuan CY, Gu Y, Taya C, Karasuyama H, Su MS, Rakic P and Flavell RA. (1998). Cell, 94, 325 ± 337. Lebowitz PF, Sakamuro D and Prendergast GC. (1997). Cancer Res., 57, 708 ± 713. Lin HJ, Eviner V, Prendergast GC and White E. (1995). Mol. Cell. Biol., 15, 4536 ± 4544. Margolin N, Raybuck SA, Wilson KP, Chen W, Fox T, Gu Y and Livingston DJ. (1997). J. Biol. Chem., 272, 7223 ± 7228. McKenna WG, Bernhard EJ, Markiewicz DA, Rudoltz MS, Maity A and Muschel RJ. (1996). Oncogene, 12, 237 ± 245. Miquel K, Pradines A, Sun J, Qian Y, Hamilton AD, Sebti SM and Farve G. (1997). Cancer Res., 57, 1846 ± 1850. Nakagawa T, Zhu H, Morishima N, Li E, Xu J, Yankner BA and Yuan J. (2000). Nature, 403, 98 ± 103. Nicholson DW. (1999). Cell Death Dier., 6, 1028 ± 1042. Norgaard P, Law B, Joseph H, Page DL, Shyr Y, Mays D, Pietenpol JA, Kohl NE, Oli A, Coer JR, Poulson HS and Moses HL. (1999). Clin. Cancer Res., 5, 35 ± 42. Nunez G, Benedict MA, Hu Y and Inohara N. (1998). Oncogene, 17, 3237 ± 3245.

O'Reilly LA and Strasser A. (1999). In¯amm. Res., 48, 5 ± 21. Park HW and Beese LS. (1997). Curr. Opin. Struct. Biol., 7, 873 ± 880. Park HW, Boduluri SR, Moomaw JF, Casey PJ and Beese LS. (1997). Science, 275, 1800 ± 1804. Reiss Y, Brown MS and Goldstein JL. (1992). J. Biol. Chem., 267, 6403 ± 6408. Reiss Y, Goldstein L, Seabra MC, Casey PJ and Brown MS. (1990). Cell, 62, 81 ± 88. Rosen K, Rak J, Leung T, Dean NM, Kebel RS and Filmus J. (2000). J. Cell. Biol., 149, 447 ± 456. Sakahira H, Enari M and Nagata S. (1998). Nature, 391, 96 ± 99. Scheid MP, Schubert KM and Duronio V. (1999). J. Biol. Chem., 274, 31108 ± 31113. Stark Jr WW, Blaskovich MA, Johnson BA, Qian Y, Vasudevan A, Pitt B, Hamilton AD, Sebti SM and Davies P. (1998). Am. J. Physiol., 275, 55 ± 63. Summers MD and Smith GE. (1998). Texas Agric. Exp. St. Bull., 1555, 29 ± 31. Sun J, Qian Y, Chen Z, Marfurt J, Hamilton AD and Sebti SM. (1999). J. Biol. Chem., 274, 6930 ± 6934. Sun J, Qian Y, Hamilton AD and Sebti SM. (1995). Cancer Res., 55, 4243 ± 4247. Suzuki N, Urano J and Tamanol F. (1998). Proc. Natl. Acad. Sci. USA, 95, 15356 ± 15361. Tatton WG and Olanow CW. (1999). Biochem. Biophys Acta., 1410, 195 ± 213. Thornberry NA and Lazebnik Y. (1998). Science, 281, 1312 ± 1316. Yuan J, Shaham S, Ledoux S, Ellis HM and Horvitz HR. (1993). Cell, 75, 641 ± 651. Zhang FL and Casey PJ. (1996). Annu. Rev. Biochem., 65, 241 ± 269. Zhivotovsky B, Joseph B and Orrenius S. (1999). Exp. Cell. Res., 248, 10 ± 17.