American Journal of Pathology, Vol. 152, No. 2, February 1998 Copyright X American Society for Investigative Pathology
Increased Expression of Monocyte Chemotactic Protein-1 during Active Hepatic Fibrogenesis Correlation with Monocyte Infiltration
Fabio Marra,* Raffaella DeFranco,* Cecilia Grappone,t Stefano Milani,t Sabrina Pastacaldi,* Massimo Pinzani,* Roberto G. Romanelli,* Giacomo Laffi,* and Paolo Gentilini* From the Istituto di Medicina Interna* and Dipartimento di Fisiopatologia Clinica,t Unita di Gastroenterologia, Universita di Firenze, Florence, Italy
Monocyte chemotactic protein (MCP)-1 is a chemoattractant and activator for circulating monocytes and T lymphocytes. We investigated MCP-1 protein and gene expression during chronic liver disease at different stages, using mmunohistochemistry and in situ hybridization, respectively. In normal liver, a modest expression of MCP-1 was confined to few perisinusoidal cells and to bile duct epithellal cells. During chronic hepatitis, MCP-1 mmunosning and gene expression were evident in the inflammatory infiltrate of the portal tract. In tissue from patients with active cirrhosis, MCP-1 expression was clearly up-regulated and was present in the portal tract, in the epithellal cells of regenerating bile ducts, and in the active septa surrounding regenerating nodules. A combination of in situ hybridization for MCP-1 and immunohistochemistry showed that activated stellate cells and monocyte/macrophages contribute to MCP-1 expression in vivo together with bile duct epithelial cells. Comparison of serial sections of liver biopsies from patients with various degrees of necroInflammatory activity showed that infiltration of the portal tracts with monocytes/macrophages is dietly correlated with the expression of MCP-1. These data expand previous in vitro studies showing that secretion of MCP-1 may contribute to the formation and maintenance of the inflammatory Inflltrate observed during chronic liver disease. (Am J Pathol 1998,
primary hepatocellular insult, such as that caused by hepatitis viruses, toxic agents, or immune-mediated damage, leads to infiltration of inflammatory cells is largely unknown. Recruitment of monocytes and lymphocytes from the bloodstream, together with proliferation of the resident macrophages, appears to be the most relevant mechanism.2'3 The recruitment of leukocytes is regulated by chemotactic agents, which cause directional movement of the cells according to concentration gradients. Studies conducted over the last 10 years have identified chemokines as a new class of proteins that act as leukocyte chemoattractants in a relatively specific manner.4'5 The chemokines may be distinguished in four subclasses based on the position of conserved cysteine residues. The group of CXC chemokines includes a variety of factors that are mainly, but not exclusively, chemotactic for neutrophils, such as interleukin (IL)-8.4'5 Lymphotactin, a cytokine that specifically attracts lymphocytes, is the only known member of the C class of chemokines.6 The CC group includes molecules with two adjacent conserved cysteine residues, which are chemotactic for monocytes and lymphocytes.4'5 A novel cell-associated chemokine characterized by a CX3C motif and higher molecular weight has been recently identified.7 Monocyte chemotactic protein (MCP)-1, a chemokine of the CC group, determines recruitment and activation of monocytes and T lymphocytes.8-11 MCP-1 is secreted by a large number of cells in culture, including mesenchymal, epithelial, and neoplastic cells.12-15 Accumulating in vitro and in vivo evidence indicates that MCP-1 may play an important role in mediating the recruitment and activation of inflammatory cells during a number of diseases. MCP-1 expression is potently regulated by proinflammatory cytokines, such as IL-1 or tumor necrosis factor-a, which are produced in different inflammatory states.12'15 Moreover, MCP-1 expression has been shown to be increased in a number of pathological conditions, including atherosclerosis, pulmonary fibrosis, and kidney diseases.16-16 Interventions aimed at blocking the actions of MCP-1 have
152:423-430)
Inflammatory infiltration is a common histological abnormality during chronic liver disease. Mononuclear cells penetrate the hepatic lobule and contribute to the eventual development of liver fibrosis and cirrhosis.1 How a
Supported by grants from MURST (Liver Cirrhosis and Viral Hepatitis Project) and by the Italian Liver Foundation. Accepted for publication November 6, 1997. Address reprint requests to Dr. Fabio Marra, Istituto di Medicina Interna, UniversitA di Firenze, Viale Morgagni 85, 1-50134 Florence, Italy. E-mail:
[email protected].
423
424 Marra et al AJP February 1998, Vol. 152, No. 2
:. ;
0.. I
t
.-I ,
.
.,*'a
~~~~~~~~~~~.
|
l!
,
'
l
x
A ,,_.X,r^ .-
--
I
,
Figure 1. Immunostaining for MCP-1 in normal liver tissue and during chronic liver disease. Sections of liver tissues were immunostained with polyclonal anti-MCP-1 antibody as described in Material and Methods. A: In the portal tract of normal liver, MCP-1 expression is confined to epithelial cells of the bile ducts (bd) and to isolated cells in sinusoidal position (arrowhead). Branches of the hepatic artery (ha) and portal vein (pv) are negative. B: In chronic active hepatitis, specific signal is present in inflammatory cells of the portal tract (pt, arrows). MCP-1 immunostaining is also evident in active septa originating from the portal tract (arrowheads). C: In cirrhosis with chronic active hepatitis, intense staining is present at the interface between the fibrous septum (S) and the cirrhotic nodule (N), especially in areas of active fibrogenesis (arrows). D: Negative control of the section shown in C. APAAP; original magnification, X360 (A to C) and X250
(D).
resulted in reduction of the number of inflammatory cells, indicating that MCP-1 is likely to play a role in the pathogenesis of inflammation.19-21 Few studies have addressed the role of MCP-1 in the liver. We have shown that MCP-1 represents the most important chemotactic factor for monocytes secreted by cultured human stellate cells,22 which are responsible for extracellular matrix accumulation during chronic liver disease.23 Expression of MCP-1 by stellate cells is up-regulated by different stimuli, including cytokines, proteases such as thrombin, and oxidative stress.22'24'25 In vivo, MCP-1 mRNA has been found to be up-regulated in patients with chronic hepatitis and in experimental models of liver damage in the rat.22 26 However, the cell types involved in MCP-1 production during chronic liver disease have not been evaluated. The aim of this study was to analyze MCP-1 expression in tissue samples from patients with chronic liver disease with different grades of severity. We provide evidence for up-regulated expression of MCP-1 and identify the cell types responsible for its production. In addition, we show that MCP-1 directly correlates with the number of monocytes/macrophages
infiltrating the liver in a series of patients with chronic hepatitis.
Materials and Methods Human Tissues Normal human liver tissue (three subjects) was obtained from surgical liver biopsies obtained from patients undergoing uncomplicated cholecystectomy. Liver specimens from a total of 15 patients with chronic hepatitis were obtained by percutaneous needle biopsy. Liver tissue characterized by advanced cirrhosis associated with chronic active hepatitis (three patients) was obtained from organs explanted during orthotopic liver transplantation. Informed consent was obtained from all subjects. The etiology of liver disease was viral hepatitis (due to hepatitis B virus or hepatitis C virus infection) in all cases. All of the samples were frozen immediately after collection by dipping in liquid nitrogen and stored in liquid nitrogen until used. The study protocol conformed to the
MCP-1 in Chronic Liver Disease 425 AJP February 1998, Vol. 152, No. 2
Es :&
U
IL '.
.1.
-
I._
I
0
I
'.
*
.4:b,. ii.
Figure 2. In situ hybridization for MCP-1 mRNA in normal liver tissue and during chronic liver disease. Dark-field (A to C) and bright-field (D to F) photomicrographs of in situ hybridization for MCP-1 mRNA with a 35S-labeled RNA probe are shown. A and D: In normal liver, MCP-1 transcripts are present in correspondence to bile ducts (bd, arrows). B and E: In patients with chronic hepatitis, specific signal is detected within the enlarged portal tract (pt). C and F: In liver tissue from patients with cirrhosis and chronic active hepatitis, MCP-1 mRNA is present in the enlarged portal tract (PT) and around the regenerated nodules (n). G: Negative control, hybridized with a sense probe, of the section shown in C and F. Original magnification, X75 (A, B, D, and E) and X30 (C, F, and G).
ethical guidelines of the 1975 Declaration of Helsinki and approved by the University Human Research Review Committee.
was
Antibodies and Plasmids The rabbit antiserum raised against purified baboon MCP-1 has been described elsewhere.14 This antiserum is 100% cross-reactive with human MCP-1 and was used at a 1:200 dilution. Monoclonal antibodies against the monocyte/macrophage marker CD68 were purchased from Dako (Glostrup, Denmark). Anti-a-smooth muscle actin monoclonal antibodies (clone 1A4) were from Sigma Chemical Co. (St. Louis, MO). Polyclonal antibodies against factor Vil were from Dako. A 291-bp cDNA clone encoding for human MCP-1 (nucleotides 20 to 310 of the coding sequence) was obtained by reverse transcription polymerase chain reaction. Five micrograms of total RNA from cultured human hepatic stellate cells incubated for 4 hours with interferon-y were used as a template for cDNA transcription using AMV reverse transcriptase (Invitrogen, San Diego, CA). The cDNA was used as a template for 35 cycles of polymerase chain reaction (45 seconds at 94°C, 1 minute at 55°C, and 1 minute at 720C) together with specific primers (sense, 5'TTCTGTGCCTGCTGCTCATAGC3'; antisense, 5'GAGTGAGTGTTCAAGTCTTCGG3') The reaction mix was separated by agarose electrophoresis. A single band of the expected size was
obtained, cut from the gel, subcloned in pCRII (Invitrogen), and sequenced using the dideoxynucleotide method (U.S. Biochemical, Cleveland, OH). The sequence of the cloned fragment was identical to the published sequence of human MCP-1.27 For transcription of the antisense probe, the plasmid was linearized with BamHl and transcribed with T7 polymerase. For the sense probe, the plasmid was digested with Xbal and transcribed with SP6 polymerase.
Immunohistochemistty Frozen sections (6 mm thickness) were collected onto clean glass slides, dried overnight, and fixed in acetone and chloroform for 30 minutes. After brief air drying, the primary antibody was applied and kept for 30 minutes at room temperature in a humid chamber. After washing in Tris-buffered saline (TBS), sections were incubated with mouse monoclonal anti-rabbit antibodies (Dako) and then with affinity-purified rabbit anti-mouse antibodies (Dako) for 30 minutes at room temperature. At the end of the incubation, sections were washed twice in Tris-buffered saline and then incubated for 30 minutes with the alkaline phosphatase anti-alkaline phosphatase immune complex (APAAP; Dako) diluted 1:50 in Tris-buffered saline. The chromogenic reaction was developed for 30 minutes at room temperature with a mixture containing 100 mg/L new fuchsin (Merck, Darmstadt, Germany) 500 mg/L naphthol AS-BI phosphate (Sigma), 200 mg/L so-
426
Marra et al
AJP February 1998, Vol. 152, No. 2
I
~~~~~~J;r'&\
Figure 3. Bile duct epithelial cells express MCP-1, as shown by in situ hybridization for MCP-1 mRNA with a 35S-labeled RNA probe in a patient with cirrhosis and chronic active hepatitis. An enlarged portal tract with neoformed bile ducts is shown. A: Hybridization with the antisense probe shows specific signal in bile duct epithelial cells (arrows). B: Hybridization with the sense probe (negative control) demonstrates the low level of background. Original magnification, X360.
dium nitrite, 5.25 mg/L propandiol, and 50 mmol/L Tris/ HCI, pH 8.7. Control sections were treated with omission of the primary antibody or its substitution with nonimmune rabbit serum, showing no specific staining. When monoclonal antibodies were used as primary antibodies, incubation with monoclonal anti-rabbit antibodies was omitted.
In Situ Hybridization In situ hybridization was performed as described in detail elsewhere.28 Briefly, frozen sections (7 mm thick) were air dried and fixed in 4% paraformaldehyde/phosphate-buffered saline (PBS) for 20 minutes. After treatment with 0.2 N HCI for 20 minutes and washing in water for 5 minutes, the sections were digested with 0.125 mg/ml Pronase (Boehringer Mannheim, Mannheim, Germany), rinsed in 0.1 mol/L glycine/PBS, and fixed for 20 minutes in 4% paraformaldehyde/PBS. Slides were then washed in PBS for 5 minutes and acetylated for 10 minutes in acetic anhydride diluted 1:400 (v/v) in 0.1 mol/L triethanolamine, pH 8.0. After washing in PBS, slides were dehydrated in graded ethanols and air dried before hybridization. Antisense (complementary to mRNA) or sense (negative control) 35S-labeled RNA probes were obtained by
,.,
h-.f|
Figure 4. Activated stellate cells and monocyte/macrophages contribute to MCP-1 expression, as shown by a combination of in situ hybridization for MCP-1 mRNA and immunohistochemistry for specific cellular markers. A: Staining for a-smooth muscle actin, a marker of activated stellate cells. B: Staining for CD68, a marker of monocyte/macrophages. The arrows indicate cells where the message co-localizes with the specific marker. APAAP; original magnification, X900.
run-off transcription of plasmids containing the 291-bp fragment of the human MCP-1 cDNA. RNA transcription and labeling was carried out with a commercially available kit (Promega, Madison, WI) and 60 sCi of [35S]uridine-5'-(thio)-triphosphate (1250 Ci/mmol; New England Nuclear, Boston, MA). The specific activity routinely obtained was approximately 1.2 x 109 cpm/,Lg DNA. Slides were incubated with 25 gl of hybridization buffer containing 2 x 105 cpm of 35S-labeled RNA probe for 16 hours at 500C. Excess of probe was removed by washing for 4 hours at 500C in hybridization buffer. Sections were then digested for 30 minutes at 370C with 20 ,ug/ml RNAse A and washed for 30 minutes at 370C in 0.1 mol/L Tris/HCI, pH 7.5, 1 mmol/L EDTA, 0.5 mol/L NaCI. After additional washings in 2X standard saline citrate (SSC) and 0.1X SSC for 30 minutes each, the slides were dehydrated in graded ethanols and air dried. Autoradiography was performed by dipping the dehydrated slides into G5 nuclear emulsion (Ilford, Mobberley, UK) and, after 2 hours of drying, exposed in light-proof boxes at 40C for 1 to 4 weeks. The exposed slides were developed in Kodak D19 developer (Kodak, Hemel Hampstead, UK) for 2.5 minutes, rinsed in 1% acetic acid, and fixed in Kodak fixer for 3 minutes. After washing in tap water, the slides were counterstained in hematoxylin and eosin and mounted in Corbitt balsam. Sections from normal and
MCP-1 in Chronic Liver Disease
427
AJP February 1998, Vol. 152, No. 2
Table 1. Distribution of MCP-1 mRNA in Different Cell Types in Patients with Chronic Liver Disease
Biliary epithelial cells
Hepatocytes
Endothelial cells
macrophages
~~~~~~~~++
+++
_
Monocytes/
Activated stellate cells
+_
Hepatocytes and biliary epithelial cells were identified by their morphology. Activated stellate cells, monocytes/macrophages, and endothelial cells were identified by expression of a-smooth muscle actin, CD68, and factor VIII, respectively. The intensity of the in situ hybridization signal was graded as follows: -, background level; +, weak; ++, moderate; +++, intense.
pathological liver specimens were always processed in parallel, using the same batches of probes and reagents.
Combination of Immunohistology and in Situ Hybridization The co-distribution of MCP-1 mRNA transcripts and different cell types present in the liver was assessed by a combination of immunohistology and in situ hybridization, as previously described.25
Computerized Image Analysis The immunohistochemical signal for MCP-1 and CD68 was analyzed on serially stained sections with the aid of a computerized video image analysis system Leica Quantimet Q500MC (Leica Cambridge, Cambridge, UK). Thirteen liver biopsies from thirteen patients were observed under a light microscope equipped with a 25x lens. A total of 31 portal tracts were examined. The signal corresponding to the specific staining for MCP-1 and CD68, respectively, was acquired by a CCD video camera connected to the microscope. The signal was converted to digital and transformed into pixel units. The threshold of specific detection was automatically calibrated on control sections stained with nonimmune rabbit serum. Values corresponding to the percent area occupied by specific signal were measured on each section and analyzed by linear regression test.
Results We first analyzed MCP-1 protein and gene expression in control liver tissue and in specimens from patients with chronic liver disease (Figures 1 and 2). In normal liver tissue, the expression of MCP-1 was extremely modest. The hepatic lobule was almost devoid of signal for this cytokine, except for occasional scattered cells localized in sinusoidal position. In the portal tracts, specific MCP-1 signal was detected in correspondence to bile duct epithelial cells of both small and large ducts (Figure 1A). In agreement, analysis of MCP-1 mRNA expression by in situ hyridization revealed a clearly detectable signal of MCP-1 mRNA in bile duct epithelial cells (Figure 2A). Chronic hepatitis is characterized by a dense cellular infiltrate of portal tracts and hepatic lobules. Analysis of percutaneous liver biopsies from patients with chronic hepatitis by immunohistochemistry showed a marked increase in the expression of MCP-1 in the portal tract, in correspondence to the dense inflammatory infiltrate (Figure 1B). Interestingly, expression of the chemokine was more marked in areas of active fibrogenesis, such as in correspondence to the leading edges of active fibrous septa originating from the portal tract. Also in this case, the pattern of MCP-1 mRNA expression was very similar to that of immunohistology. In fact, in situ hybridization showed the presence of specific signal not only in correspondence to the bile ducts but also within cells of the inflammatory infiltrate localized in the portal
Table 2. Characteristics of the 13 Patients with Chronic Hepatitis C Virus-Related Hepatitis Used for the Correlation between MCP1 Expression and Monocyte/Macrophage Infiltration (see Figure 5).
Case 1 2 3 4 5 6 7 8 9 10 11 12 13
Age (years)
Sex
29 47 23 55 53 60 32 54 67 40 26 60 57
M M M M M M F M F F F F F
Etiology HCV HCV HCV HCV HCV HCV HCV HCV HCV HCV HCV HCV HCV
ALT
Histology
HAI grading
Staging
106 80 87 66 139 53 81 242 96 92 66 55 154
CAH CAH CAH CAH CAH CAH CAH CAH CPH CPH CPH CPH CPH
8 7 14 10 6 8 7 11 1 3 8 2 5
2 2 3 2 1 2 2 3 0 1 2 1 0
Patient 4 had been treated with recombinant interferon-a for 6 months before liver biopsy. The score for grading and staging was calculated according to Ishak et al.42 CAH, chronic active hepatitis; CPH, chronic persistent hepatitis; HCV, hepatitis C virus.
428
Marra et al
AJP February 1998, Vol. 152, No. 2
tract (Figure 2B). Cirrhosis represents a condition of end-stage liver disease, where inflammatory infiltration may show different degrees of expression. In all cases tested, the presence of cirrhosis was associated with an intense inflammatory infiltrate, and the levels of MCP-1 expression were extremely high (Figures 1C and 2C). Expression of MCP-1 was very marked in the fibrous septa, especially at the septum/nodule interface, an area where intense tissue remodeling and active fibrogenesis occur. The described patterns of MCP-1 expression for a given degree of necroinflammatory activity were consistently present in the specimens analyzed. We next identified the cell types involved in MCP-1 secretion within the liver. The expression of MCP-1 by bile duct epithelial cells was clearly evident analyzing the morphology of the structures expressing MCP-1 in normal liver and in patients with liver cirrhosis (Figure 3). Hepatocytes were consistently negative, either in normal liver or in patients with chronic liver disease. The role of nonparenchymal liver cells was established by using a combination of in situ hybridization and immunohistochemistry for cell-specific markers in liver tissue from patients with active cirrhosis, where maximal MCP-1 expression is observed. MCP-1 mRNA was clearly co-distributed with cells expressing a-smooth muscle actin, a marker of stellate cells in their activated state (Figure 4A). However, not all stellate cells were found to express MCP-1, possibly in relation to their different degree of activation and/or differentiation. Similarly, only some of the cells expressing CD68, a monocyte/macrophage marker, were positive for MCP-1 transcripts (Figure 3B), whereas cells expressing factor VIII, an endothelial cell marker, were negative (data not shown). Taken together, these data indicate that different cell populations contribute to MCP-1 expression within the liver (Table 1). MCP-1 exerts important biological effects that may be recapitulated by its chemotactic and activating action on inflammatory cells. To establish a possible relationship between MCP-1 expression and the inflammatory infiltrate, a series of 13 patients with chronic hepatitis were studied. The clinical and pathological features of the patients studied are summarized in Table 2. Serial sections from percutaneous liver biopsies were analyzed by immunohistochemistry for MCP-1 expression and for the monocyte/macrophage marker CD68, as a target of the action of MCP-1. Computerized image analysis was used to obtain a measurement of the two parameters, which were then analyzed for linear correlation. As shown in Figure 5, the signal for CD68 was directly and significantly correlated with that of MCP-1. The same results were obtained when measurements from each portal tract were individually considered, regardless of the patient. Moreover, comparable findings were obtained when the number of CD68-expressing cells was counted and plotted against the number of cells expressing MCP-1 (data not shown). Thus, monocyte infiltration is directly correlated to MCP-1 expression in patients with chronic hepatitis.
CD68+ cells (% of total area)
0
5
20 15 MCP-1 expression (% of toal area) 10
25
Figure 5. Linear correlation between MCP-1 expression and monocyte/macrophage infiltration. MCP-1 expression and CD68+ cells were measured by computerized image analysis as the percent area occupied by specific staining within the portal tract. Data are from liver biopsies performed in 13 patients with chronic viral hepatitis (see Table 2).
Discussion Accumulating evidence indicates MCP-1 as a major chemotactic factor for monocytes and lymphocytes. In this study we report that MCP-1 protein and gene expression is up-regulated in patients with chronic liver disease with different degrees of liver damage and fibrosis. These results confirm and expand our earlier observation of increased mRNA levels for MCP-1 in patients with chronic hepatitis.22 MCP-1 was found to be expressed at high levels in those areas where the necroinflammatory and reparative processes are more intense. Accordingly, in patients with chronic hepatitis, the signal was observed in all areas characterized by evident inflammation, including portal tracts and intralobular infiltrates. In patients with cirrhosis, MCP-1 expression was consistently localized in areas of active inflammation and extracellular matrix deposition, such as at the interface between active septa and the cirrhotic nodule. MCP-1 production has been reported to be relevant in several conditions characterized by infiltration of inflammatory cells, such as renal damage,18-20'29 atherosclerosis,16 cardiac ischemia-reperfusion,30 arthritis,31 and lung or brain damage.17,2132 Moreover, this chemokine is expressed at high levels in tumors showing a dense monocytic infiltrate,3334 which could influence tumor growth.35 Data from the present study provide additional evidence for the role of MCP-1 as a major chemoattractant for mononuclear cells, confirming that MCP-1 expression should be regarded as a ubiquitous response to tissue injury. Studies conducted in vitro have shown that hepatic stellate cells produce MCP-1.22,24,25 Stellate cells were also found to be responsible for the great majority of MCP-1 gene expression when different cell populations were separated in the rat after experimental liver injury.26 However, no data are so far available concerning the cells responsible for MCP-1 expression in the liver of
MCP-1 in Chronic Liver Disease
429
AJP February 1998, Vol. 152, No. 2
patients with chronic disease. We used techniques capable of evaluating the cells responsible for synthesis of this chemokine in the context of the intact liver tissue, ie, immunohistochemistry, in situ hybridization, and a combination of the two techniques. The results of this study indicate that different cell populations contribute to MCP-1 production in the inflamed liver. Activated stellate cells expressing MCP-1 were observed within the active fibrous septa originating from the infiltrated portal tract and around regenerating nodules in patients with active cirrhosis. These data confirm that MCP-1 expression occurs in areas of active fibrogenesis and supports the hypothesis that inflammation and fibrogenesis during chronic hepatitis are two strictly connected processes. The general biological relevance of these findings is supported by studies in other systems such as the kidney. In an experimental model of glomerular injury, neutralization of MCP-1 led to a decrease in collagen deposition, suggesting the involvement of this chemokine in irreversible tissue damage.20 Previous studies have indicated that hepatic stellate cells produce soluble mediators, including chemokines, which influence recruiting and activation of leukocytes,36-39 and this study provides additional evidence for a critical role played by hepatic stellate cells as modulators of leukocyte trafficking in the liver. Data from in situ hybridization indicate that elements other than stellate cells participate in the production of MCP-1 in the liver, including cells expressing CD68, an antigen specific for monocyte/macrophages. Based on these findings, it is tempting to speculate that monocytes infiltrating the injured liver may recruit other inflammatory cells by secreting MCP-1, thus contributing to the maintenance of the inflammatory infiltrate. An intriguing finding from our study is the identification of bile duct epithelial cells as MCP-1-secreting elements in the liver. The role of these cells as chemokine producer is supported by preliminary data showing regulated secretion of MCP-1 and IL-8 by cultured human bile duct epithelial cells.40 Surprisingly, expression of MCP-1 by bile duct epithelial cells was observed also in the normal liver, where it was not associated with any detectable infiltrate, indicating either that the protein is not secreted or that MCP-1 levels in this condition are insufficient to recruit inflammatory cells. However, it is more likely that MCP-1 produced by bile duct epithelial cells is secreted into the bile and therefore does not exert biological actions within the lobule, at least in the normal liver. MCP-1 is one of several molecules potentially able to recruit inflammatory cells in vivo. The finding of increased levels in patients with chronic liver disease prompted us to evaluate the possible role of this cytokine as a mediator of inflammatory cell infiltration in the liver. We observed a positive linear correlation between MCP-1 expression and the number of monocytes/macrophages in the portal tracts, as shown by computerized image analysis. Although these data do not conclusively prove the existence of a causal relationship, they argue for a role of MCP-1 in the recruitment of lymphocytes and monocytes during chronic hepatitis, possibly in concert with other factors. As all patients investigated in the present study had liver damage of viral origin, additional studies are
required to establish whether these findings are generalizable to other forms of chronic liver disease, such as ethanol abuse or chronic cholestasis. In response to an acute damage, the recruitment of inflammatory cells is probably necessary for a physiological wound healing, whereas during chronic injury, soluble factors produced by inflammatory cells are likely to be involved in the progression of the disease. Molecular cloning of different chemokine receptors, including the MCP-1 receptor,41 provides the possibility for the development of selective antagonists. Future studies are needed to establish whether modulating the biological actions of this and other chemokines may be an effective strategy for the management of patients with chronic liver disease.
Acknowledgments We are indebted to Dr. Anthony J. Valente for generously providing the anti-MCP-1 antibody used in this study. The excellent technical assistance of Wanda Delogu is gratefully acknowledged.
References 1. Perrillo RP: Chronic hepatitis. Diseases of the Liver and the Biliary Tract. Edited by Gitnick G, LaBrecque DR, Moody FG. St. Louis, Mosby-Year Book, 1992, pp 299-310 2. Paronetto F: The role of reticuloendothelial system in viral hepatitis. The Reticuloendothelial System. Edited by Escobar MR, Utz JP. New York, Plenum, 1988, 249-268 3. Bernuau D, Rogier E, Feldmann G: A quantitative ultrastructural analysis of the leukocytes in contact with hepatocytes in chronic active hepatitis, with a cytochemical detection of mononuclear phagocytes. Am J Pathol 1982, 109:310-320 4. Ben-Baruch A, Michiel DF, Oppenheim JJ: Signals and receptors involved in recruitment of inflammatory cells. J Biol Chem 1995, 270:11703-11706 5. Strieter RM, Standiford TJ, Huffnagle GB, Colletti LM, Lukacs NW, Kunkel SL: "The good, the bad, and the ugly": the role of chemokines in models of human disease. J Immunol 1996, 156:3583-3586 6. Kelner GS, Kennedy, J, Bacon KB, Kleyensteuber S, Largaespada DA, Jenkins NA, Copeland NG, Bazan JF, Moore KW, Schall TJ, Zlotnik A: Lymphotactin: a cytokine that represents a new class of chemokine. Science 1994, 266:1395-1399 7. Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, Greaves DR, Zlotnik A, Schall TJ: A new class of membrane-bound chemokine with a CX3C motif. Nature 1997, 385:640-644 8. Valente AJ, Graves DT, Vialle-Valentin CE, Delgado R, Schwartz CJ: Purification of a monocyte chemotactic factor secreted by nonhuman primate vascular cells in culture. Biochemistry 1988, 27:4162-4168 9. Loetscher P, Seitz M, Clark-Lewis I, Baggiolini M, Moser B: Monocyte chemotactic proteins MCP-1, MCP-2, and MCP-3 are major attractants for human CD4+ and CD8+ T lymphocytes. FASEB J 1994, 8:1055-1060 10. Carr MW, Roth SJ, Luther E, Rose SS, Springer TA: Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proc Natl Acad Sci USA 1994, 91:3652-3656 11. Taub DD, Proost P, Murphy WJ, Anver M, Longo DL, VanDamme J, Oppenheim JJ: Monocyte chemotactic protein-1 (MCP-1), -2, and -3 are chemotactic for human T lymphocytes. J Clin Invest 1995, 95: 1370-1376 12. Rollins BJ, Yoshimura T, Leonard EJ, Pober JS: Cytokine-activated human endothelial cells synthesize and secrete a monocyte chemoattractant, MCP-1/JE. Am J Pathol 1990, 136:1229-1233 13. Standiford TJ, Kunkel SL, Phan SH, Rollins BJ, Strieter RM: Alveolar macrophage-derived cytokines induce monocyte chemoattractant
430
Marra et al
AJP February 1998, Vol. 152, No. 2
14. 15.
16.
17.
18.
19.
20.
21. 22.
23. 24.
25.
26. 27.
28.
protein-1 expression from human pulmonary type 11-like epithelial cells. J Biol Chem 1991, 266:9912-9918 Graves, DT, Jiang YL, Williamson MJ, Valente AJ: Identification of monocyte chemotactic activity produced by malignant cells. Science 1989, 245:1490-1493 Larsen CG, Zachariae COC, Oppenheim JJ, Matsushima K: Production of monocyte chemotactic and activating factor (MCAF) by human dermal fibroblasts in response to interleukin 1 or tumor necrosis factor. Biochem Biophys Res Commun 1989, 160:1403-1408 Yla-Herttuala S, Lipton BA, Rosenfeld BE, Sarkioia T, Yoshimura T, Leonard EJ, Witzum JL, Steinberg D: Expression of monocyte chemoattractant protein 1 in macrophage-rich areas of human and rabbit atherosclerotic lesions. Proc Natl Acad Sci USA 1991, 88:5252-5256 Antoniades HN, Neville-Golden J, Galanopoulos T, Kradin RL, Valente AJ, Graves DT: Expression of monocyte chemoattractant protein 1 mRNA in human idiopathic pulmonary fibrosis. Proc Natl Acad Sci USA 1992, 89:5371-5375 Grandaliano G, Gesualdo L, Ranieri E, Monno R, Montinaro V, Marra F, Schena FP: Monocyte chemotactic peptide-1 expression in acute and chronic human nephritides: a pathogenetic role in interstitial monocyte recruitment. J Am Soc Nephrol 1996, 7:906-913 Wenzel U, Schneider A, Valente AJ, Abboud HE, Thaiss F, Helmchen UM, Stahl RA: Monocyte chemoattractant protein-1 mediates monocyte/macrophage influx in anti-thymocyte antibody-induced glomerulonephritis. Kidney Int 1997, 51:770-776 Lloyd, CM, Minto AW, Dorf ME, Proudfoot A, Wells TNC, Salant DJ, Gutierrez-Ramos J-C: RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis. J Exp Med 1997, 185:1371-1380 Flory CM, Jones ML, Warren JS: Pulmonary granuloma formation in the rat is partially dependent on monocyte chemoattractant protein 1. Lab Invest 1993, 69:396-404 Marra F, Valente AJ, Pinzani M, Abboud HE: Cultured human liver fat-storing cells secrete monocyte chemotactic protein-1: regulation by proinflammatory cytokines. J Clin Invest 1993, 92:1674-1680 Pinzani M: Hepatic stellate cells: expanding roles for a liver-specific pericyte. J Hepatol 1995, 22:700-706 Marra F, Valente AJ, Grandaliano G, Abboud HE: Thrombin stimulates proliferation of liver fat-storing cells and expression of monocyte chemotactic protein-1: potential role in liver injury. Hepatology 1995, 22:780-787 Xu Y, Rojkind M, Czaja MJ: Regulation of monocyte chemoattractant protein 1 by cytokines and oxygen free radicals in rat hepatic fatstoring cells. Gastroenterology 1996, 110:1870-1877 Czaja MJ, Geerts A, Xu J, Schmiedeberg P, Ju Y: Monocyte chemoattractant protein 1 (MCP-1) expression occurs in toxic rat liver injury and human liver disease. J Leukocyte Biol 1994, 55:120-126 Yoshimura T, Yuhki N, Moore SK, Appella E, Lerman Ml, Leonard EJ: Human monocyte chemoattractant protein-1 (MCP-1): full-length cDNA cloning, expression in mitogen-stimulated blood mononuclear leukocytes, and sequence similarity to mouse competence gene JE. FEBS Lett 1989, 244:487-493 Milani S, Grappone C, Pellegrini G, Schuppan D, Herbst H, Calabro
29.
30.
31. 32.
33. 34.
35. 36.
37. 38. 39. 40.
41.
42.
A, Casini A, Pinzani M, Surrenti C: Undulin RNA and protein expression in normal and fibrotic human liver. Hepatology 1994, 20:908-916 Wada K, Yokohama H, Furuichi K, Kobayashi K-I, Harada K, Naruto M, Su S-B, Akiyama M, Mukaida N, Matsushima K: Intervention of crescentic glomerulonephritis by antibodies to monocyte chemotactic and activating factor (MCAF/MCP-1). FASEB J 1996, 10:14181425 Kumar AG, Ballantyne CM, Michael LH, Kukielka GL, Youker KA, Lindsey ML, Hawkins HK, Birdsall HH, McKay CR, LaRosa GJ, Rossen RD, Smith CW, Entman ML: Induction of moncyte chemoattractant protein-1 in the small veins of ischemic and reperfused canine myocardium. Circulation 1997, 95:693-700 Gong JH, Ratkay LG, Waterfield JD, Clark-Lewis I: An antagonist of monocyte chemoattractant protein-1 (MCP-1) inhibits arthritis in the MRL-lpr mouse model. J Exp Med 1997, 186:131-137 Berman JW, Guida MP, Warren J, Amat J, Brosnan CF: Localization of monocyte chemoattractant peptide-1 expression in the central nervous system in experimental autoimmune encephalomyelitis and trauma in the rat. J Immunol 1996, 156:3017-3023 Graves DT, Barnhill R, Galanopoulos T, Antoniades HN: Expression of monocyte chemotactic protein-1 in human melanoma in vivo. Am J Pathol 1992, 140:9-14 Negus RPM, Stamp GWH, Relf MG, Burke F, Malik STA, Bernasconi S, Allavena P, Sozzani S, Mantovani A, Balkwill FR: The detection and localization of monocyte chemoattractant protein-1 in human ovarian cancer. J Clin Invest 1995, 95:2391-2396 Zhang L, Khayat A, Cheng H, Graves DT: The pattern of monocyte recruitment in tumors is modulated by MCP-1 expression and influences the rate of tumor growth. Lab Invest 1997, 76:579-590 Pinzani M, Abboud HE, Gesualdo L, Abboud SL: Regulation of macrophage colony-stimulating factor in liver fat-storing cells by peptide growth factors. Am J Physiol 1992, 262:C876-C881 Pinzani M, Carloni V, Marra F, Riccardi D, Laffi G, Gentilini P: Biosynthesis of platelet-derived growth factor and its 10-acyl analogue by liver fat-storing cells. Gastroenterology 1994, 106:1301-1311 Tsukamoto H, Wang SC, Lin M, Ohata M, Pham TV: NF-KB activation and chemokine expression by hepatic stellate cells in cholestatic liver injury. Hepatology 1996, 24:331A Maher JJ, Scott MK: Rat hepatic stellate cells produce cytokineinduced neutrophil chemoattractant (CINC) in primary culture and in liver injury in vivo. Hepatology 1996, 24:353A Morland CM, Fear J, Joplin R, Adams DH: Human biliary epithelial cells express chemokines interleukin-8 and monocyte chemotactic protein-1 in response to inflammatory cytokine stimulation. Hepatology 1996, 24:332A Charo IF, Myers SJ, Herman A, Franci C, Connolly AJ, Coughlin SR: Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxy-terminal tails. Proc NatI Acad Sci USA 1994, 91:2752-2756 Ishak K, Baptista A, Bianchi L, Callea F, De Groote J, Gudak F, Denk H, Desmet V, Korb G, MacSween RN, Phillips MJ, Portman BG, Poulsen E, Scheuer P, Schmid M, Thaler H: Histological grading and staging of chronic hepatitis. J Hepatol 1995, 22:696-699
