Inactivation of Phaeodactylum tricornutum urease gene using

Plant Biotechnology Journal (2014), pp. 1–11

doi: 10.1111/pbi.12254

Inactivation of Phaeodactylum tricornutum urease gene using transcription activator-like effector nuclease-based targeted mutagenesis Philip D. Weyman1, Karen Beeri2, Stephane C. Lefebvre2, Josefa Rivera2, James K. McCarthy2, Adam L. Heuberger3, Graham Peers4, Andrew E. Allen2,5 and Christopher L. Dupont2,* 1

Department of Synthetic Biology and Bioenergy, J. Craig Venter Institute, La Jolla, CA, USA

2

Department of Microbial and Environmental Genomics, J. Craig Venter Institute, La Jolla, CA, USA

3

Proteomics and Metabolomics Facility, Colorado State University, Fort Collins, CO, USA

4

Department of Biology, Colorado State University, Fort Collins, CO, USA

5

Scripps Institution of Oceanography, Integrative Oceanography Division, La Jolla, CA, USA

Received 10 January 2014; revised 22 July 2014; accepted 6 August 2014. *Correspondence (tel +858-200-1886; fax +858 200 1880; email [email protected])

Keywords: diatoms, genome editing, urease, metabolomics, Phaeodactylum tricornutum, transcription activator-like effector nucleases.

Summary Diatoms are unicellular photosynthetic algae with promise for green production of fuels and other chemicals. Recent genome-editing techniques have greatly improved the potential of many eukaryotic genetic systems, including diatoms, to enable knowledge-based studies and bioengineering. Using a new technique, transcription activator-like effector nucleases (TALENs), the gene encoding the urease enzyme in the model diatom, Phaeodactylum tricornutum, was targeted for interruption. The knockout cassette was identified within the urease gene by PCR and Southern blot analyses of genomic DNA. The lack of urease protein was confirmed by Western blot analyses in mutant cell lines that were unable to grow on urea as the sole nitrogen source. Untargeted metabolomic analysis revealed a build-up of urea, arginine and ornithine in the urease knockout lines. All three intermediate metabolites are upstream of the urease reaction within the urea cycle, suggesting a disruption of the cycle despite urea production. Numerous high carbon metabolites were enriched in the mutant, implying a breakdown of cellular C and N repartitioning. The presented method improves the molecular toolkit for diatoms and clarifies the role of urease in the urea cycle.

Introduction One of the most important recent advancements of eukaryotic genetics is the development of targeted genome editing. These techniques were first enabled by sequence-specific zinc finger nucleases (ZFNs) (Durai et al., 2005; Miller et al., 2007), and progress has greatly accelerated with the development of the easilyconstructed transcription activator-like effector nucleases (TALENs) (Christian et al., 2010; Esvelt and Wang, 2013). These chimeric enzymes consist of both a transcription activator-like effector (TALE) domain that binds DNA and a nuclease domain. Originally identified in Xanthomonas plant pathogens, TALEs are characterized by a repeated 34-amino acid sequence that recognizes specific DNA sequences (Kay et al., 2007). Their utility for genome editing arises from the TALEs’ alterable specificity that can be manipulated by the researcher to bind to sequences of interest. The standard and frequently used TALEN design incorporates the FokI nuclease at the C-terminus of the chimeric protein (Sanjana et al., 2012). Because FokI functions as a dimer, two TALENs must be engineered such that their binding sites allow for the dimerization of the fused FokI domains and subsequent cleavage of the DNA. Transcription activator-like effector nucleases (TALENs) have been reported to facilitate the genome editing in a variety of

eukaryotic species (Li et al., 2012; Sander et al., 2011; Tesson et al., 2011; Wood et al., 2011) and have recently been described for mutagenesis of Phaeodactylum tricornutum (Daboussi et al., 2014). Phaeodactylum tricornutum is an important model algal species for both ecological and biotechnological studies. Its attractive features include a compact, well-assembled genome (27.4 Mb) (Bowler et al., 2008) and the availability of multiple transcriptomic and proteomic data sets (Allen et al., 2008; Bertrand et al., 2012; Hockin et al., 2012; Hook and Osborn, 2012). A well-established genetic transformation system has enabled over-expression or down-expression of target genes in P. tricornutum (Allen et al., 2011; Apt et al., 1996; De Riso et al., 2009; Siaut et al., 2007); however, these techniques rely on random insertions into the nuclear genome which, due to the potential for high variability of target gene expression in the resulting transgenic lines, provide limited utility for loss of function studies as complete elimination of target protein expression is rarely achieved. Transcription activator-like effector nucleases (TALENs) are used in two ways to create targeted mutants: (i) TALENs expressed in the nucleus generate sequence-specific, doublestranded DNA breaks, which may be subsequently repaired by nonhomologous end joining (NHEJ), often concomitant with an

Please cite this article as: Weyman, P.D., Beeri, K., Lefebvre, S.C., Rivera, J., McCarthy, J.K., Heuberger, A.L., Peers, G., Allen, A.E., and Dupont C.L. (2014) Inactivation of Phaeodactylum tricornutum urease gene using transcription activator-like effector nuclease-based targeted mutagenesis. Plant Biotechnol. J., doi: 10.1111/pbi.12254

ª 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

1

2 Philip D. Weyman et al. insertion or deletion (indel) mutation (Reyon et al., 2012) and (ii) A second strategy combines TALEN expression with homologous recombination (HR) to interrupt the target site and insert an antibiotic resistance marker. This method requires the cointroduction of a second DNA construct consisting of the antibiotic resistance cassette flanked by sequences homologous to both sides of the TALENs’ target cut site. The NHEJ-mediated process results in a mutant that is unmarked and must be identified by phenotype or highthroughput genotyping methods (Sanjana et al., 2012), and an advantage to the HR-mediated insertional strategy is easy PCRbased screening for mutants. To investigate TALEN-based genome editing in P. tricornutum, the urease enzyme (Pt_29702 [JGI]), a nickel-containing metalloenzyme that degrades urea to ammonia and carbon dioxide (Rees and Bekheet, 1982), was chosen as the initial target. It is encoded by a single-copy open reading frame, and antisera against urease in P. tricornutum has been generated in our laboratory. Exogenous urea serves as an important source of nitrogen to diatoms (Wafar et al., 1995). The presence of a complete urea cycle in marine diatoms (Allen et al., 2011) raises the possibility that urease may also be important in recycling endogenously produced urea. While removal of nickel from the media can essentially ‘knockout’ urease function (Price and Morel, 1991; Rees and Bekheet, 1982), the recent discovery of a nickel-containing superoxide dismutase in eukaryotic algae, including P. tricornutum (Cuvelier et al., 2010; Dupont et al.,

2008), suggests that nickel deprivation knockout would likely affect both enzymes simultaneously. Due to potential unknown and indirect effects nickel starvation might have on metabolism, the engineering of a gene-specific, insertional mutant is necessary to elucidate the role of urease in P. tricornutum. A recent study has outlined the use of TALENs in P. tricornutum to generate mutants by NHEJ-mediated repair (Daboussi et al., 2014); here, we outline the use of TALENs in P. tricornutum to generate targeted insertional mutants based on HR. We tested the technology by knocking out the urease gene using the TALEN techniques described below, and we demonstrate the recovery of desired P. tricornutum transgenic lines. Additionally, we characterize the resulting genomic architecture at the urease locus, the urease protein expression, and the growth and metabolic phenotypes of our resulting transgenic lines.

Results and discussion To interrupt the urease gene (Pt_29702) in P. tricornutum, we created two plasmids—one expressing the TALENs and the other containing a selectable marker cassette flanked by homologous sequence to the target site—that were cotransformed into P. tricornutum by particle bombardment (Figure 1). The first plasmid was designed to coexpress both the upstream- and downstream-engineered TALENs on a single plasmid (Figure 1). After assembly of the TALENs with sequence-specific repeats, the two TALEN genes were amplified by PCR and assembled into the

(a)

(b)

(c)

(d)

(e)

Figure 1 TALEN assembly strategy. TALENs were assembled by combining repeat monomers (short red lines) into hexamers (a, longer red lines) according to previously described protocols (Sanjana et al., 2012). Three hexamers were combined with TALEN backbones (black with orange broken arrow) to create a full-length TALEN coding region with customized binding sites (b). The fully assembled TALEN coding region consists of an N- and C-terminus of the transcription activator-like effector (TALE) region (orange), the designed repeat region (red) and the FokI domain (purple). After DNA sequencing to confirm correct TALEN sequence, two TALENs (binding to an upstream and a downstream position relative to the target site) were each amplified by PCR and assembled into the dual expression vector, pTH (c). Plasmid pTH contains the FcpB promoter (left, green curved arrow), the FcpF promoter (right, green curved arrow) and two FcpA terminators (red hexagons). The yellow box shows a kanamycin resistance cassette to aid in assembly of the expression plasmid. TALENs encoded by pTH were then cobombarded into Phaeodactylum tricornutum along with the plasmid containing a ‘knockout (KO) cassette’ designed to recombine at the TALEN target site inactivating the urease gene (d). The cassette was designed by assembling two PCR fragments (dark blue) each containing 1 kbp of urease sequence from the 50 and 30 sides of the target site on either side of an ShBle expression cassette (light blue). The resulting mutants should have the ShBle inserted at the target site within the urease coding region (green arrow) (e). ª 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 1–11

TALEN-based P. tricornutum mutagenesis 3

Figure 2 Selection of TALEN binding sequences for urease knockout. A region in approximately the centre of the urease coding region was selected as described in the text. The 59 nt region consisted of 20 nt for the upstream TALEN (yellow), a 19 nt spacer where nuclease cleavage is presumed to occur, and 20 nt for the downstream TALEN (green). The downstream TALEN was designed to the bottom strand to allow the C-terminal FokI regions to dimerize. Homology regions flanking the antibiotic resistance cassette were designed to the regions outside the 59-nt binding region as described in the text (lower case).

dual expression vector, pTH, driven by the P. tricornutum FcpB and FcpF promoters (Bhaya and Grossman, 1993). The two TALENs were each designed to bind a 20-nt region separated by a 19-nt spacer where endonuclease cleavage was expected to occur (Figure 2). While the sense strand of DNA was used to design the forward TALEN, the downstream TALEN was designed using the antisense strand such that once the TALENs bind, the Cterminal FokI domains could dimerize. In selecting the TALEN binding regions within the urease gene, we used only the rule that each TALEN must begin with a ‘T’, and the search string ‘TN57-A’ was used to identify a potential TALEN target site at approximately mid-point within the urease coding region. The second plasmid (the ‘knockout plasmid’ or KO-plasmid) contained the ShBle expression cassette (Falciatore et al., 1999) flanked by 1 kbp of upstream and 1 kbp of downstream sequence that shares homology to the regions of the urease gene adjacent to the targeted cut site. The hypothesized mechanism was the following: (i) Both plasmids were transformed into the same cell, (ii) the TALENs were expressed from the first plasmid and cut the genomic DNA at the target site, and (iii) the KO-plasmid was recombined into the target site to create the desired gene disruption. Because the TALEN expression plasmid lacks a selectable marker, it can be lost over subsequent divisions if it is not integrated into the nuclear genome. Loss of the TALEN genes allows for a mutant with a clean background in which observed phenotypes may be more directly attributable to the engineered mutations and also permits multiple rounds of TALEN-based mutation provided antibiotic markers are available or can be recycled. Phaeodactylum tricornutum was transformed with either a combination of the urease TALEN coexpression vector and the KO-plasmid or with only the KO-plasmid. Colonies obtained from the transformations were patched on L1+ phleomycin plates and subsequently screened by PCR using primers outside of the 1-kbp homology regions found on the KO-plasmid (Figure 3a). Thus, a 2-kbp PCR product was expected for wild-type (WT) urease sequence, while a 3.4 kbp PCR product was expected for an insertional mutant. Representative results are shown in Figure 3b for the TALEN + KO-plasmid cotransformation and in Figure 3c for KO-plasmid only. For the cotransformation of both the TALEN plasmid and the KO-plasmid, 75 colonies were tested by PCR and 18 (24%) were positive for insertion of the ShBle cassette in the urease gene as either a biallelic mutant (i.e. no WT band observed, Figure 3b lanes 3 and 6) or monoallelic mutant (i.e. both WT and mutant bands observed, Figure 3b lanes 8 and 10). Of the 18 positive colonies, 10 (56%) lacked the WT band and were consistent with a biallelic mutant genotype. Also, of the 18 positive colonies, an independent set of 9 (50%) had remnants of the TALEN expression vector (data not shown), suggesting that in half of

(a)

(b)

(c)

Figure 3 PCR identification of mutants in Phaeodactylum tricornutum lines. (a) Diagram of urease gene with targeted disruption by the ShBle cassette. The insertion cassette was flanked by 1-kbp homology (blue boxes) on either side of the ShBle cassette (light blue triangle). Primers Urease-KO-5 and Urease-KO-6 were designed to bind outside of the homology region found on the insertion cassette and were thus able to detect insertion of the ShBle cassette into the urease gene. (b) P. tricornutum colonies obtained from cotransformation with both TALEN expression plasmid and ShBle knockout plasmid were screened by PCR with Urease-KO-5 and Urease-KO-6 primers. (c) PCR results as in B from colonies obtained from particle bombardment with ShBle knockout plasmid only.

the knockout mutants, the TALEN expression cassette was no longer present allowing one to identify a clean, biallelic mutant. In the control transformation containing only the KO-plasmid, only 2 of 75 (2.6%) colonies were observed to have a faint band consistent with the urease gene interrupted by the ShBle cassette, and both were putative monoallelic mutants (Figure 3c lane 3). Overall, the cotransformation of TALEN and KO-plasmid substantially increases HR over transformation with just a KO-plasmid. In this study, biallelic mutants could only be obtained by cotransformation of the KO-plasmid with the TALEN expression plasmid. We selected several putative monoallelic lines (9-1, 11-1, 11-6) and several putative biallelic knockout mutant lines (9-7, 11-3, 11-4, 11-5) for further analysis. PCR using primers outside of the urease homology regions on DNA extracted from these lines yielded WT bands only (e.g. 11-1), insertional mutant bands only (e.g. 9-7, 11-3, 11-4 and 11-5) or a combination of both (e.g. 91, 11-6) (Figure 4). To determine whether any of the TALEN expression vector remained in the transgenic lines, we performed PCR using primers specific for the kanamycin resistance cassette on the pTH expression vector and using primers specific for the TALEN gene itself (Figure 4). Only two lines had a band at the expected size from the kanamycin-specific PCR (11-1 and 11-5): one of these lines (11-1) had a WT band with the urease primers

ª 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 1–11

4 Philip D. Weyman et al.

Figure 4 Screening selected lines for the presence of the TALEN expression vector. The mutant genotype was determined as in Figure 3 using PCR primers Urease-KO-5 and Urease-KO-6. Additional primer sets specific to kanamycin resistance gene (primers Km-1 and Km-2) and the TALEN repeat region on the TALEN expression vector [primers (TALE)-seq1 and TALE-seq-2] were also performed.

and the other line (11-5) had a mutant urease band consistent with biallelic mutation (Figure 4). PCR with the TALEN-specific primers yielded a similar result as with the kanamycin primers (Figure 4). In summary, using this co-bombardment strategy, biallelic insertional mutants in which the TALEN expression cassette did not co-integrate were readily identifiable. To determine the number and site of insertions, we performed Southern blot hybridization on DNA extracted from WT or mutant lines (Figure 5). The results indicated that a variety of genomic modifications were attained, but it was generally straightforward to identify a clone with the desired insertional mutation. Hybridization with a probe made from the 30 region of the urease gene (downstream of the target insertion site) gave the expected band size at 1.8 kbp in WT cells (Figure 5). In the mutants, this restriction fragment was expected to shift to 3.2 kbp due to the insertion of the ShBle cassette. Because P. tricornutum is a diploid organism, biallelic mutants will exclusively display the larger band at 3.2 kbp, while monoallelic mutants may have a large band accompanied by the smaller 1.8kbp WT band if a WT allele remained unaltered. To create a biallelic mutant using the TALEN approach, two cleavage and insertion events are required to disrupt the urease gene on both copies of the chromosome. We tested four lines (9-7, 11-3, 11-4, and 11-5) that appeared to be biallelic urease mutants based on the PCR data. Although all four lacked the WT band, each of the lines had a different genetic ‘architecture’ at the urease locus. For example, line 9-7 had two bands at larger (mutant) sizes for both the urease and the ShBle probes (~3.2 and 3.3 kbp, Figure 5). This was consistent with a mutation at one of the 50 BamHI sites as explained below (Figure 5). Line 11-3 appeared to be as expected with a single band at the 3.2-kbp mutant size for both the urease and the ShBle probes. Line 11-4 had a doublet at slightly less than the 3.2 kbp expected size for the urease probe only while the ShBle probe had the expected 3.2-kbp band suggesting that a duplication or additional insertion event occurred in the 30 region of the urease gene. A second Southern blot with DNA digested by XhoI to cut well outside of the 30 region of the urease gene showed a single band for line 11-4 at ~7 kbp, while a 4.8 kbp band was expected for both the ShBle and urease probes (Figure S1). This is consistent with a duplication or insertion in the

Figure 5 Southern blot of wild-type (WT) and urease mutant lines. Expected arrangements of BamHI sites are shown before and after recombination with the ShBle knockout cassette to yield mutants. The urease coding region (green arrow), TALEN target site (orange rectangle), regions of homology on the KO-plasmid (dark blue) and ShBle cassette are shown. Probe positions for ShBle (purple bar) and urease (dark green bar) are also depicted. Phaeodactylum tricornutum DNA was digested with BamHI, separated by agarose gel electrophoresis, blotted and hybridized with DIG-labelled probes to either urease or ShBle. Putative biallelic mutant lines (9-7, 11-3, 11-4, 11-5) are shown along with monoallelic knockout line 9-1 and a WT control (WT).

30 region of the urease gene. The incorporation of DNA from plasmids during repair has been noted for P. tricornutum (Daboussi et al., 2014). Line 11-5 appears to have multiple insertions of the ShBle gene as evidenced by the multiple bands on the ShBle-probed blot (Figure 5). The band patterns of line 9-1 were consistent with its designation as an incomplete and putatively monoallelic mutant; it had two hybridizing bands, one at the expected WT size (1.8 kbp) and one at the mutant size (3.2 kbp). That the mutant band is much greater in intensity than the WT band remains unexplained, but it may be the result of segregation based on improved growth of lines with two copies of the ShBle gene rather than one. To better understand the nature of the insertion in the 9-7 mutant, we amplified the region of the urease by PCR, cloned the bands using Gibson assembly and sequenced the resulting plasmids. The sequencing revealed cloned PCR products in line 9-7 in which the 30 BamHI site that would have yielded a 3.2-kbp band (Figure 5) was mutated, while no BamHI site mutation was observed in the wild type (data not shown). The disruption of the BamHI site in the 9-7 mutant was expected to result in a band in the Southern blot that was ~100 bp longer (Figure 5). The mutation was likely present on a subset of the KO-plasmids and depending on where HR initiated, the resulting P. tricornutum urease allele yielded either the 3.2 or the 3.3-kbp band. This double band pattern for line 9-7 was also observed when using a probe to ShBle (Figure 5). The similar pattern of both ShBle and urease for line 9-7 indicated that ShBle insertion was confined to the urease region and that no off-target insertions took place.


TALEN-based P. tricornutum mutagenesis 5 To test whether the TALEN alone could create mutations by targeted digestion and repair by NHEJ, we engineered a version of the urease TALEN coexpression vector that contained a ShBle resistance cassette without the flanking homology regions to the urease gene. This plasmid, pTALEN-Ble, was introduced by particle bombardment and resulting colonies were tested by growth assay for lack of ability to grow on urea as the sole nitrogen source. After several particle bombardments and plating on nitrate-containing L1 medium with phleomycin selection, a total of 38 colonies were obtained. Liquid cultures were started from these colonies to test their growth using urea or nitrate as the nitrogen source. Five colonies were identified that exhibited lack of growth on urea-containing medium while still maintaining good growth on medium containing nitrate (Figure S2). Overall, the ability to obtain a urease mutant using the TALEN expression plasmid alone and without cotransformation with the plasmid containing a homology-flanked resistance marker suggests that the TALEN was active in the P. tricornutum cell. Western blot analysis showed a complete lack of urease protein in the biallelic mutant lines 9-7, 11-3 and 11-5, suggesting that these were truly nullizygous (Figure 6). A partial reduction in urease protein was observed in the monoallelic mutant line 9-1 and to a lesser extent in 11-6 (Figure 6). Total protein stained by Sypro Ruby showed equivalent protein loading for each sample. Blots were also probed with antisera to the FLAG epitope at the N-terminus of the TALEN proteins, and only line 11-5 had a band for the TALEN protein (Figure 6). Based on PCR, this was also the only line thought to contain a stable integration of the TALEN vector. In growth assays, biallelic mutant lines (9-7, 11-3, 11-4, 11-5) could not grow when urea was supplied as the sole nitrogen source, while no growth impairment was observed with either ammonium or nitrate as the nitrogen source (Figure 7, ammonium not shown for brevity). Remarkably, the monoallelic

Figure 6 Western blot of various urease knockout lines. Total soluble proteins were extracted from selected lines, separated by SDS-PAGE, blotted and incubated with polyclonal antisera specific to Phaeodactylum tricornutum urease or the FLAG epitope found on the TALEN protein. Two incomplete or monoallelic mutants (9-1 and 11-6) are compared with three complete or biallelic mutants (9-7, 11-3, and 11-5). Total proteins were separated and stained with Sypro Ruby as a loading control.

Figure 7 Phenotypic analysis of mutants. Growth curves of wild-type cells and biallelic mutant lines 9-7, 11-3, 11-4 and 11-5 in media containing nitrate or urea as sole nitrogen sources. Growth curves for ammonium are identical to those for nitrate, but not shown for clarity.

mutants (9-1 and 11-6) exhibited WT-like growth rates on all three nitrogen sources including urea (Figure S3), despite clearly reduced urease protein levels for line 9-1. In cyanobacteria, knockout of a high affinity nickel transporter and reduced nickel accumulation did not affect growth on urea, suggesting that only trace amounts of urease were required for growth (Dupont et al., 2012). Potentially, a similar scenario exists in the diatom, although it raises the question of why urease is produced at higher levels than required for exogenous urea assimilation, particularly given the protein size and concurrent metal requirements. In humans, the urea cycle converts the toxic ammonium produced by amino acid catabolism into urea, which is then excreted. We have hypothesized that diatoms assimilate urea produced endogenously by the urea cycle (Allen et al., 2011), although this would require a functional urease. We conducted untargeted metabolite analyses of a WT and nullizygous line in exponential growth on nitrate to examine the nonassimilatory biochemical role of urease (Table 1). Relative to WT P. tricornutum, the nullizygous mutant line 9-7 contains 60% more urea, providing confirmation of endogenous urea production by the urea cycle and urea accumulation due to the knockout of the urease (Figure 8). Further, both arginine and ornithine are enriched in the nullizygous line. Arginine may accumulate as a result of the feedback inhibition of arginase in response to increased urea (the product of the reaction), while ornithine accumulation may result from the reduced level of carbamoyl-P substrate available to run the ornithine carbamoyltransferase reaction. Reduced level of carbamoyl-P is perhaps brought upon as a direct consequence of the urease knockout that impairs ammonium recycling by carbamoyl phosphate synthase (unCPS, protein ID 24195) (Figure 8). Previously, we hypothesized that the urea cycle functions as a repacking hub balancing the exchange


6 Philip D. Weyman et al. Table 1 Changes in metabolites shown by nontargeted GC-MS metabolite analysis. Values are weighted mean peak areas of a spectral cluster (arbitrary units) for quadruplicate biological replicates and triplicate technical replicates. Pink shading indicates P values less than 0.05 while green shading indicates P values greater than 0.05 but less than 0.1

*P-values are from FDR-adjusted ANOVA for pooling all biological and technical replicates.

of nitrogen and carbon within the cell (Allen et al., 2011). In our metabolomics analysis, high nitrogen compounds, including lysine, asparagine and glutamine, were all enriched within the nullizygous line, as were several high-carbon compounds such as saccharides, sugars and lipids (Table 1). Several other unidentified metabolites were also significantly different within the nullizygous lines. Overall, urease appears to be required for a completely functional urea cycle, which in turn is required for efficient carbon and nitrogen balance within the cell, although a clear growth rate phenotype is not apparent under nutrient replete conditions. The use of TALENs may complement existing RNAi-mediated knockdown strategies (Cerutti et al., 2011; De Riso et al., 2009; Radakovits et al., 2010). RNAi can be effective in lowering effective transcript levels for genes of interest with corresponding effects on protein levels, although often dozens of lines need to be screened to find 50% reduction in target protein abundance. As demonstrated by Figures 6 and 7, even 50% knockdown would have little discernable growth phenotype effect for some proteins, such as urease, preventing high-throughput phenotypic screens. While biallelic knockout via TALEN-mediated methods can remove all detectable protein, the utility of the more subtle RNAi-based approaches will still be of use when essential genes are examined or a paralogous gene family is targeted. Development of newer technology using the CRISPR/CAS9 systems has been of great use for a variety of eukaryotes (DiCarlo et al., 2013;

Hruscha et al., 2013; Jiang et al., 2013; Mali et al., 2013; Ran et al., 2013), and these strategies are in development for P. tricornutum.

Conclusions We have demonstrated a TALEN-based strategy to create targeted, insertional mutations in P. tricornutum. While it has been demonstrated previously that expression of the TALEN is all that is required for efficient knockout of a gene of interest (Daboussi et al., 2014), we have found that it is much easier to obtain mutants when combining the TALEN expression cassette with a second plasmid containing an antibiotic resistance gene flanked by homologous sequence to the TALEN target site. Not only does this enable more efficient screening of lines by colony PCR, it also is a general strategy applicable for any gene regardless of whether an easily-screened phenotype exists. Advice for identifying nullizygous mutants efficiently can be summarized in the following ‘best practice’ points. First, after patching colonies, researchers should immediately screen by PCR using primers just outside of the region included as homology in the knockout plasmid. A multiplex reaction can be made with primers screening for the kanamycin resistance gene to simultaneously identify lines that are truly nullizygous and that lack integration of the TALEN expression cassette. While PCR screening for the


TALEN-based P. tricornutum mutagenesis 7

Figure 8 A schematic showing the relationship between urease and the metabolites enriched (italics underlined) in nullizygous urease mutant 9-7 relative to wild-type Phaeodactylum tricornutum.

junctions of insertion of the antibiotic cassette can be performed, this must be in addition to the strategy described above as it does not guarantee identification of nullizygous mutants. Second, screening for phenotype (if available) or the presence of the disrupted protein by Western blot is crucial to confirm that the mutant line lacks the targeted protein. Finally, screening multiple, confirmed lines allows consistent association of phenotype with the intended gene interruption. The protocol presented above to create targeted mutations of genes of interest in diatoms will greatly accelerate research with this emerging model eukaryote at levels spanning the molecular to the ecological.

Experimental procedures Strains and media Escherichia coli (Epi300; Epicentre, Madison, WI) strains were grown on Luria–Bertani broth or agar supplemented with ampicillin (100 mg/L), tetracycline (12 mg/L) or kanamycin (50 mg/L) as needed. Pheodactylum tricornutum was grown in F/2 medium (Hallegraeff et al., 2003) at 18 °C under cool white fluorescent lights (50 lE/m/s). Antibiotics used for P. tricornutum were phleomycin (100 mg/L) and zeocin (50 mg/L). Sequence information for P. tricornutum was taken from the DOE genome sequencing site (http://genome.jgi-psf.org/Phatr2/Phatr2.home. html) as described (Bowler et al., 2008).

Molecular biology Unless otherwise noted, all molecular biology techniques were performed according to Sambrook et al. (2001). Phusion highfidelity DNA polymerase (Thermo Scientific, Pittsburg, PA) was used for all products to be cloned except where noted. PCR directly from E. coli colonies was performed using OneTaq 2x PCR mastermix (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions. All primer sequences are shown in Table 2. A site within the P. tricornutum UREABC (PHATRDRAFT_29702) that is compatible with the TALEN requirements (Sanjana et al., 2012) was chosen to target the insertion of the ShBle gene conferring resistance to bleomycin. This site consists of 20-nt TALE-binding sites both upstream and downstream of the targeted TALEN cut site. The upstream TALE-binding site was designed to be 50 -TGGACCGGTACGTTGCTAAA (on top DNA

strand), and the downstream TALE-binding site (on bottom DNA strand) was designed to be 50 -TCCTACCTTGCGGAAGATCG. The two TALE-binding sites are separated by a 19-nt spacer in which the FokI nuclease is designed to cleave. The search string ‘T-N57A’ was used to identify potential sites to design the TALENs. Alternatively, two useful web-based tools to identify compatible TALEN sites have been described (Cermak et al., 2011; Sanjana et al., 2012). TALENs were assembled according to published protocols (Sanjana et al., 2012). After assembly, the sequence of the TALE repeats was confirmed by Sanger DNA sequencing according to the published protocol. We next assembled a TALEN expression vector, pTH, that would permit efficient transcription and translation of the upstream and downstream TALENs on a single plasmid. The plasmid pTH was constructed in a hierarchical manner. First, two promoter–terminator combinations (pPtPT-1 and pPtPT-2) were constructed using Gibson assembly (Gibson et al., 2009) into the cloning vector pUC19. In each construction, a unique restriction enzyme (I-CeuI for pPtPT-1 and I-SceI for pPtPT-2) was inserted between the promoter and terminator by PCR. Promoters FcpF (for pPtPT-1) and FcpB (For pPtPT-2) were amplified by PCR from P. tricornutum genomic DNA using primers PtPT1 + PtPT2 and PtPT5 + PtPT6, respectively. Both pPtPT-1 and pPtPT-2 contain the FcpA terminator that was amplified by primers PtPT3 + PtPT4 and PtPT7 + PtPT4, respectively. The PCR products were purified by Qiaquick PCR purification columns (Qiagen, Valencia, CA) and were assembled with EcoRI and HindIII digested vector pUC19 using the Gibson method. Plasmid map and sequence for pTH can be found in Figure S4. The pTH vector for TALEN expression in P. tricornutum is available at addgene.org. The promoter–terminator combinations were amplified from pPtPT1 and pPtPT2 using primers PtTH1 + PtTH2 and PtTH5 + PtTH6, respectively. These products were combined with a product amplifying the kanamycin resistance gene from pACYC177 using primers PtTH3 + PtTH4, and the three products were assembled by Gibson method into a ScaI and PstI digested pBR322 vector to create plasmid pTH. After transformation into E. coli Epi300 cells, colonies were selected by growth on antibiotics kanamycin and tetracycline and screened by PCR. After purification of the plasmid, digestion with I-SceI and I-CeuI yielded two expected bands of size 1.7 and 5.1 kbp, as expected.


8 Philip D. Weyman et al. Table 2 Primers used in this study (beginning with 50 end) Talen-entry-1

AGCTGAGGGTACCCCGTAACTATAACGGTCGGCTTATCGAAATTAATACGACTCACT

Talen-entry-2

CCAGCCAAAGTCGAGGTAGTTCGCTACCCTAGAAGGCACAGTCGAGGC

Talen-entry-3

CGCCCCCTTCACCAGTTACGCTAGGGGGCTTATCGAAATTAATACGACTCACT

Talen-entry-4

AGCCAAAGTCGAGGTAGCTATATTACCCTGCTAGAAGGCACAGTCGAGGC

Pt-PT1

ACGACGTTGTAAAACGACGGCCAGTGCTAACAGGATTAGTGCAATTCGAG

Pt-PT2

TTCGCTACCTTAGGACCGTTATAGTTACGGGGTACCCTCAGCTAGAATATTATCG

Pt-PT3

CGTAACTATAACGGTCCTAAGGTAGCGAACTACCTCGACTTTGGCTGG

Pt-PT4

AACAGCTATGACCATGATTACGCCAATGAAGACGAGCTAGTGTTATTCC

Pt-PT5

CACGACGTTGTAAAACGACGGCCAGTGAGGGCGAATTGGAGCTCC

Pt-PT6

CTATATTACCCTGTTATCCCTAGCGTAACTGGTGAAGGGGGCGGCC

Pt-PT7

AGTTACGCTAGGGATAACAGGGTAATATAGCTACCTCGACTTTGGCTGGG

Pt-TH1

TAGTTTGCGCAACGTTGTTGCCATTGCTGCACTAACAGGATTAGTGCAATTCGAG

Pt-TH2

TGAGACACAACGTGGCTTTGTTGAATAAATCGTGAAGACGAGCTAGTGTTATTCC

Pt-TH3

TTCACAGTCAGGAATAACACTAGCTCGTCTTCACGATTTATTCAACAAAGCCACG

Pt-TH4

AGGCGAGATTCCGCGGTGGAGCTCCAATTCGCCCTGCCAGTGTTACAACCAATTAACC

Pt-TH5

ATCAGAATTGGTTAATTGGTTGTAACACTGGCAGGGCGAATTGGAGCTCC

Pt-TH6

CATACACTATTCTCAGAATGACTTGGTTGAGTTGAAGACGAGCTAGTGTTATTCC

T1ure-1

CACGACGTTGTAAAACGACGGCCAGTGCGATACACAACCCTGTCTCG

T1ure-2

GTGAGGGTTAATTTCGAGCTTGGCGTAATCATGGTGTGCCCCCTCCAAACATG

T1ure-3

TCGAGTGGGGTGACGACCATGTTTGGAGGGGGCACACCATGATTACGCCAAGCTC

T1ure-4

ATTCCAAAGTAGGAGAGAAACAAGTGTCAGTATGAAGACGAGCTAGTGTTATTCCT

T1ure-5

CACAGTCAGGAATAACACTAGCTCGTCTTCATACTGACACTTGTTTCTCTCCTACTTTG

T1ure-6

AACAGCTATGACCATGATTACGCCAAAACATGGGGCGCATCTTGA

Talen-chk-F

GGTACAATCTTCCCATCGG

Talen-chk-R

TCATGTCCTGGTACTTGACG

Talen-chk-F2

CCAAGTCGACGGTATCGATAA

Talen-chk-F3

GTGGATCCCACGAGATATCAC

Urease-KO-5

GGACAGTCACTCATCGGACG

Urease-KO-6

AGTGTCAGCATGAATGGCG

KmR-1

CGTATTTCGTCTCGCTCAGG

KmR-2

TCGAGCATCAAATGAAACTGC

Urease-KO-1

CCTTAGACTTTGCCGACGAG

Urease-KO-2

TCGCTATGTATCGCTTGACG

SB2

GACTTCGTGGAGGACGACTT

30 -ShBle

GTCCTGCTCCTCGGCCA

UR9-7-R

CACCCGGCATTACTTGATTCCGTCCGATGAGTGACTGTCCCACTGGCCGTCGTTTTACAA

UR9-7-F

TTGTTTTTGTATCACAGGCCGCCATTCATGCTGACACTTGGCGTAATCATGGTCATAGCT

ShBlestuffer1

TTCCGCGCACATTTCCCCGAAAAGTGCCACCTGCAGGATTAGTGCAATTCGAGTTG

ShBlestuffer2

ATAGGTTAATGTCATGATAATAATGGTTTCTTAGAGACGAGCTAGTGTTATTCCTGACTG

Urstuffer-3

CTCATGAGCGCTTGTTTCG

Urstuffer-4

GTCTGTGAGTCGATTGCCAG

TALE-Seq-F1

CCAGTTGCTGAAGATCGCGAAGC

TALE-Seq R1

TGCCACTCGATGTGATGTCCTC

To assemble the upstream and downstream TALENs into expression vector pTH, the sequenced-verified TALENs were amplified by PCR. Reactions were set up using Herculase (BioRad, Hercules, CA) polymerase according to the manufacturer’s instructions using primers TalenEntry1 + TalenEntry2 for the upstream TALEN and TalenEntry3 + TalenEntry4 for the downstream TALEN. The upstream primer for each TALEN binds just upstream of the Kozak sequence and the T7 promoter, and the downstream primer binds just after the stop codon. PCR products were purified by agarose gel extraction using the QiaQuick kit (Qiagen). The purified products were assembled by the Gibson method with the pTH vector digested with I-SceI and I-CeuI. Digestion of the pTH vector with these two enzymes creates two bands, both of which were used in the assembly as the goal is to insert the upstream TALENs at the I-CeuI site and the downstream

TALEN at the I-SceI site. After assembly, the reaction was transformed into E. coli Epi300 cells and colonies were selected on Luria agar plates supplemented with kanamycin and tetracycline. The final vector containing the two TALENs, pTH-UreaseTALENs, was partially sequenced using primers Talen-chk-F2 and Talen-chk-F3. Plasmid map and sequence for pTH-UreaseTALENs can be found in Figure S5. The final step was to assemble the plasmid to be used for HR of the ShBle cassette into the urease gene (i.e. the ‘KO-plasmid’). This plasmid was designed to have the ShBle expression cassette flanked by 1 kbp of homology sequences located upstream (Urease-Up) and downstream (Urease-Dn) of the TALEN recognition sequence, respectively (Figure 1). To construct this plasmid, primers T1ure1 + T1ure2 and T1ure5 + T1ure6 were used to amplify the 50 and 30 homology regions, respectively. The ShBle


TALEN-based P. tricornutum mutagenesis 9 expression cassette was amplified from plasmid pAF6 using primers T1ure3 + T1ure4 (Falciatore et al., 1999). PCR products were purified by QiaQuick PCR Purification Kit (Qiagen) and assembled using the Gibson method with pUC19 that had been digested with EcoRI and HindIII and similarly purified (Gibson et al., 2009). The assembly reaction was transformed into EPI300 cells (Epicentre) and selected on Luria broth containing ampicillin. The resulting plasmid, pKO-urease, was purified from resulting colonies, tested by restriction digest and verified to be correct. To create a version of the urease TALEN expression plasmid that contained an ShBle marker (pTALEN-Ble), we identified a unique restriction site (AatII) within the plasmid approximately 130 bp upstream of the Bla gene. The partially sequenced urease TALEN coexpression plasmid was digested with AatII and ethanol precipitated. The ShBle expression cassette was amplified from pAF6 using primers ShBlestuffer1 and ShBlestuffer2 (Table 2), purified using QiaQuick PCR Purification Kit (Qiagen) and assembled with the AatII-digested vector using Gibson assembly. Properly assembled clones were identified using screening primers UrStuffer3 and UrStuffer4 (Table 2) that bound outside the AatII site on the plasmid, and positive colonies were further confirmed by restriction digest.

DNA extraction and Southern blot DNA was extracted from P. tricornutum cultures using a modified CTAB procedure (Wilson, 2001). Briefly, 200 mL of early log phase P. tricornutum culture was pelleted and resuspended in 500 lL buffer P1 (Qiagen). The cell wall was digested by treatment of the cells with 1 lL Zymolyase 20T solution (20 mg/mL stock, USB) and 1 lL 1 M b-mercaptoethanol for 1 h at 37 °C. Following this treatment, DNA was extracted according to Wilson (2001). The DNA (20–30 lg) was then digested with BamHI or XhoI, precipitated and separated by agarose gel electrophoresis. Southern blots were performed as described as in (Sambrook et al., 2001). Dig-labelled probes were prepared using the PCR-Dig Probe Synthesis Kit (Roche, Basel, Switzerland) according to the manufacturer’s recommendations. The PCR-Diglabelling reaction for urease probe was performed using the urease-KO-1 and urease-KO-2 primers, and the PCR reaction for the ShBle probe was performed using the SB2 and 30 -ShBle primers (Table 2).

Cloning urease region for sequencing Primers UR9-7-F and UR9-7-R were used to amplify pUC19 with homology to the region amplified by primers Urease-KO-5 and Urease-KO-6 primers. The PCR products from 9-7 amplified by Urease-KO-5 and Urease-KO-6 were assembled into the amplified vector using Gibson assembly (Gibson et al., 2009) and transformed into Epi300 cells (Epicentre) by electroporation. Colony PCR was performed to screen the colonies, and the plasmid DNA was extracted and sequenced.

Transformation of Phaeodactylum tricornutum Plasmids were introduced to the P. tricornutum genome using biolistic methods as previously described (Falciatore et al., 1999). Briefly, 2 lg of either pKO-urease knockout plasmid by itself or 2 lg each of pKO-urease and pTH containing the TALENs (pTHUreaseTALENs) were loaded onto tungsten beads (Bio-Rad) and shot into ca. 4 9 107 cells plated on F/2 medium containing 880 lM nitrate as the sole nitrogen source. The cells were maintained for 2 days in the light and then were transferred to F/2 1% agar plates containing phleomycin. After 7–10 days,

roughly 100 colonies per plate appeared for both the knockout plasmid alone (pKO-urease) and for the TALEN-knockout plasmid cobombardment (pKO-urease + pTH-UreaseTALENs). These colonies were repatched and screened by colony PCR using the Phire Plant Direct PCR kit (Thermo) according to the manufacturer’s instructions. Primers used included UreaseKO5 + UreaseKO6 to screen for insertion into the urease gene and KmR1 + KmR2 to screen for the presence of the TALEN vector. The presence of the TALEN coding region was verified using primers TALE-seq-F1 and TALE-seq-R1 (Table 2).

Growth curves To assess growth in medium with different nitrogen sources, we measured in vivo chlorophyll-a fluorescence (10 AU; Turner Instruments, Sunnyvale, CA) over exponential growth. Cultures (25 mL) were started from liquid starter cultures in F/2 media (Guillard and Ryther, 1962) supplemented with 880 lM NO3 or NH4 or 440 lM urea as the sole nitrogen sources.

Western blots Fifty mL of P. tricornutum culture (1 9 106 cells/mL) was pelleted by centrifugation (7000 g, 10 min), flash frozen in liquid nitrogen and stored at 80 °C. Pellets were thawed in lysis buffer (125 mM Tris-HCl, pH 6.8; 200 mM NaCl and 1 mM phenylmethanesulfonylfluoride). Cells were lysed at 4 °C by sonication (Bioruptor; Diagenode, Denville, NH), with clarification of the lysate by centrifugation (10 000 g, 10 min). The protein concentration of the supernatant was determined by BCA assay. Ten micrograms of protein in 29 loading buffer (125 mM Tris–HCL pH6.8, 4% SDS, 20% Glycerol and 10% b-mercaptoethanol) was separated on tris-EDTA gels with transfer to PVDF membranes. Membranes were probed using 1 : 5000 dilution of an antibody to P. tricornutum urease (SDIX, Inc., Newark, DE) or 1 : 1000 dilution of an anti-FLAG antibody (Thermo) to visualize the TALEN protein.

Metabolomics sample preparation Metabolite analyses were performed on four biological replicates of wild type and lines 9-7. Exponentially growing cultures were filtered onto 3.0 lm PVDF membrane (Durapore, Millipore, Temecula, CA), immediately frozen in liquid nitrogen and stored at 80 °C. The frozen cells were rinsed off the filters, and metabolites were extracted with 1 mL ice-cold 70% methanol. Samples were sonicated for 15 min, centrifuged at 3000 g for 10 min at 4 °C and 500 lL of supernatant was transferred to a separate tube for GC-MS analysis.

GC-MS analysis Five hundred microlitres of extract was dried using a speedvac, resuspended in 50 lL of pyridine containing 15 mg/mL of methoxyamine hydrochloride, incubated at 60 °C for 45 min, sonicated for 10 min and incubated for an additional 45 min at 60 °C. Next, 50 lL of N-methyl-N-trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane (MSTFA + 1% TMCS; Thermo Scientific) was added, and samples were incubated at 60 °C for 30 min, centrifuged at 3000 g for 5 min and cooled to room temperature, and 80 lL of the supernatant was transferred to a 150 lL glass insert in a GC-MS autosampler vial. Metabolites were detected using a Trace GC Ultra coupled to a Thermo ISQ mass spectrometer (Thermo Scientific, Waltham, MA). Samples were injected in a 1 : 10 split ratio twice in discrete randomized blocks. Separation occurred using a 30-m TG-5MS column


10 Philip D. Weyman et al. (Thermo Scientific; 0.25 mm i.d., 0.25-lm film thickness) with a 1.2 mL/min helium gas flow rate, and the programme consisted of 80 °C for 30 s, a ramp of 15 °C per min to 330 °C, and an 8 min hold. Masses between 50–650 m/z were scanned at 5 scans/s after electron impact ionization. Please see Supporting Information (Data S1) for additional metabolomics methodology.

Acknowledgements This work was supported by the United States Department of Energy Genomics Science programme grants (DE-SC00006719 and DE-SC0008593) to AEA and CLD, DE-SC00008595 to GP, a National Science Foundation grant MCB-1024913 to AEA and CLD, and a National Science Foundation grant MCB-1129303 to CLD. AEA was also parti supported by the Gordon and Betty Moore Foundation grant GBMF3828. The authors declare that they have no conflict of interest related to this manuscript.

References Allen, A.E., LaRoche, J., Maheswari, U., Lommer, M., Schauer, N., Lopez, P.J., Finazzi, G., Fernie, A.R. and Bowler, C. (2008) Whole-cell response of the pennate diatom Phaeodactylum tricornutum to iron starvation. Proc. Natl Acad. Sci. USA, 105, 10438–10443. Allen, A.E., Dupont, C.L., Obornık, M., Horak, A., Nunes-Nesi, A., McCrow, J.P., Zheng, H., Johnson, D.A., Hu, H., Fernie, A.R. and Bowler, C. (2011) Evolution and metabolic significance of the urea cycle in photosynthetic diatoms. Nature, 473, 203–207. Apt, K.E., Kroth-Pancic, P.G. and Grossman, A.R. (1996) Stable nuclear transformation of the diatom Phaeodactylum tricornutum. Mol. Gen. Genet. 252, 572–579. Bertrand, E.M., Allen, A.E., Dupont, C.L., Norden-Krichmar, T.M., Bai, J., Valas, R.E. and Saito, M.A. (2012) Influence of cobalamin scarcity on diatom molecular physiology and identification of a cobalamin acquisition protein. Proc. Natl Acad. Sci. USA, 109, 1762–1771. Bhaya, D. and Grossman, A.R. (1993) Characterization of gene clusters encoding the fucoxanthin chlorophyll proteins of the diatom Phaeodactylum tricornutum. Nucleic Acids Res. 21, 4458–4466. Bowler, C., Allen, A.E., Badger, J.H., Grimwood, J., Jabbari, K., Kuo, A., Maheswari, U., Martens, C., Maumus, F., Otillar, R.P., Rayko, E., Salamov, A., Vandepoele, K., Beszteri, B., Gruber, A., Heijde, M., Katinka, M., Mock, T., Valentin, K., Verret, F., Berges, J.A., Brownlee, C., Cadoret, J.-P., Chiovitti, A., Choi, C.J., Coesel, S., De Martino, A., Detter, J.C., Durkin, C., Falciatore, A., Fournet, J., Haruta, M., Huysman, M.J.J., Jenkins, B.D., Jiroutova, K., €ger, N., Kroth, P.G., La Roche, J., Jorgensen, R.E., Joubert, Y., Kaplan, A., Kro Lindquist, E., Lommer, M., Martin-Jezequel, V., Lopez, P.J., Lucas, S., Mangogna, M., McGinnis, K., Medlin, L.K., Montsant, A., Oudot-Le Secq, M.-P., Napoli, C., Obornik, M., Parker, M.S., Petit, J.-L., Porcel, B.M., Poulsen, N., Robison, M., Rychlewski, L., Rynearson, T.A., Schmutz, J., Shapiro, H., Siaut, M., Stanley, M., Sussman, M.R., Taylor, A.R., Vardi, A., von Dassow, P., Vyverman, W., Willis, A., Wyrwicz, L.S., Rokhsar, D.S., Weissenbach, J., Armbrust, E.V., Green, B.R., Van de Peer, Y. and Grigoriev, I.V. (2008) The Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature, 456, 239–244. Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J. and Voytas, D.F. (2011) Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res. 39, e82. Cerutti, H., Ma, X., Msanne, J. and Repas, T. (2011) RNA-mediated silencing in Algae: biological roles and tools for analysis of gene function. Eukaryot. Cell, 10, 1164–1172. Christian, M., Cermak, T., Doyle, E.L., Schmidt, C., Zhang, F., Hummel, A., Bogdanove, A.J. and Voytas, D.F. (2010) Targeting DNA double-strand breaks with TAL effector nucleases. Genetics, 186, 757–761. Cuvelier, M.L., Allen, A.E., Monier, A., McCrow, J.P., Messie, M., Tringe, S.G., Woyke, T., Welsh, R.M., Ishoey, T., Lee, J.-H., Binder, B.J., DuPont, C.L.,

Latasa, M., Guigand, C., Buck, K.R., Hilton, J., Thiagarajan, M., Caler, E., Read, B., Lasken, R.S., Chavez, F.P. and Worden, A.Z. (2010) Targeted metagenomics and ecology of globally important uncultured eukaryotic phytoplankton. Proc. Natl Acad. Sci. USA, 107, 14679–14684. Daboussi, F., Leduc, S., Marechal, A., Dubois, G., Guyot, V., Perez-Michaut, C., Amato, A., Falciatore, A., Juillerat, A., Beurdeley, M., Voytas, D.F., Cavarec, L. and Duchateau, P. (2014) Genome engineering empowers the diatom Phaeodactylum tricornutum for biotechnology. Nat. Commun. 5, 3831. De Riso, V., Raniello, R., Maumus, F., Rogato, A., Bowler, C. and Falciatore, A. (2009) Gene silencing in the marine diatom Phaeodactylum tricornutum. Nucleic Acids Res. 37, e96. DiCarlo, J.E., Norville, J.E., Mali, P., Rios, X., Aach, J. and Church, G.M. (2013) Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, 4336–4343. Dupont, C.L., Neupane, K., Shearer, J. and Palenik, B. (2008) Diversity, function and evolution of genes coding for putative Ni-containing superoxide dismutases. Environ. Microbiol. 10, 1831–1843. Dupont, C.L., Johnson, D.A., Phillippy, K., Paulsen, I.T., Brahamsha, B. and Palenik, B. (2012) Genetic identification of a high-affinity Ni transporter and the transcriptional response to Ni deprivation in Synechococcus sp. strain WH8102. Appl. Environ. Microbiol. 78, 7822–7832. Durai, S., Mani, M., Kandavelou, K., Wu, J., Porteus, M.H. and Chandrasegaran, S. (2005) Zinc finger nucleases: custom-designed molecular scissors for genome engineering of plant and mammalian cells. Nucleic Acids Res. 33, 5978–5990. Esvelt, K.M. and Wang, H.H. (2013) Genome-scale engineering for systems and synthetic biology. Mol. Syst. Biol. 9, 1–17. Falciatore, A., Casotti, R., Leblanc, C., Abrescia, C. and Bowler, C. (1999) Transformation of nonselectable reporter genes in marine diatoms. Mar. Biotechnol. 1, 239–251. Gibson, D.G., Young, L., Chuang, R.-Y., Venter, J.C., Hutchison, C.A. and Smith, H.O. (2009) Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods, 6, 343–345. Guillard, R.R.L. and Ryther, J.H. (1962) Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt, and Detonula confervacea (cleve) Gran. Can. J. Microbiol. 8, 229–239. Hallegraeff, G.M., Anderson, D.M. and Cembella, A.D., eds (2003) Manual on Harmful Marine Microalgae. Paris, France: UNESCO Publishing. Hockin, N.L., Mock, T., Mulholland, F., Kopriva, S. and Malin, G. (2012) The response of diatom central carbon metabolism to nitrogen starvation is different from that of green algae and higher plants. Plant Physiol. 158, 299–312. Hook, S.E. and Osborn, H.L. (2012) Comparison of toxicity and transcriptomic profiles in a diatom exposed to oil, dispersants, dispersed oil. Aquat. Toxicol. 124–125, 139–151. Hruscha, A., Krawitz, P., Rechenberg, A., Heinrich, V., Hecht, J., Haass, C. and Schmid, B. (2013) Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish. Development, 140, 4982–4987. Jiang, W., Bikard, D., Cox, D., Zhang, F. and Marraffini, L.A. (2013) RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 1–9. Kay, S., Hahn, S., Marois, E., Hause, G. and Bonas, U. (2007) A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science, 318, 648–651. Li, T., Liu, B., Spalding, M.H., Weeks, D.P. and Yang, B. (2012) High-efficiency TALEN-based gene editing produces disease-resistant rice. Nat. Biotechnol. 30, 390–392. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E. and Church, G.M. (2013) RNA-guided human genome engineering via Cas9. Science, 339, 823–826. Miller, J.C., Holmes, M.C., Wang, J., Guschin, D.Y., Lee, Y.-L., Rupniewski, I., Beausejour, C.M., Waite, A.J., Wang, N.S., Kim, K.A., Gregory, P.D., Pabo, C.O. and Rebar, E.J. (2007) An improved zinc-finger nuclease architecture for highly specific genome editing. Nat. Biotechnol. 25, 778–785. Price, N. and Morel, F. (1991) Colimitation of phytoplankton growth by nickel and nitrogen. Limnol. Oceanogr. 36, 1071–1077. Radakovits, R., Jinkerson, R.E., Darzins, A. and Posewitz, M.C. (2010) Genetic engineering of algae for enhanced biofuel production. Eukaryot. Cell, 9, 486– 501.


TALEN-based P. tricornutum mutagenesis 11 Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A. and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281– 2308. Rees, T.A. and Bekheet, I.A. (1982) The role of nickel in urea assimilation by algae. Planta, 156, 385–387. Reyon, D., Tsai, S.Q., Khayter, C., Foden, J.A., Sander, J.D. and Joung, J.K. (2012) FLASH assembly of TALENs for high-throughput genome editing. Nat. Biotechnol. 30, 460–465. Sambrook, J., Fritsch, E.F. and Maniatis, T. (2001). Molecular Cloning: A Laboratory Manual (Argentine, J., ed.) Cold Spring Harbor Laboratory Vol. 3, pp. 2344. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sander, J.D., Cade, L., Khayter, C., Reyon, D., Peterson, R.T., Joung, J.K. and Yeh, J.-R.J. (2011) Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat. Biotechnol. 29, 697–698. Sanjana, N.E., Cong, L., Zhou, Y., Cunniff, M.M., Feng, G. and Zhang, F. (2012) A transcription activator-like effector toolbox for genome engineering. Nat. Protoc. 7, 171–192. Siaut, M., Heijde, M., Mangogna, M., Montsant, A., Coesel, S., Allen, A., Manfredonia, A., Falciatore, A. and Bowler, C. (2007) Molecular toolbox for studying diatom biology in Phaeodactylum tricornutum. Gene, 406, 23–35. Tesson, L., Usal, C., M enoret, S., Leung, E., Niles, B.J., Remy, S., Santiago, Y., Vincent, A.I., Meng, X., Zhang, L., Gregory, P.D., Anegon, I. and Cost, G.J. (2011) Knockout rats generated by embryo microinjection of TALENs. Nat. Biotechnol. 29, 695–696.

Wafar, M.V.M., Le Corre, P. and L’Helguen, S. (1995) ƒ-Ratios calculated with and without urea uptake in nitrogen uptake by phytoplankton. Deep Sea Res. Part I Oceanogr. Res. Pap. 42, 1669–1674. Wilson, K. (2001) Preparation of genomic DNA from bacteria. In Current Protocols in Molecular Biology (Ausubel, F.M., ed.) Vol. Chapter 2, p. Unit 2.4. Wiley Online Library. Wood, A.J., Lo, T.-W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C., Leung, E., Meng, X., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D. and Meyer, B.J. (2011) Targeted genome editing across species using ZFNs and TALENs. Science, 333, 307.

Supporting information Additional Supporting information may be found in the online version of this article: Figure S1 Southern blot of wild type and urease mutant DNA digested with XhoI. Figure S2 Phenotypic analysis of mutants created by pTALEN-Ble. Figure S3 Phenotypic analysis of incomplete or monoallelic mutants grown on nitrate and urea. Figure S4 Plasmid map and sequence for pTH. Figure S5 Plasmid map and sequence for pTH + Urease_TALENs. Data S1 Metabolomics procedures.
