JAC
Journal of Antimicrobial Chemotherapy (2002) 49, 625–630
Increase in MICs of ciprofloxacin in vivo in two closely related clinical isolates of Enterobacter cloacae Hans-Jörg Lindea*, Frank Notkaa, Christine Irtenkaufa, Jochen Deckera, Jens Wilda, Hans-Helmut Nillera, Peter Heisigb and Norbert Lehna a
Institute for Medical Microbiology and Hygiene, University of Regensburg, Regensburg; Department for Pharmaceutical Biology, Institute of Pharmacy, University of Hamburg, Hamburg, Germany
b
The mechanisms of fluoroquinolone resistance in two isolates of Enterobacter cloacae, Ecl#1 and Ecl#2, from the same patient and with identical pulsed-field gel electrophoresis patterns, have been analysed. MICs of ciprofloxacin were 0.25 and 1 mg/L for Ecl#1 and Ecl#2, respectively. Ecl#2 was also more resistant to chloramphenicol and organic solvents. The quinolone resistance determining regions of gyrA/B and parC/E, and the marORA and acrB genes, were sequenced. Expression of marR, acrB, soxS, robA, ramA and fis was analysed by northern blotting. The activity of a 90 bp E. cloacae mar promoter fragment was examined with the reporter plasmid pIGJ-1mar. Sequencing the gyrAB and parCE genes revealed a single amino acid substitution in GyrA (corresponding to position 83 in GyrA of Escherichia coli) in Ecl#1 and Ecl#2 (Phe83) compared with reference strain E. cloacae DSMZ 3264 (Thr83). Ecl#2 accumulated significantly less norfloxacin and displayed higher levels of expression of marR and acrB than Exl#1, indicative of greater fluoroquinolone efflux activity. Sequencing gyrB, parC/E and marORA, and northern blotting of robA, ramA and fis, did not reveal any further differences between the two strains. No homologue of soxRS was detected in E. cloacae. Expression of GFP from pIGJ1-mar in Ecl#2 was higher than in Ecl#1. In these two closely related clinical isolates of E. cloacae, a target mutation in GyrA (Ecl#1 and Ecl#2) and increased fluoroquinolone efflux by AcrAB (Ecl#2) contribute to the resistance phenotypes, corroborating findings in vitro and in vivo about the sequential development of fluoroquinolone resistance.
Introduction Based on data obtained in vitro, it has been proposed that the development of fluoroquinolone resistance in Escherichia coli is due to progressive accumulation of target alterations in GyrA, mutations that increase active efflux, and target alterations in ParC.1 It is not clear whether this combination of specific and non-specific resistance mechanisms is peculiar to this E. coli K12 strain, to E. coli in general or to the situation in vitro. We have shown that, in E. coli, overexpression of the AcrAB efflux pump system increases fluoroquinolone resistance over and above that conferred by target mutations in GyrA and ParC.2 The natural role of the AcrAB efflux pump system may be to confer resistance to substances hazardous to the bacteria,
including such structurally diverse compounds as fluoroquinolones, tetracyclines, chloramphenicol, organic solvents, oxidative stress agents and the disinfectant triclosan, many of which may be environmental.3–5 In E. coli, expression of AcrAB is regulated negatively by its repressor AcrR and positively by the transcription factors MarA and SoxS.6 As in a signal cascade, production of MarA is regulated by various positive and negative transcription factors, specifically MarR,7 MarA,8 SoxS,6 RobA9 and Ram,10 and the accessory factor Fis,9 as demonstrated in studies with E. coli and Klebsiella pneumoniae. In the present study, we analysed the resistance mechanisms of two closely related clinical isolates of Enterobacter cloacae with reduced susceptibility to ciprofloxacin (CIP), chloramphenicol (CAT), doxycycline (DOX) and organic solvents.
*Corresponding author. Tel: 49-941-944-6461; Fax: 49-941-944-6402; E-mail:
[email protected]
625 © 2002 The British Society for Antimicrobial Chemotherapy
H.-J. Linde et al.
Materials and methods Bacterial strains E. cloacae strains Ecl#1 and Ecl#2 were isolated from the same patient on the same day. Ecl#1 was isolated as the sole organism from the conjunctiva, displaying clinical symptoms of conjunctivitis. Ecl#2 was recovered during surgical revision of peritonitis, after extensive resection of the pancreas and abscess formation. The patient had received a cumulative dose of CIP 1200 mg for the treatment of peritonitis until 6 days before the samples were taken. He was then switched to piperacillin/sulbactam, and finally to imipenem, when the microbiological results became available. E. cloacae DSMZ 3264 was obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany). The E. coli strain S17 containing plasmid pBP591 with wild-type marR has been described previously.11 Enterobacter strains were identified by the VITEK system (bioMérieux Vitek, Hazelwood, MO, USA) and comparison of 16S rRNA sequences with GenBank sequences.
An attempt was made to amplify soxRS from adjacent gene loci, assuming similar gene arrangements in E. coli and E. cloacae. Using E. coli specific primers for yicC and yicD, a PCR product of the expected size was recovered using E. cloacae genomic DNA as template; however, when sequenced, no sequences or open reading frames homologous to the soxRS genes of E. coli were detected by BLAST search.
RNA extraction and northern blot analysis Overnight cultures were diluted 100-fold in LB broth and grown with shaking to mid-logarithmic phase at 37C. Paraquat (45 min, final concentration 1.3 mM; Sigma, Deisenhofen, Germany) was added to induce the sox operon or its equivalent. Digoxigenin-labelled probes were obtained by PCR. RNA was purified with the RNeasy Purification Kit (Qiagen, Hilden, Germany). Northern blotting was carried out using standard techniques,14 with glyceraldehyde phosphate dehydrogenase specific probes for control.
Complementation assays
PFGE A rapid pulsed-field gel electrophoresis (PFGE) procedure was carried out as described previously.12 Chromosomal DNA was digested with SpeI at 37C for 3 h. Electrophoresis was carried out with the CHEF-mapper system (BioRad, Hercules, CA, USA). The run time was 14 h, with an initial switch time of 2.16 s and a final switch time of 35 s.
Susceptibility testing MICs of CIP, CAT and DOX were determined by Etest (AB Biodisk, Solna, Sweden). To test organic solvent tolerance, isolates were inoculated on to Mueller–Hinton agar at a concentration of 105 cfu/spot and the agar surface was overlaid with hexane and cyclohexane to generate different levels of organic solvent toxicity. Hexane and cyclohexane have distribution coefficients in octanol/water of 3.9 and 3.4, respectively.13 The plates were checked for visible bacterial growth after 2 days incubation at 37C.
DNA amplification and nucleotide sequence determination Primers and PCR conditions for amplification of partial regions of the gyrA, gyrB, parC, parE, marRA, acrB, soxS, robA, fis, yjcC, yjcD and ram genes are listed in Table 1. Complementary strands were sequenced in duplicate using PCR primers (6 pmol) on a 310 DNA sequencer (PerkinElmer, Foster City, CA, USA). In contrast to all other target genes, we were unable to amplify a sox homologue using various sets of primers specific for the E. coli gene under low-stringency conditions.
For complementation tests, the marR wild-type gene of E. coli under the control of the bla promoter was introduced into Ecl#1 and Ecl#2 by mobilization, using the filter mating technique.15 The donor strain E. coli S17 containing plasmid pBP591 and the recipient strain, Ecl#1 or Ecl#2, were mixed in a 1:1 ratio and incubated at 37C for 12 h on minimal agar. Cells were scraped from the surface of the agar, suspended in LB broth and plated on LB agar containing kanamycin 50 mg/L for selection.
Accumulation of norfloxacin Accumulation of norfloxacin (NOR) was determined according to Martínez-Martínez et al.16 to demonstrate active efflux mechanism(s). Bacteria were incubated with NOR (10 mg/L, 10 min) in the absence and presence of carbonyl cyanide m-chlorophenylhydrazone (CCCP, 0.1 mM). Fluorescence (proportional to the concentration of NOR) was determined on a Hitachi F 2000 fluorescence spectrophotometer (Hitachi, Tokyo, Japan; excitation 279 nm, emission 445 nm).
Promoter studies PCR fragments of 252, 96 and 30 bp of marO of Ecl#1 immediately upstream of the transcription start of marR were cloned in-frame into the pUC18-derived reporter plasmid pIGJ containing the CAT and GFP genes using a BglII restriction site (Figure 2a). Plasmids pIGJ-1mar (252 bp), pIGJ-4mar (96 bp) and pIGJ-5mar (30 bp) were introduced into Ecl#1 and Ecl#2, and the expression of GFP was determined by fluorescence-activated cell sorting
626
627
yjcC–yjcD
ram
fis
robA
soxS
acrB
marO
marA
marR
parE
parC
gyrB
gyrA
Gene
CGACCTTGCGAGAGAAAT GTTCCATCAGCCCTTCAA AACTGGCAGACTGCCAGGAAC GCCAAGCGCGGTGATAAGC TGAATTTACGGAAAACGCCTA GCCACTTCACGCAGGTTATG TACCGAGCTGTTCCTTGTGG GGCAATGTGCAGACCATCAG TATCTGCCGTGACTAAACTAC TTGCGTCGTGACATCGTC ACTCGTAGGACAAACACTGC GTATTCATAGCATAGTGGT AGACCGGGAATCGAAATAC AACCATATGAATAAGACGACC TGTTCGAGAAGAGCACGCACCAC CCACGATTGCGGGCAGGTTAAAG ATAGAATTCACCAATAAAATTAC AGGCGGATACTCGAGATGTCCCA TCAGAAAATTATTCAG TCGCGACCTTTTAATCTG ATACCTCTTGCTCGTCGTC ACAACGCGTAAATTCTGAC CATCATCAGCGCAGCAC GCGCCAGTGCAGTATCAGAG GGATCTCAACCAGCTCTATACG TTATGCAATGGATGGAGC GCAACCACTTCCTGACG
Primers (forward/reverse)
50
42
50
50
50
50
50
50
50
45
50
50
50
Tm (C)
AF302683
AF302684
AF302681
AF302680
AF302679
AF302678
AF302677
AF302676
GenBank accession no.
(232)
(568)
(333)
81 (455)
85 (100)
86 (336)
79 (434)
91 (257)
85 (269)
93 (190)
88 (401)
% similarity (nuc)
86
98
89
100
94
100
87
% similarity (aa)
1559–2013
1341–1441
1894–2230
1446–1880
1231–1498
172–441
1227–1416
55–455
Section (nuc)
this study
this study, NB
this study, NB
this study, NB
ref. 2
this study
this study
this study
this study
ref. 22
this study
modified from ref. 22
from ref. 20
Remarks
Table 1. Primers and annealing temperatures (Tm) used in this study: the percentage similarity of the nucleotide (nuc) and amino acid (aa) sequences of the respective genes are calculated compared with E. coli
MICs of ciprofloxacin in E. cloacae
H.-J. Linde et al. (FACS). The mean fluorescence intensity (MFI) was specified. FACS analysis was carried out on a FACSCalibur (Becton-Dickinson, San Jose, CA, USA) cell sorter using CellQuest (Becton Dickinson) analysis software. The graph was generated using WinMDI software.
GenBank accession numbers GenBank accession numbers of E. cloacae genes are listed in Table 1.
Data analysis SPSS 8.0 for Windows was used for calculation of the Mann–Whitney U-test results.
Results and discussion Two isolates of E. cloacae (Ecl#1 and Ecl#2) were recovered from two infection sites (conjunctivitis and peritonitis) in the same patient. The isolates showed identical PFGE patterns (data not shown) and 100% identity in all gene sequences obtained in the course of the study. Thus, the isolates can be considered to be genetically and epidemiologically closely related. From our data, we cannot decide whether fluoroquinolone resistance in the two isolates evolved independently or sequentially. Ecl#1 and Ecl#2 display different CIP MICs of 0.25 and 1 mg/L, respectively, and Ecl#2 is more resistant to organic solvents, DOX and CAT (Table 2). Because the patient had follow-on therapy with imipenem, no more isolates of E. cloacae were obtained. Sequencing the quinolone resistance determining regions of gyrA, gyrB, parC and parE revealed a single amino acid substitution at residue 83 of GyrA of Ecl#1 and Ecl#2 (Phe83) compared with DSMZ 3264 (Thr83). This is a conservative mutation compared with Ser83 found in other CIPR clinical isolates of E. cloacae.17,18 Residue 83 is critical for quinolone resistance in E. coli and E. cloacae,19,20 and the amino acid substitution is consistent with the elevated
CIP MIC of Ecl#1 compared with DSMZ 3264. In addition, various silent mutations were noted in the topoisomerase gene sequences of Ecl#1 and Ecl#2 compared with those of DSMZ 3264. Elevated MICs of the structurally unrelated antibiotics CAT and DOX, together with the increase in organic solvent tolerance displayed by Ecl#2 compared with Ecl#1, are consistent with an efflux phenotype. The role of an efflux mechanism in quinolone resistance of Ecl#2 was confirmed by its significantly lower NOR accumulation (P 0.001). The metabolic uncoupler CCCP increased NOR accumulation in both strains; however, accumulation by Ecl#2 was affected more. Consistent with these findings, increased expression of marR and acrB in Ecl#2, compared with Ecl#1 and DSMZ 3264, was demonstrated by northern blotting (Figure 1). To investigate further the regulation of marRA expression in the E. cloacae strains and to evaluate the possible role of marOR, the promoter regions (marO) and the repressor genes (marR) of Ecl#1 and Ecl#2 were sequenced. The corresponding sequences in both strains were found to be identical. Both showed differences in MarR, compared with DSMZ 3264, at residue 6 (Tyr instead of Ile) and residue 80 (Val instead of Ala). Complementation of Ecl#2 with the marR wild-type sequence of E. coli had no effect on the MIC of CIP. The transcription factors SoxS,6 Ram10 and RobA9 and the accessory factor Fis9 also act on the mar operon. However, northern blotting of robA, fis and ram detected lowlevel expression of these genes in both strains, with no apparent differences (data not shown). In contrast to all other target genes, we were unable to identify a sox homologue by PCR using several sets of primers specific for the E. coli genes, under low-stringency conditions or by northern blotting with different probes. Although these results do not necessarily rule out the presence of a sox homologue in DSMZ 3264, Ecl#1 and Ecl#2, our results argue against it. The hypothesis that the presence or absence of an unknown factor influences expression of the mar locus in Ecl#2 was challenged by the introduction of reporter plasmids into Ecl#1 and Ecl#2. When plasmids pIGJ-1mar
Table 2. Characteristics of E. cloacae strains: results of MIC testing, organic solvent tolerance, GyrA alteration and transcription level of marA and acrB OST (growth)a
MIC (mg/L) Strain DSMZ 3264 Ecl#1 Ecl#2
CIP
DOX
CAT
H
CH
GyrAb aa 83
0.016 0.25 1
2 12 24
3 6 16
()
Thr Phe Phe
a
Organic solvent tolerance: H, hexane; CH, cyclohexane. Numbering according to E. coli.23
b
628
Transcription marR
acrB
()
MICs of ciprofloxacin in E. cloacae
Figure 1. Northern blot analysis of mRNA levels of gapdh (a), marR (b) and acrB (c). Total RNA was prepared from E. cloacae strains Ecl#1, Ecl#2 and DSMZ 3264, transferred to Hybond-N membranes and probed with digoxigenin-labelled PCR products.
(252 bp) and pIGJ-4mar (96 bp) were introduced into Ecl#1 and Ecl#2, expression of GFP was greater in Ecl#2 than in Ecl#1, as detected by FACS analysis (8547 MFI versus 1570 MFI; Figure 2b, data not shown for pIGJ4mar). Introduction of pIGJ-5mar (30 bp) did not give a differential effect. This finding indicates that the region of bp –96 to –30 relative to the transcription start of marR (a region that in E. coli contains the Fis-binding site and the marbox for binding of MarA, SoxS and RobA)9 interacts with the putative factor. Experiments are in hand to identify the factor. What is the basic level of activity of efflux pumps of Enterobacteriaceae under natural circumstances in the host?21 Our findings of constitutive overexpression of MarR (which is cotranscribed with MarA) in Ecl#2 in the present study and of MarA in E. coli2 indicate that physiological regulation of the AcrAB locus does not generate sufficient efflux pump activity under conditions in vivo. Two observations indicate that the constitutive overexpression of MarRA in Ecl#2 does not influence the biological fitness of the bacterium. First, the isolate was grown from a site of infection 6 days after the last dose of CIP and therefore has to be regarded as fully pathogenic. Second, growth curves (obtained by recording optical density over time until stationary growth; data not shown) of the two isolates Ecl#1 and Ecl#2 revealed no apparent difference compared with those of three other clinical wild-type E. cloacae isolates. In conclusion, in this pair of closely related clinical isolates of E. cloacae, different levels of quinolone resistance can be explained by increased AcrAB efflux pump activity in the more resistant strain, in addition to a target mutation
Figure 2. (a) Map of reporter plasmid pIGJ-1mar containing a 252 bp fragment with the promoter region marO of Ecl#1. (b) FACS analysis of expression of GFP from pIGJ-1mar in the genetic background of Ecl#1 (#1) and Ecl#2 (#2). Ecl#1 and Ecl#2 without the plasmid were included for controls (#1–, #2–).
in GyrA in both strains. These data corroborate findings in vitro1 and in vivo2 concerning the sequential development of fluoroquinolone resistance.
Acknowledgements Sequencing was carried out by Holger Melzl and Josef Köstler. We thank Birgit Huber, Thomas Grundler and Peter Neumann for excellent technical assistance. This study was presented in part at the 40th Interscience Conference on Antimicrobial Agents and Chemotherapy, Toronto, Canada, 17–20 September 2000.
References 1. Kern, W. V., Oethinger, M., Jellen-Ritter, A. S. & Levy, S. B. (2000). Non-target gene mutations in the development of fluoroquinolone resistance in Escherichia coli. Antimicrobial Agents and Chemotherapy 44, 814–20. 2. Linde, H., Notka, F., Metz, M., Kochanowski, B., Heisig, P. & Lehn, N. (2000). In vivo increase in resistance to ciprofloxacin in Escherichia coli associated with deletion of the C-terminal part of MarR. Antimicrobial Agents and Chemotherapy 44, 1865–8. 3. Alekshun, M. N. & Levy, S. B. (1997). Regulation of chromosomally mediated multiple antibiotic resistance: the mar regulon. Antimicrobial Agents and Chemotherapy 41, 2067–75.
629
H.-J. Linde et al. 4. Alekshun, M. N. & Levy, S. B. (1999). The mar regulon: multiple resistance to antibiotics and other toxic chemicals. Trends in Microbiology 7, 410–3.
15. Heisig, P. (1996). Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli. Antimicrobial Agents and Chemotherapy 40, 879–85.
5. McMurry, L. M., Oethinger, M. & Levy, S. B. (1998). Overexpression of marA, soxS, or acrAB produces resistance to triclosan in laboratory and clinical strains of Escherichia coli. FEMS Microbiology Letters 166, 305–9.
16. Martínez-Martínez, L., García, I., Ballesta, S., Benedi, V. J., Hernandez-Allés, S. & Pascual, A. (1998). Energy-dependent accumulation of fluoroquinolones in quinolone-resistant Klebsiella pneumoniae strains [published erratum appears in Antimicrobial Agents and Chemotherapy 42, 2772]. Antimicrobial Agents and Chemotherapy 42, 1850–2.
6. Miller, P. F. & Sulavik, M. C. (1996). Overlaps and parallels in the regulation of intrinsic multiple-antibiotic resistance in Escherichia coli. Molecular Microbiology 21, 441–8. 7. Martin, R. G. & Rosner, J. L. (1995). Binding of purified multiple antibiotic-resistance repressor protein (MarR) to mar operator sequences. Proceedings of the National Academy of Sciences, USA 92, 5456–60. 8. Martin, R. G., Jair, K. W., Wolf, R. E., Jr & Rosner, J. L. (1996). Autoactivation of the marRAB multiple antibiotic resistance operon by the MarA transcriptional activator in Escherichia coli. Journal of Bacteriology 178, 2216–23. 9. Martin, R. G. & Rosner, J. L. (1997). Fis, an accessorial factor for transcriptional activation of the mar (multiple antibiotic resistance) promoter of Escherichia coli in the presence of the activator MarA, SoxS, or Rob. Journal of Bacteriology 179, 7410–9. 10. George, A. M., Hall, R. M. & Stokes, H. W. (1995). Multidrug resistance in Klebsiella pneumoniae: a novel gene, ramA, confers a multidrug resistance phenotype in Escherichia coli. Microbiology 141, 1909–20. 11. Hüllen, V., Heisig, P. & Wiedemann, B. (1997). Role of marR mutations in the development of clinical resistance of Escherichia coli against fluoroquinolones. In Abstracts of the Thirty-seventh Interscience Conference on Antimicrobial Agents and Chemotherapy, Abstract C-64, p. 57. American Society for Microbiology, Washington, DC. 12. Gautom, R. K. (1997). Rapid pulsed-field gel electrophoresis protocol for typing of Escherichia coli O157:H7 and other gramnegative organisms in 1 day. Journal of Clinical Microbiology 35, 2977–80.
17. Brisse, S., Milatovic, D., Fluit, A. C., Verhoef, J., Martin, N., Scheuring, S. et al. (1999). Comparative in vitro activities of ciprofloxacin, clinafloxacin, gatifloxacin, levofloxacin, moxifloxacin, and trovafloxacin against Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, and Enterobacter aerogenes clinical isolates with alterations in GyrA and ParC proteins. Antimicrobial Agents and Chemotherapy 43, 2051–5. 18. Dekitsch, C., Schein, R., Markopulos, E., Kuen, B., Graninger, W. & Georgopoulos, A. (1999). Analysis of mutations to gyrA in quinolone-resistant clinical isolates of Enterobacter cloacae. Journal of Medical Microbiology 48, 73–7. 19. Deguchi, T., Yasuda, M., Nakano, M., Ozeki, S., Kanematsu, E., Nishino, Y. et al. (1997). Detection of mutations in the gyrA and parC genes in quinolone-resistant clinical isolates of Enterobacter cloacae. Journal of Antimicrobial Chemotherapy 40, 543–9. 20. Weigel, L. M., Steward, C. D. & Tenover, F. C. (1998). gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae. Antimicrobial Agents and Chemotherapy 42, 2661–7. 21. Oethinger, M., Podglajen, I., Kern, W. V. & Levy, S. B. (1998). Overexpression of the marA or soxS regulatory gene in clinical topoisomerase mutants of Escherichia coli. Antimicrobial Agents and Chemotherapy 42, 2089–94. 22. Everett, M. J., Jin, Y. F., Ricci, V. & Piddock, L. J. (1996). Contributions of individual mechanisms to fluoroquinolone resistance in 36 Escherichia coli strains isolated from humans and animals. Antimicrobial Agents and Chemotherapy 40, 2380–6.
13. Aono, R. (1998). Improvement of organic solvent tolerance level of Escherichia coli by overexpression of stress-responsive genes. Extremophiles 2, 239–48.
23. Cohen, S. P., Hächler, H. & Levy, S. B. (1993). Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli. Journal of Bacteriology 175, 1484–92.
14. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA.
Received 1 March 2001; returned 9 November 2001; revised 3 December 2001; accepted 11 January 2001
630
