Incorporation of Coenzyme Q10 into Bovine Oocytes Improves ...

BIOLOGY OF REPRODUCTION (2012) 87(5):118, 1–12 Published online before print 26 September 2012. DOI 10.1095/biolreprod.112.101881

Incorporation of Coenzyme Q10 into Bovine Oocytes Improves Mitochondrial Features and Alleviates the Effects of Summer Thermal Stress on Developmental Competence1 Mirit Gendelman and Zvi Roth2 Department of Animal Sciences, Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University, Rehovot, Israel

Environmental stress-induced alterations in oocyte mitochondria are suggested to deleteriously affect developmental competence of the ovarian pool of oocytes. We examined the association between seasonal effects on oocyte developmental competence and mitochondrial distribution, polarization, mitochondrial DNA (mtDNA) content, and RNA expression, and whether the incorporation of coenzyme Q10 (CoQ10) might improve these effects. Bovine oocytes were collected during the summer (June–August), fall (September–November), and winter (December–May), matured in vitro with or without 50 lM CoQ10, fertilized, and cultured for 8 days. The proportion of developed blastocysts was highest in the winter, intermediate in the fall, and lowest in the summer. Matured oocytes were classified into categories I–IV according to their mitochondrial distribution pattern (MitoTracker green). The proportion of highand low-polarized mitochondria (JC-1 assay) differed between oocyte categories but was not affected by season. On the other hand, oocyte distribution into categories differed between seasons and was affected by CoQ10, with an increased proportion of category I oocytes in the fall. Oocyte mtDNA did not differ between seasons, but expression of mitochondrionassociated genes involved in the respiratory chain (ND2, SDHD, CYTB, COXII, ATP5B, and TFAM) did. Coenzyme Q10 increased the expression of CYTB, COXII, and ATP5B and the proportions of blastocysts developed in the fall. In summary, season-induced alterations in mitochondrial functions might explain, in part, the reduced oocyte developmental competence. It seems that in the fall, under modest harm, CoQ10 incorporation can alleviate these deleterious effects somewhat. environment, mitochondria, oocyte competence, stress

INTRODUCTION Perturbations in the physiology of the follicle-enclosed oocyte during the lengthy period of follicular development can potentially lead to an oocyte with reduced competence for fertilization and subsequent development. This phenomenon has been best characterized for heat stress, reflected by reduced oocyte quality during the summer and a carryover effect 1 Supported by the United States-Israel Binational Agricultural Research and Developmental Fund (BARD), project US-3986-07, and by the U.S. Department of Agriculture, grant 2007-35203-18073. 2 Correspondence: Zvi Roth, Department of Animal Sciences, Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University, Rehovot 76100, Israel. E-mail: [email protected]

Received: 9 May 2012. First decision: 24 June 2012. Accepted: 24 September 2012. Ó 2012 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363

1

Article 118

Downloaded from www.biolreprod.org.

through the fall, even though the weather is cooler [1]. The mechanisms underlying the disruption in oocyte competence are likely to be complex and are not fully understood. Accumulating evidence indicates that thermal stress increases the variation in fatty acid profiles of the membrane in association with reduced oocyte developmental competence [2], alters the transcriptional levels of genes involved in oogenesis, folliculogenesis, and embryonic development [3], and disrupts both nuclear and cytoplasmic events such as translocation of the cortical granule to the oolemma [4] and cytoskeleton rearrangement, which can eventually lead to apoptosis [5]. Although the mitochondria are the most abundant organelles detected in the cytoplasm of mammalian oocytes [6], the relationship between thermal stress and mitochondrial features has not been described. Mitochondria are maternally inherited organelles, and each mitochondrion carries its own genome. Mitochondrial maturation and redistribution, as well as the amount of ATP produced and energy accumulated during oogenesis, are crucial for oocyte activation through fertilization and further embryonic development. Therefore, season-induced alterations in mitochondrial functions are suggested to directly affect oocyte developmental competence. In humans, the average amount of mitochondrial DNA (mtDNA) in oocytes that failed to undergo fertilization was found to be significantly lower than that in fertilized oocytes [7]. Based on the bottleneck theory [8], the number of mitochondria increases during oogenesis from a few in premigratory germ cells to about 200 at the oogonium stage. The primary oocyte contains approximately 5000 mitochondria, and during cytoplasmic maturation, this number increases to more than 100 000; at the same time, each mitochondrion contains one to two copies of mtDNA [9]. Following fertilization and through the early stages of embryonic development, the number of mitochondria does not change and the mitochondria remain structurally immature, characterized by a rounded or oval shape, with a few cristae and some vacuoles. With embryonic genome activation, the mitochondria undergo progressive functional and structural changes: they adopt an elongated configuration with an extensive array of cristae and generate a higher level of ATP to supply energy for embryonic growth, RNA and protein synthesis, and blastocoel formation [10]. Given that up to the compact stage, preimplantation embryos depend on a predetermined number of mitochondria present in the MII-stage oocyte, it was hypothesized that seasonal alterations might deleteriously affect the mitochondria number and/or function and therefore impair oocyte developmental competence. Mitochondria are directly involved in cellular metabolism, homeostasis, and apoptosis. The main mitochondrial function is ATP production via oxidative phosphorylation. This process requires the activity of five multimeric enzyme complexes

ABSTRACT

GENDELMAN AND ROTH

MATERIALS AND METHODS

located in the inner mitochondrial membrane. Complex I (also known as NADH dehydrogenase) oxidizes nicotinamide adenine dinucleotide (NADH). Complex II, the succinate dehydrogenase (SDH) protein complex, oxidizes flavin adenine dinucleotide (FADH2). Complexes I and II transfer electrons from NADH and FADH2 to the ubiquinone coenzyme Q10 (CoQ10), a lipophilic benzoquinone that is solubilized in the inner mitochondrial membrane. Coenzyme Q10 transfers electrons to complex III (also known as ubiquinol cytochrome c reductase or cytochrome bc1 complex), which in turn reduces cytochrome c, a mobile hydrophobic hemoprotein. Cytochrome c then transfers the electrons to complex IV (also known as cytochrome c oxidase) which reduces O2 to produce H2O [11]. Electron transport along complexes I to IV of the respiratory chain forms an electrochemical gradient, that is, membrane potential and a pH gradient. The energy stored in each component is used to convert ADP to ATP by complex V (ATP synthase). The electrochemical gradient is also important for Ca2þ sequestering, lipid biogenesis, and protein import [12–14]. The significance of ATP levels during in vitro maturation has been demonstrated in bovine oocytes. Oocytes of good morphology are characterized by high ATP levels and high developmental competence [15]. Moreover, oocyte morphology is associated with a distinct pattern of mitochondrial distribution, ranging from homogeneous clumps distributed throughout the cytoplasm to large clumps located at the periphery [15]. Taken together, it is suggested that mitochondrial polarization and their distribution within the oocyte are associated with oocyte developmental competence, and we therefore monitored these parameters, in the current study, to examine seasonal effects on the oocyte. The subunits of the oxidative phosphorylation complexes are encoded by both the nuclear and mitochondrial genome. The mtDNA is a double-stranded circular DNA molecule of approximately 16.5 kb that, in mammals, encodes 13 polypeptides—subunits of the enzyme complexes of the oxidative phosphorylation system—and 22 tRNAs and 2 rRNAs, which constitute part of the mitochondrial translation machinery [16–18]. We have recently provided evidence of high sensitivity of the ovarian pool of oocytes to elevated temperature and of changes in gene expression being an integral part of the oocyte’s response to thermal stress. Exposure of germinal vesicle-stage oocytes to thermal stress during follicular growth induces alterations in the transcription levels of genes involved in oogenesis, folliculogenesis, and further embryonic development [3, 19]. Similarly, oocytes in aging women express altered transcription levels of genes involved in mitochondrial function [20]. Given the possibility of stress-induced alterations in mitochondrial function, the current study also examined the association between seasonality and expression of mitochondrion-associated genes. The general hypothesis of the current study is that thermal stress-induced alterations in oocyte developmental competence involve changes in mitochondrial features. A series of experiments were performed to examine mitochondrial distribution (MitoTracker green), polarization (JC-1 dye), mtDNA copy number, and gene expression in matured oocytes. Coenzyme Q10, which plays a pivotal role in the mitochondrial respiratory chain, has been shown to prevent apoptosis in keratocyte cells [21], improve oxidative phosphorylation (i.e., ATP production) in atrial trabeculae mitochondria [22], and improve oocyte developmental competence [23]. Therefore, we examined whether CoQ10 can also improve developmental competence of bovine oocytes that have been subjected to thermal stress.

Chemicals

In Vitro Production of Embryos In vitro production of embryos was performed as previously described by Gendelman et al. [19]. Briefly, bovine ovaries were obtained from a local abattoir from multiparous Holstein cows. Ovaries were transported to the laboratory within 60 to 90 min in physiological saline solution (0.9% w/v NaCl at 378C with 50 lg/ml penicillin-streptomycin). In the laboratory, ovaries were washed with fresh saline, cut through the center, and placed over a transillumination stand so that follicles could be easily visualized [25]. Cumulus oocyte complexes (COCs) were aspirated from 3- to 8-mm follicles with an 18-gauge needle attached to a 10-ml syringe. COCs with at least three layers of cumulus surrounding a homogeneous cytoplasm were washed three times in HEPES-TALP, and groups of 10 oocytes were transferred to 50-ll droplets of OMM overlaid with mineral oil. The droplets containing COCs were incubated in humidified air with 5% CO2 for 22 h at 38.58C. Matured COCs were washed three times in HEPES-TALP and transferred in groups of 30 oocytes to four-well plates containing 600 ll IVF-TALP and 25 ll/well of 0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 lM epinephrine in 0.9% (w/v) NaCl. Percoll-purified spermatozoa (;1 3 106) from frozen-thawed semen were used for fertilization. Spermatozoa were coincubated with COCs for 18 h at 38.58C in a humidified atmosphere with 5% CO2. After fertilization, putative zygotes were removed from the fertilization wells, denuded of cumulus cells by gentle vortexing in HEPES-TALP containing 1000 U/ml hyaluronidase, and randomly placed in groups of 10 in 25-ll droplets of KSOM. All the embryo droplets were overlaid with mineral oil and cultured for 8 days at 38.58C in an atmosphere of humidified air with 5% CO2, 5% O2, and 90% N2.

Mitochondrial Staining Mitochondrial distribution, regardless of membrane potential, was determined by staining with MitoTracker green dye as previously described [15]. Putative MII-stage oocytes were collected following 22 h of in vitro maturation and stained with 200 nM MitoTracker green dye diluted in HEPES-TALP at 38.58C for 30 min. Oocytes were then denuded, washed three times in PBS with 1 mg/ml polyvinylpyrrolidone (PBS-PVP), and placed in Fluoromount drops (Diagnostic BioSystem). MitoTracker green dye accumulates in the membrane lipids, and mitochondrial distribution was examined under an inverted fluorescence microscope (Nikon Eclipse TE-2000-U) using Nis Elements Software (Nikon). Oocytes were classified into four different mitochondrial-distribution categories according to Stojkovic et al. [15], with minor modifications. In general, the higher the number of the category, the lower the oocyte quality: category I oocytes showed more homogeneous mitochondrial clumps distributed throughout the oocyte cytoplasm; category II oocytes were characterized by more restricted mitochondrial clumps at the periphery of the oocyte; category III oocytes displayed a small number of

2

Article 118


All the chemicals, unless otherwise specified, were purchased from SigmaAldrich. Follicle-stimulating hormone (FSH) isolated from ovine pituitary extract (Ovagen) was purchased from ICP Bio. Superscript II, Dynabeads mRNA DIRECT kit, and MitoTracker green stain were purchased from Invitrogen. Diethylpyrocarbonate (DE-PC)-treated water was purchased from Biological Industries, DyNAmo qPCR kit was from Zotal, QIAquick gel extraction was from Qiagen GmbH, High Pure PCR Template Preparation kit was from Roche Diagnostics, double-distilled water (DDW) was purchased from Merck, and the culture media HEPES-Tyrode lactate (TL), SP-TL, and IVF-TL were prepared in our laboratory: HEPES-TL was supplemented with 0.3% (w/v) bovine serum albumin (BSA), 0.2 mM sodium pyruvate, and 0.75 mg/ml gentamicin (HEPES-TALP); SP-TL was supplemented with 0.6% BSA, 1 mM sodium pyruvate, and 0.2 mg/ml gentamicin (SP-TALP); IVF-TL was supplemented with 0.6% essential fatty acid-free BSA, 0.2 mM sodium pyruvate, 0.05 mg/ml gentamicin, and 0.01 mg/ml heparin (IVF-TALP) [24]. Oocyte maturation medium (OMM) consisted of TCM-199 with Earle salts supplemented with 10% (v/v) heat-inactivated fetal calf serum (Bio-Lab), 0.2 mM sodium pyruvate, 50 mg/ml gentamicin, 1.32 mg/ml ovine FSH, and 2 mg/ ml estradiol. Potassium simplex-optimized medium (KSOM) contained 95 mM NaCl, 2.5 mM KCl, 0.35 mM KH2PO4, 0.2 mM MgSO47H2O, 0.8% (v/v) sodium lactate, 0.2 mM sodium pyruvate, 0.2 mM D ( þ)-glucose, 25 mM NaHCO3, 1 mM L-glutamine, 0.01 mM ethylenediaminetetraacetic acid (EDTA), and 0.01 mM phenol red supplemented with 1.7 mM CaCl22H2O, 0.1 mg/ml polyvinyl alcohol, 10 ll/ml essential amino acids and 5 ll/ml nonessential amino acids, 100 units (U)/ml penicillin-G, and 0.1 mg/ml streptomycin.

SEASONAL EFFECT ON MITOCHONDRIAL FEATURES TABLE 1. Primers used in this study for real-time PCR. Genes ND2 SDHD CYTB COXII ATP5B TFAM YWHAZ

Primer Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Accession number NM_174565 NM_001040483 NM_001038090 NM_001244111 NM_175796 NM_001034016 NM_174814

Sequence (5 0 !3 0 )

Size (bp)

R2

Efficiency

CATGCTCCGAAACTCTGACA GCATTTACACAGGCCCCTAA GTCCTATGGTGCTGGATGCT GTTGATGTTCATGGCACAGG CCAGGTAGCCAAGGATGTGT CTTTCGGCTCTTGAGGACTG AACAGGCTGAACCGTGTACC TACGAACAGAGGGGTTTGGT TGCTTTATTGGGCAGAATCC GATCCGTCAAGTCATCAGCA CTGGTCAGTGCTTTGTCTGC CTAAAGGGATAGCGCAGTCG GCAGCTGGTGATGACAAGAA AGTTAAGGGCCAGACCCAGT

129

0.995

96.8

113

0.995

108

163

0.995

102.9

118

0.996

99.5

152

0.997

104.7

128

0.996

103.2

124

0.997

97

single gene. The fluorescence was recorded to determine the Ct during the loglinear phase of the reaction at which fluorescence rises above background. Gene expression was quantified and analyzed by MxPRO QPCR software for Mx3000p and Mx3005p QPCR version 3, and the DDCt method was used to calculate the relative expression of each gene.

Determination of mtDNA Copy Number To examine the absolute oocyte mtDNA copy number, putative MII-stage oocytes were collected at the end of 22 h of maturation. The oocytes were denuded as described above, washed eight times with PBS-PVP, snap-frozen in liquid nitrogen, and stored at 808C until DNA isolation (n ¼ 50 oocytes per season from four different production runs). DNA was extracted individually from each oocyte by High Pure PCR Template Preparation kit according to the manufacturer’s recommendations (Roche). The DNA was bound specifically to the glass fibers prepacked in the filter tube by the combined action of a chaotropic agent (guanidine), a detergent (Triton X-100), and the enzyme proteinase K. Following insertion of isopropanol, the silica-bound DNA was washed twice (20 mM NaCl and 2 mM Tris-HCl, pH 7.5) and eluted with 200 ll of prewarmed (728C) elution buffer (10 mM Tris-HCl, pH 7.5). The external standard was the 146-bp product of CYTB (using primers 5 0 GAGGTCGGGTGCGAATAGTA-3 0 and 5 0 -ACGAAACAGGCTCCAA CAAC-3 0 , efficiency 99.9%). PCRs were carried out under standard conditions with 100 ng of total DNA in a 25-ll volume as previously described by Reynier et al. [7] with some modifications. The PCR program consisted of an initial denaturation step at 958C for 5 min followed by 30 cycles at 958C for 30 sec, 558C for 30 sec, and 728C for 30 sec, and a final extension at 728C for 10 min. The PCR products were purified by gel extraction kit according to the manufacturer’s recommendations. DNA fragments were excised from the agarose gel, QG buffer was added, and incubation was at 508C for 10 min. Following the addition of isopropanol, the samples were washed with PE buffer, and DNA elution was carried out with 30 ll DDW. DNA purity was examined by means of the 260/280 nm absorbance ratio, with values between 1.8 and 2.0 being considered acceptable. It was assumed that 1 ng of a 146-bp product contains 6.35 3 109 molecules of double-stranded DNA. Serial dilutions were then carefully made to assess the concentrations of known numbers of templates. This was used as the external standard for real-time PCR. The serial dilutions were all conserved at 208C in single aliquots. Real-time PCR was conducted on an Mx3000p using SYBR green in a final volume of 20 ll containing DE-PC water, 500 nM of each primer, and 3 ll DNA as described above. For each PCR run, a standard curve was generated using eight points of 10-fold serial dilutions of the target mtDNA PCR product with the same primers as those used for oocyte mtDNA amplification. The Mx3000p cycler software generated a standard curve, which then enabled determination of the starting copy number of mtDNA in each sample. The raw data were then increased 66.6-fold to calculate the total mtDNA content in each oocyte.

Gene Quantification Oocytes were collected at the end of 22 h of maturation and denuded of cumulus cells by gentle vortexing in HEPES-TALP containing 1000 U/ml hyaluronidase as described above. For each season, from three different production runs, samples of 20 oocytes were grouped, snap-frozen in liquid nitrogen, and stored at 808C until RNA extraction. For real-time PCR analyses, poly (A) RNA was isolated using Dynabeads mRNA DIRECT kit according to the manufacturer’s instructions (Invitrogen) as previously described [19]. In brief, oocytes were lysed by adding 100 ll lysis binding buffer to each sample. Prewashed oligo (dT)25 Dynabeads (20 ll) were added to each tube and mixed for 5 min at room temperature to allow binding of poly (A) to the beads. The samples were put into a magnetic separator to remove the lysis buffer while retaining the Dynabeads. The Dynabeads were washed twice with 100 ll washing buffer A (100 mM Tris-HCl, pH 7.5, 500 mM LiCl, 10 mM EDTA, pH 8, and 5 mM dithiothreitol [DTT]), twice with 100 ll washing buffer B (10 mM Tris-HCl, pH 7.5, 0.15 M LiCl, and 1 mM EDTA), and once with 100 ll 10 mM Tris-HCl. After removal of the Tris-HCl, 8 ll sterile DE-PC water was added, and the samples were immediately subjected to reverse transcription (RT). Reverse transcription was performed in a total volume of 20 ll. The first step was incubation at 708C with an 8-ll sample of RNA, 1 ll oligo (dT)12–18 (500 lg/ml), 1 ll RNAseout, 1 ll dNTPs (10 mM each), and 1 ll (50 ng) random primer, followed by 50 min incubation at 428C and 5 min at 708C with RT mix containing 4 ll 53 RT buffer, 200 U of Superscript II RT, 2 ll 0.1 M DTT, and DE-PC water. The samples were transferred to 208C until use. Quantitative RT was carried out with primers for ND2, SDHD, CYTB, COXII, ATP5B, and TFAM, using YWHAZ as the reference gene. The primers were derived from bovine sequences found in Genbank and designed using Primer Express software (Table 1). Real-time PCR was conducted in an Mx3000p cycler (Stratagene) using SYBR green in a final volume of 20 ll containing DE-PC water, 500 nM of each primer, and 3 ll diluted cDNA. To determine the final working dilution, a standard curve consisting of six measurement points was established for each primer using 2-fold dilutions of pooled samples (n ¼ 20 oocytes per sample). Cycle threshold (Ct) values were plotted against log-10 of the template dilution. The reaction efficiency ranged between 90% and 110% with R2 . 0.995. The dilution ratio, selected to set Ct values in the range of 24 to 27, was 1:4 (Table 1). The amplification program included preincubation at 958C for 7 min to activate taq polymerase followed by 40 amplification cycles of denaturation at 958C for 10 sec and annealing-elongation at 608C for 15 sec. All samples were run in duplicate in 96-well plates. A melting-curve analysis was performed at the end of the amplification to confirm the presence of a

Experimental Design Experiment 1: seasonal effect on bovine oocyte developmental competence. Oocytes were aspirated from ovaries collected at the local abattoir in the summer (June–August), fall (September–November), and winter (December–May). The oocytes were matured, fertilized, and cultured in vitro as described above. The proportion of oocytes cleaved to 2- and 4-cell-stage embryos and further developed to the blastocyst stage was assessed at 42–44 h

3

Article 118


mitochondria with peripheral localization, while category IV oocytes displayed intensive staining and were defined as nonviable. A mitochondrial apoptosis detection kit (JC-1 dye) was used to evaluate mitochondrial membrane potential. Putative MII-stage oocytes were collected following in vitro maturation and stained with JC-1 dye in incubation buffer (1:1000 v/v) at 38.58C for 20 min. Oocytes were then washed three times in PBS-PVP, placed in Fluoromount drops, and examined under an inverted fluorescence microscope using Nis Elements Software. The images were analyzed using ImageJ version 1.4 Software (National Institutes of Health), which allows for quantification of JC-1 signal intensity in the oocytes. The ratio of rhodamine isothiocyanate (J-aggregate) to fluorescein isothiocyanate (Jmonomer) staining was determined for each oocyte, and the average ratio was calculated for each group of oocytes.

GENDELMAN AND ROTH


and 7–8 days postfertilization (PF), respectively. At least five in vitro fertilization (IVF) runs were performed during the summer and fall while more than 10 IVF runs were performed through the winter. Experiment 2: seasonal effect on mitochondrial features. Oocytes collected in the summer (June–August), fall (September–November), and winter (December–May) were matured for 22 h at 388C. The oocytes were examined for their mitochondrial distribution (MitoTracker green staining; n ¼ 300 from seven in vitro maturation [IVM] runs for each season) and the proportions of mitochondria with high- and low-polarized membranes (mitochondrial apoptosis detection kit, JC-1 dye; n ¼ 200 from four IVM runs for each season) were determined. Messenger RNA was isolated from subgroups of MII-stage oocytes (n ¼ 20 per sample from three IVM runs), and real-time PCR was carried out with primers for ND2, SDHD, CYTB, COXII, ATP5B, and TFAM as described above. In addition, for each oocyte, mtDNA copy number was examined with primers for mitochondrial CYTB (n ¼ 50 oocytes per season from four IVM runs). Experiment 3: season and CoQ10 interactions and their association with oocyte competence. Oocytes collected in the summer (June–August), fall (September–November), and winter (December–May) were matured in vitro with 0, 30, 50, or 100 lM CoQ10. Selection of these concentrations was based on an earlier report [23]. The oocytes were fertilized and cultured as describe above. The proportion of oocytes cleaved to 2- and 4-cell-stage embryos and further developed to the blastocyst stage was assessed at 42–44 h and 7–8 days PF, respectively. At least five IVF runs were performed for each group. Experiment 4: effect of CoQ10 on oocyte cellular, mitochondrial and molecular features in the fall. Based on results from experiment 3, an additional set of oocytes collected in the fall (September–November) were matured with or without 50 lM CoQ10. At the end of 22 h of maturation, the oocytes were further examined for mitochondrial distribution (n ¼ 150 for each group from five IVM runs), mitochondrial polarization (n ¼ 150 for each group from five IVM runs), mitochondrion-associated gene expression (ND2, SDHD, CYTB, COX, ATP5B, and TFAM; n ¼ 20 per sample from three IVM runs), and mtDNA copy number (n ¼ 50 oocytes for each group from four IVM runs).

Statistical Analysis Data were analyzed using JMP-7 (SAS Institute Inc.). Between-group comparisons were performed by one-way ANOVA followed by Tukey-Kramer test. The variables were: season (summer, fall, and winter), proportion of cleaved oocytes, blastocyst rate, mitochondrial distribution categories (MitoTracker staining), mitochondrial activity (active vs. inactive, JC-dye), relative gene expression, and mtDNA copy number. Before the analysis, the data were arcsine transformed. The data are presented as means 6 SEM excluding the mtDNA data, which were presented by dispersion diagrams with mean line. For all the analyses, P values , 0.05 were considered significant.

RESULTS Seasonal Effects on Oocyte Developmental Competence The percentage of oocytes that were fertilized and cleaved to the 2- to 4-cell stage (42–44 h PF) did not differ between seasons and were 75% 6 2.13%, 76.63% 6 1.39%, and 75.4% 6 2.8% for summer, fall, and winter, respectively (P , 0.05; Fig. 1A). On the other hand, the percentage of embryos that developed to the blastocyst stage (7–8 days PF) was higher in the winter than in the summer, with an intermediate rate in the fall (7.0% 6 1.5%, 12.8% 6 1.5%, and 19.0% 6 1.1% for the summer, fall, and winter, respectively, P , 0.05; Fig. 1B). Seasonal Effects on Mitochondrial Cellular and Molecular Features

FIG. 1. Seasonal effects on oocyte developmental competence. A) Percentage of oocytes cleaved to the 2- to 4-cell stage, 42–44 h postfertilization. B) Percentage of embryos developed to the blastocyst stage, 7–8 days postfertilization. Data are presented as means 6 SEM; different lowercase letters indicate seasonal effect within embryonic stage, P , 0.05.

The pattern of mitochondrial distribution was examined throughout the summer, fall, and winter by live-cell dynamic fluorescence imaging. Representative images of mitochondrial localization and organization of MII-stage oocytes are presented in Figure 2. In all of the examined seasons, the four defined categories of mitochondrial distribution were evident. However, the percentage of oocytes within categories differed between seasons (P , 0.05). In the winter, category I oocytes dominated (68.7% 6 10.5%); in the summer, category III and

IV oocytes (42.0% 6 11.9% and 33.0% 6 5.5%, respectively) dominated, and in the fall, category II oocytes were predominant (49.7% 6 6.1%; Fig. 2A). In addition, mitochondrial polarization in the oocytes was examined by JC-1, a commonly used dye that stains mitochondria in a membrane potential-dependent manner. The proportions of high- and low-polarized mitochondrial membranes differed between oocyte categories (P , 0.05) in a pattern that was 4

Article 118

SEASONAL EFFECT ON MITOCHONDRIAL FEATURES

Downloaded from www.biolreprod.org. FIG. 2. Seasonal effect on mitochondrial distribution and polarity pattern accompanied by representative fluorescence microscopy images of the midline. A) Oocyte division into four categories according to mitochondrial distribution in the examined season (summer, fall, winter). 1) Category I: mitochondrial clumps in the oocyte cytoplasm. 2) Category II: more restricted mitochondrial clumps at the periphery of the oocyte. 3) Category III: oocytes display a small number of peripherally located mitochondria. 4) Category IV: display of intensive staining and defined as nonviable oocytes. B) Seasonal effect on the proportion of high-polarized mitochondrial membranes (Dwm) in categories I–III. C) Seasonal effect on the general proportion of highpolarized mitochondrial membranes in each season. D) Representative images of high and low mitochondrial polarization exhibited in oocyte. 1) Represent higher proportion of high-polarized mitochondria. 2) Represent higher proportion of low-polarized mitochondria. Data are presented as means 6 SEM; different lowercase letters indicate seasonal effect.

5

Article 118

GENDELMAN AND ROTH

Downloaded from www.biolreprod.org. FIG. 3. Seasonal effect on transcriptional level of mitochondrion-associated genes and mtDNA copy number. A) Transcript levels of ND2, SDHD, CYTB, COXII, ATP5B, and TFAM in the summer, fall, and winter. B) Comparison of mtDNA copy number in oocytes collected in summer, fall, and winter. Data are presented as means 6 SEM; different lowercase letters indicate seasonal effect (P , 0.05).

conserved between seasons (Fig. 2B). For example, the proportion of highly polarized mitochondria was higher in category I oocytes in all seasons. Nevertheless, the sum of polarized mitochondria from all the categories (I–IV) revealed a higher proportion of highpolarized mitochondria in oocytes collected during the winter versus summer (P , 0.05). Oocytes collected during the fall showed intermediate proportions (Fig. 2C).

RNA expression of mitochondrial-associated genes ND2, SDHD, CYTB, COXII, ATP5B, and TFAM differed between seasons, with reduced mRNA expression level for all of the examined genes (except TFAM) in the summer versus winter (P , 0.05). In the fall, mRNA expression of ND2, SDHD, and ATP5B was higher than in the winter, whereas that of CYTB and COXII was lower (P , 0.05; Fig. 3A). 6

Article 118


Downloaded from www.biolreprod.org. FIG. 4. Effect of the interaction between seasonality and CoQ10 on oocyte developmental competence. A) Percentage of oocytes cleaved to the 2- to 4cell stage, 42–44 h postfertilization. B) Percentage of embryos developed to the blastocyst stage, 7–8 days postfertilization. Data are presented as means 6 SEM; different lowercase letters indicate CoQ10 effect within embryonic stages (P , 0.05).

Mitochondrial DNA copy number is an important indicator of oocyte developmental competence. In general, there was large variation among individual oocytes, reflected by a wide range (81 429 to 1 259 733) of mtDNA copies. The average mtDNA copy number did not differ between seasons and was 491 274 6 229 881 in oocytes collected during the winter; 430 421 6 247 016 in the summer; and 476 684 6 199 691 in the fall (Fig. 3B).

oocytes that cleaved to the 2- to 4-cell stage (42–44 h PF; Fig. 4A) or that developed to the blastocyst stage. Oocyte maturation with a high CoQ10 dose (100 lM) reduced blastocyst formation in the winter (P , 0.05); maturation with 50 lM CoQ10 in the fall increased the percentage of oocytes that fertilized, cleaved, and further developed to the blastocyst stage (22.0% 6 1.8%) to a level similar to that achieved in the winter (19.0% 6 1.1%; Fig. 4B).

Interactive Effects of Seasonality and CoQ10 on Oocyte Developmental Competence

Effect of CoQ10 on Mitochondrial Features in Oocytes Collected in the Fall

Maturation of oocytes with increased doses of CoQ10 during the summer and winter did not affect the proportion of

Maturation of oocytes collected in the fall with 50 lM CoQ10 increased the proportion of category I oocytes and 7

Article 118

GENDELMAN AND ROTH

Downloaded from www.biolreprod.org. FIG. 5. Effect of CoQ10 addition on mitochondrial distribution and polarity pattern in oocytes collected in the fall. A) Oocyte division into the four categories according to the mitochondrial distribution. B) Proportion of high-polarized mitochondrial membranes (Dwm) in categories I–III in each group. C) General proportion of high-polarized mitochondrial membranes in each group. Data are presented as means 6 SEM; different lowercase letters indicate CoQ10 effect (P , 0.05).

decreased the proportion of category II oocytes. The proportion of category III and IV oocytes was not affected by CoQ10 (Fig. 5A). On the other hand, during the fall, oocytes treated with 50 lM CoQ10 exhibited a higher proportion of highly polarized mitochondria compared to nontreated oocytes (Fig. 5C). Note that the proportion of highly polarized mitochondria within categories I–IV did not differ between CoQ10-treated and nontreated oocytes (Fig. 5B). Furthermore, while CoQ10 did not affect mtDNA copy number (Fig. 6B), it did affect mRNA expression of the mitochondrion-associated genes, reflected by increased expression of ND2, SDHD, CYTB, COXII, and ATP5B (Fig. 6A) compared with nontreated oocytes collected

in the winter, and decreased expression of ND2 and ATP5B compared with nontreated oocytes collected in the fall. The expression levels of TFAM did not change. DISCUSSION Developmental competence of bovine oocytes decreases throughout the summer and remains low in the fall, even though the animals are no longer exposed to thermal stress [1, 26, 27]. While the underlying mechanism is not entirely clear, it seems to be multifactorial in nature [28]. In the current study, we provide new evidence for an association between reduced developmental competence during the summer and fall and 8

Article 118


Downloaded from www.biolreprod.org. FIG. 6. Effect of CoQ10 addition on transcription levels of mitochondrion-associated genes and mtDNA copy number in oocytes collected in the fall. A) Transcript levels of ND2, SDHD, CYTB, COXII, ATP5B, and TFAM in the treated fall oocytes as compared to nontreated fall and winter oocytes. B) Comparison of mtDNA copy number in treated versus nontreated fall-collected oocytes. Data are presented as means 6 SEM; different lowercase letters indicate CoQ10 effect (P , 0.05).

seasonal variations in mitochondrial features such as alterations in mitochondrial distribution within the oocyte, impaired proportion of highly polarized mitochondria, and altered expression of mitochondrion-associated genes, particularly those encoding oxidative phosphorylation complexes. The findings also suggest that season-induced alterations in the mitochondrial respiratory chain are involved in the reduction in embryonic development because CoQ10 was found to increase the expression of genes associated with the mitochondrial electron transport chain and improved developmental competence of oocytes collected during the fall. Taken together, these findings seem to provide additional insight into the complex

mechanism underlying the reduced developmental competence of oocytes during the summer and fall. Mitochondria play a pivotal role in cell/oocyte function [29]. The pattern of mitochondrial distribution within the MII oocyte has been shown to correlate with oocyte morphological characteristics and developmental competence [15]. In addition, mitochondrial dysfunction induced by photosensitization (R123) severely inhibits blastocyst development [30]. The findings of the current study indicate a clear association between the patterns of mitochondrial distribution (i.e., categories I–IV) and mitochondrial membrane polarity in matured oocytes, with high mitochondrial polarity in category I and low polarity in category IV. Interestingly, while the 9

Article 118

GENDELMAN AND ROTH

10

Article 118


ATP5B) and mitochondrial (ND2, CYTB, COXII) genes, with a prominent effect during the summer on those participating in the mitochondrial electron transport chain. Such alterations might cause a reduction in the number of active components of the mitochondrial electron transport chain, which in turn might lead to reduced ATP production. NADH dehydrogenase subunit 2 (ND2) is part of complex I in the mitochondrial electron transport chain that is involved in proton translocation across the inner mitochondrial membrane. Succinate dehydrogenase subunit D (SDHD) is one of the two transmembrane subunits of complex II. Cytochrome b (CYTB) is a subunit of complex III, which consists of a mitochondrion-encoded gene (mitochondrial cytochrome b) and 10 nuclear gene products. Cytochrome c oxidase subunit II (COXII) is part of complex IV and transfers electrons from cytochrome c to catalytic subunit 1. COXII provides the substrate-binding site and contains a copper center termed Cu (A), which is probably the primary acceptor in cytochrome c oxidase. ATP5B encodes a subunit of mitochondrial ATP synthase (complex V). ATP synthase is composed of two linked multisubunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, F0, comprising the proton channel. ATP5B is a subunit of complex F1. Given the important role of each of the mitochondrial electron transport chain complexes, it is highly likely that season-induced alterations in one or more of these components will impair mitochondrial function. In the current study, an increase in gene transcription was found in oocytes collected during the fall for SDHD, ND2, and ATP5B, which play a role in the entrance and last point in the electron transport chain, respectively. On the other hand, reduced transcription levels of CYTB and COXII were also evident. Both may act as limiting components of the mitochondrion’s oxidation phosphorylation capacity. Such alterations, that is, an increase or decrease in genes associated with the electron transport chain, might impair that chain of events and cause a decline in ATP levels, which in turn would impair oocyte developmental competence. Supporting this assumption are the findings for CoQ10. Coenzyme Q10 is a ubiquitous free-radical scavenger and a key component of the mitochondrial respiratory chain for ATP production [47]. In the present study, maturation of oocytes with 50 lM CoQ10 in the fall did not affect mtDNA copy number but induced changes in mitochondrial distribution within the oocytes and increased the proportion of polarized mitochondria. Moreover, incorporation of CoQ10 into the oocytes enhanced the proportion of embryos that developed to the blastocyst stage. Stojkovic et al. [23] reported that CoQ10 increases the ATP content in expanded blastocysts. Similarly, treatment with CoQ10 stimulates ATP formation in myocardial cells of mouse fetuses [48]. Therefore, it is reasonable to suggest that the observed increase in developmental competence of oocytes matured with CoQ10 during the fall is at least in part an outcome of the changes in gene transcription levels reported for CoQ10-treated oocytes. Because ATP is an essential energy source for motor proteins and one of the determinant factors in mitochondrial movement [49], it can be speculated that CoQ10-enhanced ATP production underlies the rearrangement of mitochondria within the oocyte in the fall. In support of this, an abnormal distribution of mitochondria is related to the inappropriate formation of the cytoplasmic microtubule network [50–53]. Nonetheless, beneficial effect of CoQ10 in improving blastocysts formation can also be a result of oxidative damage prevention. It should be noted, however, that CoQ10 did not improve oocyte developmental competence in the summer or winter, suggesting that CoQ10 beneficially contributes to oocyte developmental competence only in the face of moderate damage.

proportion of highly polarized mitochondria within each oocyte category was not affected by seasons, the distribution of oocytes into the categories was, with a high proportion of category I oocytes in the winter, a low proportion in the summer, and an intermediate proportion in the fall. In light of these findings, it seems that season-induced alterations in mitochondrial polarization and their distribution within the oocyte also affect their developmental competence. Moreover, these alterations are carried over to further developmental stages, as indicated by the reduced proportion of oocytes that fertilized, cleaved, and developed to the blastocyst stage. Mitochondrial membrane potential is a key indicator of cellular viability. It reflects the pumping of hydrogen ions across the inner membrane during the process of electron transport and oxidative phosphorylation, the driving force behind ATP production [12]. Although no definitive correlation has been shown between membrane potential and mitochondrial activity in somatic cells [31, 32] or in oocytes [33], various mitochondrial functions are dependent on the maintenance of membrane potential. These include protein import, ATP generation, lipid biogenesis, and acquisition of fertilization competence [13, 14]. It is therefore reasonable to assume that the seasonal trends in membrane potential noted in the present study underlie the reduction in oocyte developmental competence during the summer and fall. One might assume that these seasonal alterations result from reduced mtDNA copy number. In mammals (mice, rats, and pigs), mtDNA replication does not accrue during the first divisions, suggesting that the developing embryo is entirely dependent on the energy produced by oocyte-inherited mitochondria [34–37]. Reynier et al. [7] reported that mtDNA copy number is an important determinant of embryo viability: the average mtDNA copy number was significantly higher in fertilizable oocytes than in those that failed to undergo fertilization. In addition, mtDNA content in oocytes retrieved from patients with ovarian insufficiency was lower than in patients with a normal ovarian profile [38]. Nevertheless, our findings indicate that the average mtDNA number in matured oocytes does not differ between seasons and ranges between 373 000 and 807 794, similar to the number reported elsewhere for matured bovine oocytes [39, 40]. Therefore, it is less likely that oocyte mtDNA copy number is involved in reducing oocyte developmental competence during the hot season. In line with these results, manipulation of mtDNA copy number in a female germ line did not affect fertilization outcome [41] and was not associated with maternal age [42]. Further support is provided by the findings on mitochondrial transcription factor A (TFAM), which is responsible for mtDNA replication, transcription, and biogenesis of mitochondria [43, 44]; in mouse embryos, disruption of TFAM transcription causes severe mtDNA depletion with abolished oxidative phosphorylation [45]. However, in the present study, the transcription level of TFAM in oocytes did not differ between the seasons. Taken together, it seems that alterations in parameters other than mtDNA copy number underlie the reduced blastocyst outcome of summer and fall oocyte fertilization. Mitochondrial oxidative phosphorylation capacity is determined by the interplay between nuclear and mitochondrial genes [46]. Mitochondrial DNA encodes 13 proteins that participate in the oxidative phosphorylation process. The remaining mitochondrial respiratory chain proteins are encoded by nuclear DNA: they are translated in the cytoplasm and then imported into the mitochondria where they are assembled into functional complexes together with the mitochondrion-encoded polypeptides [16, 18]. Here we provide evidence for seasoninduced alterations in the expression of both nuclear (SDHD2,


In summary, acquisition of oocyte competence is a multifactorial process. In line with these, our results suggest an association between mitochondrial features and seasonal developmental competence of bovine oocytes. The findings also indicate that under moderate stress, incorporation of CoQ10 can improve mitochondrial distribution, membrane polarization, and expression of genes involved in the mitochondrial electron transport chain. Moreover, CoQ10 improved oocyte developmental competence and seems to be a promising candidate for improving in vitro production of bovine embryos in the fall.

21.

22.

23.

REFERENCES

24. 25.

26.

27. 28.

29.

30.

31.

32.

33.

34. 35.

36.

37. 38.

39.

40.

41.

42.

11

Article 118


1. Roth Z, Arav A, Bor A, Zeron Y, Braw-Tal R, Wolfenson D. Improvement of quality of oocytes collected in the autumn by enhanced removal of impaired follicles from previously heat-stressed cows. Reproduction 2001; 122:737–744. 2. Zeron Y, Ocheretny A, Kedar O, Borochov A, Sklan D, Arav A. Seasonal changes in bovine fertility: relation to developmental competence of oocytes, membrane properties and fatty acid composition of follicles. Reproduction 2001; 121:447–454. 3. Gendelman M, Roth Z. Seasonal effect on germinal vesicle-stage bovine oocytes is further expressed by alterations in transcript levels in the developing embryos associated with reduced developmental competence. Biol Reprod 2012; 86:1–9. 4. Payton RR, Romar R, Coy P, Saxton AM, Lawrence JL, Edwards JL. Susceptibility of bovine germinal vesicle stage oocytes from antral follicles to direct effects of heat stress in vitro. Biol Reprod 2004; 71: 1303–1308. 5. Roth Z, Hansen PJ. Disruption of nuclear maturation and rearrangement of cytoskeletal elements in bovine oocytes exposed to heat shock during maturation. Reproduction 2005; 129:235–244. 6. Dvorak M, Travnik P, Hanzelka Z, Stankova J, Sladek M. Ultrastructural and morphometric analysis of cytoplasmic structures in human oocytes obtained from tertiary ovarian follicles. Scripta Medica 1987; 60:131–140. 7. Reynier P, May-Panloup P, Chretien MF, Morgan CJ, Jean M, Savagner F, Barriere P, Malthiery Y. Mitochondrial DNA content affects the fertilizability of human oocytes. Mol Hum Reprod 2001; 7:425–429. 8. Hauswirth WW, Laipis PJ. Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows. Proc Natl Acad Sci U S A 1982; 79: 4686–4690. 9. Shoubridge EA, Wai T. Mitochondrial DNA and the mammalian oocyte. Curr Top Dev Biol 2007; 77:87–111. 10. Sathananthan AH, Trounso AO. Mitochondrial morphology during preimplantational human embryogenesis. Hum Reprod 2000; 15:148–159. 11. May-Panloup P, Chretien MF, Malthiery Y, Reynier P. Mitochondrial DNA in the oocyte and the developing embryo. Curr Top Dev Biol 2007; 77:51–83. 12. Nicholls DG, Ferguson SJ. Bioenergetics, 3rd ed. London: Academic Press; 2003: 57–88. 13. Van Blerkom J, Davis P. Mitochondrial signaling and fertilization. Mol Hum Reprod 2007; 13:759–770. 14. Voisine C, Craig EA, Zufall N, von Ahsen O, Pfanner N, Voos W. The protein import motor of mitochondria: unfolding and trapping of preproteins are distinct and separable functions of matrix Hsp70. Cell 1999; 97:565–574. 15. Stojkovic M, Machado SA, Stojkovic P, Zakhartchenko V, Hutzler P, Goncalves PB, Wolf E. Mitochondrial distribution and adenosine triphosphate content of bovine oocytes before and after in vitro maturation: correlation with morphological criteria and developmental capacity after in vitro fertilization and culture. Biol Reprod 2001; 64: 904–909. 16. Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, et al. Sequence and organization of the human mitochondrial genome. Nature 1981; 290:457–465. 17. Von Heijne G. Why mitochondria need a genome. FEBS Lett 1986; 198: 1–4. 18. Wallace DC. Mitochondrial genetics: a paradigm for aging and degenerative diseases? Science 1992; 256:628–632. 19. Gendelman M, Aroyo A, Yavin S, Roth Z. Seasonal effects on gene expression, cleavage timing, developmental competence of bovine preimplantation embryos. Reproduction 2010; 140:73–82. 20. Hamatani T, Falco G, Carter MG, Akutsu H, Stagg CA, Sharov AA,

Dudekula DB, VanBuren V, Ko MS. Age associated alteration of gene expression patterns in mouse oocytes. Hum Mol Genet 2004; 13: 2263–2278. Papucci L, Schiavone N, Witort E, Donnini M, Lapucci A, Tempestini A, Formigli L, Zecchi-Orlandini S, Orlandini G, Carella G, Brancato R, Capaccioli S. Coenzyme q10 prevents apoptosis by inhibiting mitochondrial depolarization independently of its free radical scavenging property. J Biol Chem 2003; 278:28220–28228. Rosenfeldt F, Marasco S, Lyon W, Wowk M, Sheeran F, Bailey M, Esmore D, Davis B, Pick A, Rabinov M, Smith J, Nagley P, et al. Coenzyme Q10 therapy before cardiac surgery improves mitochondrial function and in vitro contractility of myocardial tissue. J Thorac Cardiovasc Surg 2005; 129:25–32. Stojkovic M, Westesen K, Zakhartchenko V, Stojkovic P, Boxhammer K, Wolf E. Coenzyme Q(10) in submicron-sized dispersion improves development, hatching, cell proliferation, and adenosine triphosphate content of in vitro-produced bovine embryos. Biol Reprod 1999; 61: 541–547. Parrish JJ, Foote RH. Fertility of cooled and frozen rabbit sperm measured by competitive fertilization. Biol Reprod 1986; 35:253–257. Arav A. Transillumination increases oocyte recovery from ovaries collected at slaughter. A new technique report. Theriogenology 2001; 55:1561–1565. Rocha A, Randel RD, Broussard JR, Lim JM, Blair RM, Roussel JD, Godke RA, Hansel W. High environmental temperature and humidity decrease oocyte quality in Bos taurus but not in Bos indicus cows. Theriogenology 1998; 49:657–665. Rutledge JJ. Use of embryo transfer and IVF to bypass effects of heat stress. Theriogenology 2001; 55:105–111. Roth Z. Heat stress, the follicle, and its enclosed oocyte: mechanisms and potential strategies to improve fertility in dairy cows. Reprod Domest Anim 2008; 43:238–244. Van Blerkom J. Mitochondrial function in the human oocyte and embryo and their role in developmental competence. Mitochondrion 2011; 11: 797–813. Thouas GA, Trounson AO, Wolvetang EJ, Jones GM. Mitochondrial dysfunction in mouse oocytes results in preimplantation embryo arrest in vitro. Biol Reprod 2004; 71:1936–1942. Smiley ST, Reers M, Mottola-Hartshorn C, Lin M, Chen A, Smith TW, Steele GD Jr, Chen LB. Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J-aggregate-forming lipophilic cation JC-1. Proc Natl Acad Sci U S A 1991; 88:3671–3675. Diaz G, Setzu MD, Zucca A, Isola R, Diana A, Murru R, Sogos V, Gremo F. Subcellular heterogeneity of mitochondrial membrane potential: relationship with organelle distribution and intercellular contacts in normal, hypoxic and apoptotic cells. J Cell Sci 1999; 112:1077–1084. Van Blerkom J, Davis P, Alexander S. Inner mitochondrial membrane potential (DeltaPsim), cytoplasmic ATP content and free Ca2 þ levels in metaphase II mouse oocytes. Hum Reprod 2003; 18:2429–2440. Ebert KM, Liem H, Hecht NB. Mitochondrial DNA in the mouse preimplantation embryo. J Reprod Fertil 1988; 82:145–149. Piko L, Taylor KD. Amounts of mitochondrial DNA and abundance of some mitochondrial gene transcripts in early mouse embryos. Dev Biol 1987; 123:364–374. Kameyama Y, Filion F, Yoo JG, Smith LC. Characterization of mitochondrial replication and transcription control during rat early development in vivo and in vitro. Reproduction 2007; 133:423–432. Smith LC, Alcivar AA. Cytoplasmic inheritance and its effects on development and performance. J Reprod Fertil 1993; 48:31–43. May-Panloup P, Chretien MF, Jacques C, Vasseur C, Malthiery Y, Reynier P. Low oocyte mitochondrial DNA content in ovarian insufficiency. Hum Reprod 2005; 20:593–597. Iwata H, Goto H, Tanaka H, Sakaguchi Y, Kimura K, Kuwayama T, Monji Y. Effect of maternal age on mitochondrial DNA copy number, ATP content and IVF outcome of bovine oocytes. Reprod Fertil Dev 2011; 23:424–432. May-Panloup P, Vignon X, Chre´tien MF, Heyman Y, Tamassia M, Malthie`ry Y, Reynier P. Increase of mitochondrial DNA content and transcripts in early bovine embryogenesis associated with upregulation of mtTFA and NRF1 transcription factors. Reprod Biol Endocrinol 2005; 14: 65–73. Wai T, Ao A, Zhang X, Dufort D, Shoubridge EA. The role of mitochondrial DNA copy number in mammalian fertility. Biol Reprod 2010; 83:52–62. Barritt JA, Kokot M, Cohen J, Steuerwald N, Brenner CA. Quantification of human ooplasmic mitochondria. Reprod Biomed 2002; 4:243–247.

GENDELMAN AND ROTH 43. Fisher RP, Clayton DA. Purification and characterization of human mitochondrial transcription factor 1. Mol Cell Biol 1988; 8:3496–3509. 44. Scarpulla RC. Nuclear control of respiratory gene expression in mammalian cells. J Cell Biochem 2006; 97:673–683. 45. Larsson NG, Wang J, Wilhelmsson H, Oldfors A, Rustin P, Lewandoski M, Barsh GS, Clayton DA. Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat Genet 1998; 18:231–236. 46. Thundathil J, Filion F, Smith LC. Molecular control of mitochondrial function in preimplantation mouse embryos. Mol Reprod Dev 2005; 71: 405–413. 47. Horowitz S. CoQ10: one antioxidant, many promising applications. Altern Complement Ther 2003; 9:111–116. 48. Kishi T, Okamoto T, Takahashi T, Goshima K, Yamagami T. Cardiostimulatory action of coenzyme Q homologues on cultured myocardial cells and their biochemical mechanisms. Clin Invest 1993; 71:S71–S75.

49. Zhang X, Wu XQ, Lu S, Guo YL, Ma X. Deficit of mitochondria-derived ATP during oxidative stress impairs mouse MII oocyte spindles. Cell Res 2006; 160:841–850. 50. Nagai S, Mabuchi T, Hirata S, Shoda T, Kasai T, Yokota S, Shitara H, Yonekawa H, Hoshi K. Correlation of abnormal mitochondrial distribution in mouse oocytes with reduced developmental competence. Tohoku J Exp Med 2006; 210:137–144. 51. Van Blerkom J. Microtubule mediation of cytoplasmic and nuclear maturation during the early stages of resumed meiosis in cultured mouse oocytes. Proc Natl Acad Sci U S A 1991; 88:5031–5035. 52. Reynolds IJ, Malaiyandi LM, Coash M, Rintoul GL. Mitochondrial trafficking in neurons: a key variable in neurodegeneration? J Bioenerg Biomembr 2004; 36:283–285. 53. Tiziana AL, Brevini RV, Chiara F, Fulvio Gandolfi F. Role of adenosine triphosphate, active mitochondria, and microtubules in the acquisition of developmental competence of parthenogenetically activated pig oocytes. Biol Reprod 2005; 72:1218–1223.


12

Article 118