were performed as described by Pheiffer and Zimmerman. (21). Restriction .... G-A C'G-T TAA C'C-C G A-T G C-T C A.T A T-A G C-T T G-GITG*A T C.AIA T-C 31. Xba. I. FIG. 2. ..... We thank William Vollmar for performing the ,B-galactosidase.
JOURNAL OF BACTERIOLOGY, Oct. 1984, p. 1-8 0021-9193/84/100001-08$02.00/0 Copyright © 1984, American Society for Microbiology
Vol. 160, No. 1
Chloramphenicol-Inducible Gene Expression in Bacillus subtilis Is Independent of the Chloramphenicol Acetyltransferase Structural Gene and Its Promoter SKORN MONGKOLSUK, NICHOLAS P. AMBULOS, JR., AND PAUL S. LOVETT* Department of Biological Sciences, University of Maryland Baltimore County, Catonsville, Maryland 21228 Received 16 April 1984/Accepted 23 July 1984
cat-86 specifies chloramphenicol acetyltransferase and is the indicator gene on the Bacillus subtilis promoter cloning plasmid pPL703. Insertion of promoters from various sources into pPL703 at a site ca. 144 base pairs upstream from cat-86 activates expression of cat-86, and the expression is characteristically inducible by chloramphenicol. Thus, chloramphenicol inducibility of cat-86 is independent of the promoter that is used to activate the gene. To determine whether cat-86 or its products were involved in chloramphenicol inducibility, gene replacement studies were performed. cat-86 consists of 220 codons. The lacZ gene from Escherichia coli was inserted into a promoter-containing derivative of pPL703, plasmid pPL603E, at two locations within cat86. pPL31ac2 contains lacZ inserted in frame after codon 2 of cat-86. pPL31ac3O contains lacZ inserted in frame after codon 30 of cat-86. In both constructions, all cat coding sequences 3' to the site of the lacZ insertion were deleted. Both plasmids exhibited chloramphenicol inducibility of ,I-galactosidase in B. subtilis. These studies provide the first direct demonstration that the transcription and translation products of a chloramphenicolinducible cat gene are uninvolved in chloramphenicol inducibility of gene expression. The results localize the region essential to inducibility to the 144-base pair segment that intervenes between the site of promoter insertion and the cat-86 gene. cat genes specify chloramphenicol (Cm) acetyltransferase, an enzyme that catalyzes the acetylation of Cm to forms that are inactive as antibiotics (25, 27). Such genes naturally occur in a wide range of gram-negative and gram-positive bacteria and render host cells insensitive to Cm. Among gram-positive bacteria, two major groups have been shown to harbor cat genes whose expression is inducible by Cm. Staphylococcus aureus isolates that are Cmr typically harbor cat genes on small, multicopy plasmids (27). Certain of these plasmids, such as pC194 and pC221, also replicate in Bacillus subtilis, and the Cm-inducible characteristic of these plasmid cat genes has been demonstrated in both hosts (9, 13, 27, 32, 33). Strains of Bacillus pumilus also harbor Cminducible cat genes, and several of these genes have been cloned into B. subtilis, where each retained the Cm-inducible characteristic (8, 30). The cat genes from S. aureus and B. pumilus are not identical. Nucleotide sequencing of the pC194 cat and cat-86 from B. pumilus demonstrates that the respective genes encode proteins of 216 and 220 amino acids and have GC contents of 30.5 and 35% (12, 13). Moreover, cat-86 shows no detectable homology with pC194 by the Southern hybridization method (7). Cm inducibility of cat-86 in the promoter-cloning plasmid pPL703 is independent of the promoter that is used to activate expression of the gene. The minimum portion of the cloned B. pumilus DNA previously found to be essential to Cm inducibility was a 234-base pair (bp) segment that includes 144 bp immediately upstream of cat-86 and the first 29 codons of cat-86 (7). Inspection of the nucleotide sequence within this region has shown that the cat-86 ribosome binding site sequence in DNA, 5'AGGAGG, is part of a 14bp sequence that is repeated in the inverted form 12 bp upstream. This sequence organization in DNA predicts that the corresponding RNA will contain a stable stem loop that *
sequesters the cat ribosome binding site in the stem. The ribosome binding site sequence of the Cm-inducible pC194 cat gene is also within an inverted repeat sequence, and each of two variants of the pC194 cat gene that are constitutively expressed in B. subtilis are deleted for all or a functional portion of the inverted repeats (1). We suggested, therefore, that the inverted repeat sequences spanning the ribosome binding site sequences for cat-86 and the pC194 cat play a key role in Cm-inducible regulation of gene expression. Since the corresponding stem loops may block the availability of the ribosome binding sites in RNA to pair with 16S rRNA, we suggested that Cm inducibility could represent a posttranscriptional control system (7). It has been suggested (4, 7) that Cm induction could result from the interaction of Cm-modified ribosomes with RNA sequences upstream from cat. Such interactions may destabilize the stem loop that sequesters the cat ribosome binding site; or, possibly, the ribosomal interactions with mRNA prevent formation of the stem loop concomitant with transcription. However, since Cm inducibility is consistently associated with cat genes from gram-positive bacteria, it is essential to test completely the role of cat in its own regulation. In the present study, we demonstrate that Cminducible gene expression exists independent of the presence of the cat-86 coding region. MATERIALS AND METHODS Bacteria and plasmids. B. subtilis BGSC 1A422 (recE4 leuB6) was used throughout and was obtained from the Bacillus Genetic Stock Center, Ohio State University, Columbus. Media and growth conditions were as previously reported (8, 31). The basic plasmid used in these studies was the promoter-cloning vector pPL703 (Fig. 1; 7, 18). This plasmid is a 5-kilobase (kb) (approximately) derivative of pUB110 containing a 1.1-kb PstI-BglII B. pumilus DNA fragment as a replacement for the short EcoRI-BamHI
Corresponding author. 1
2
MONGKOLSUK, AMBULOS, AND LOVETT
J. BACTERIOL.
Bcl
EcoRI Pst Hpa 1>
Hind
Xba
III
Xba
Bgl II/BamHI
r
pPL603/pPL603E
-
cat-86
-144J-
203
P1/P2
~~~~~~~~~EcoRi - '
380
-203
229
236 RI EcoRI R
HaI Ps Pstl
pPLJ03
BclI
HidII
HindXil
Xbal Bgll
/BamHl
ca-8
BamHl Sal
FIG. 1. Restriction Plasmids
are
maps
of pPL603, pPL603E, and pPL703.
presented in linear form, opened
at
their unique EcoRI
sites. pPL603 and pPL603E are identical, with the exception that the 203-bp EcoRI-PstI fragments in the two plasmids differ. In pPL603, the fragment is designated P1, and this restriction fragment contains that activates cat-86 expression only during sporulation. In pPL603E, the fragment is designated P2, and this fragment transcriptionally activates cat-86 during vegetative growth and sporulation. The Rl fragment contains sequences essential to Cm inducibility of cat-86, but Rl lacks promoter activity in B. subtilis (8). pPL703 is a derivative of pPL603 in which the 203-bp P1 fragment was replaced with a 21-bp multicloning site linker from M13mp7 (16, 18). In pPL703, cat-86 is unexpressed during both vegetative growth and sporulation because the gene lacks a promoter. Insertion of promoters into the unique EcoRI, BamHI, SalI, or PstI sites of pPL703 activates cat-86 expression. The dashed line represents the pUB110 portion of each plasmid. a promoter
portion of pUB110 (14). The junction between the PstI end of the inserted B. pumilus DNA and the EcoRI end of the pUB110 vector consists of a 21-bp EcoRI-PstI synthetic oligonucleotide from M13mp7 (16). The linker contains internal BamHI- and Sall-sensitive sites. The pUB110 portion of pPL703 contains a relication origin and a neomycin resistance determinant. The B. pumilus DNA in pPL703 contains the cat-86 gene specifying Cm acetyltransferase which is unexpressed in B. subtilis because the gene lacks a promoter. Promoter-containing restriction fragments inserted into the unique EcoRI, BamHI, SalI, or PstI sites of pPL703 activate expression of cat-86, which in turn renders host cells resistant to Cm. pPL603 (30) is the immediate plasmid parent to pPL703 and contains a 203-bp EcoRI-PstI B. pumilus DNA fragment (P1 fragment) in place of the 21-bp synthetic linker (Fig. 1; 8). P1 lacks a promoter that functions in vegetative B. subtilis, but P1 does contain a promoter that activates cat-86 at a late stage of sporulation (19). pPL603E is identical to pPL603 with the exception that the 203-bp EcoRI-PstI P1 fragment has been replaced with a 203bp EcoRI-PstI fragment designated P2 (Fig. 1; 8). P2 contains a vegetative promoter, hence pPL603E specifies Cmr in B. subtilis (8). Plasmid manipulations. Plasmids
were transformed into B. subtilis cells made competent by the method of Bott and Wilson (2). Methods for restriction enzyme digestion, agarose gel electrophoresis, and ligation were as previously described (8), with the exception that blunt-end ligations were performed as described by Pheiffer and Zimmerman (21). Restriction enzymes, T4 ligase, and the Klenow fragment of DNA polymerase I were purchased from Bethesda Research Laboratories. Construction and characterization of in-frame fusions between cat-86 and lacZ. The lacZ gene was inserted into pPL603E (Fig. 1) at two sites, pP131ac3O contains lacZ fused to codon 30 of cat-86, and pPL31ac2 contains lacZ fused to
codon 2 of cat-86 (see Fig. 2 and 3). In both constructions, all cat-86 sequences 3' to the site of lacZ insertion have been deleted. The source of lacZ for both constructions was pMC1871, which is pBR322 harboring a 3.1-kb, lacZ-containing PstI fragment oriented in pBR322 such that the amino terminus of lacZ is distal to the unique HindIll site in pMC1871 (24). This HindIll site is within the promoter for the Tetr gene on the pBR322 portion of pMC1871. SmaI digestion of pMC1871 cuts lacZ between two amino-terminal codons (numbers 5 and 6). Subsequent digestion with HindIll released a fragment of ca. 3.5 kb that was then inserted between the BclI and HindIII sites of pPL603E. The BciI site had been previously gap-filled, and therefore bluntend ligation places the cat-86 reading frame 5' to BclI in register with the lacZ reading frame 3' to SmaI (Fig. 2). This intermediate construction contains a unique Sall site 3' to the translation termination codons for lacZ (Fig. 3). Cleavage with SalI and XbaI, followed by gap filling and blunt-end ligation, generated pPL31ac3O. The BclI-SmaI junction was sequenced to confirm the reading frame. pPL31ac2 was constructed by first joining the 150-bp PstIAhallI fragment from pPL603E to the SmaI-PstI lacZ fragment by blunt-end ligation. AhaIll cuts between codons 2 and 3 of cat-86 (Fig. 2), and therefore joining AhalIl to SmaI places cat and lac in frame. The resulting PstI fragment (-3.2 kb) was inserted into the unique PstI site of pPL603E (Fig. 3). This intermediate plasmid was then cleaved with Sall and XbaI, gap filled, and blunt end ligated (Fig. 3). Thus, the only cat-86 coding sequences in pPL31ac2 were the first two codons of the gene. The AhaIII-SmaI junction region was sequenced to confirm the reading frame. All sequencing was performed by the M13 modification of the Sanger method (16, 22). In the construction of pPL3Iac3O and pPL31ac2, the method used to delete cat-86 coding sequences 3' to the lacZ insertion involved cleavage with XbaI and Sall followed by gap filling and blunt-end ligation. This procedure generated a Sall-sensitive site at the location of the blunt-end ligation. This site is designated SalI-XbaI in Fig. 3 and 6. pPL31ac3O and pPL31ac2 were not observed to undergo any detectable rearrangements during the course of this study. Both plasmids were, however, slowly lost from strain 1A422 in the absence of continued selection for neomycin resistance. This is in contrast to pPL603E or pPL703, which are stably maintained in the absence of selection for the plasmids. Enzyme assays. Cm acetyltransferase was assayed by the colorimetric method of Shaw (26), and total protein was determined by the Bradford procedure (3). ,-Galactosidase was measured as described by Miller (17). Electrophoresis of 0I-galactosidase from B. subtilis and Escherichia coli through cellulose acetate gels. B. subtilis 1A422 harboring pPL3iac3O or pPL31ac2 was grown in Penassay broth (Difco Laboratories) containing 10 ,ug of neomycin sulfate per ml to mid-log phase. These cells were used to inoculate 20 ml of fresh broth containing neomycin sulfate, and, when appropriate, 0.1 ,ug of Cm per ml, a subinhibitory concentration. The cultures were grown to ca. 90 Klett units (late exponential growth), and the cells were harvested, washed, and suspended in 0.01 M Tris-hydrochloride (pH 7.0). The cells were lysed by the addition of 100 ,ug of lysozyme per ml for 30 min at 37°C. Protein concentration was determined by the Bradford method (3). Protein (18 ± 3 ,ug) from each lysate was applied as an individual spot on a Titan III cellulose acetate plate (Helena Laboratories). Purified ,-galactosidase, purchased from Sigma Chemical Co., was applied but at a concentration of less than 0.1 ,ug/ml
CHLORAMPHENICOL INDUCIBILITY
VOL. 160, 1984
o
ga
'"co!I
,BcI
II
,Hind
I
Eco RI
III
Xba
IXba I
I
3
I
\
PstI
10
20
40
30
510 TGCCA'GGCTTT TAACGT AG G CAA AGCTCAGGGT AGA CTTTG 50
70
60
80
AATGGACAGAAACATGACATATCTCTT:GAAAGGA'STGATTG ~~~~~~~~~~~~~~~~~~~~~~~~~~ ~
_~~~~
90
100
-
120
10
TGGTGGTGAAAACAGATAAAATCTCCTCCTGAATACAGTA 130
-~~~Aba
1 40
III
AATCACATTC|AGGAGGIAGATAAAATTfTTA-CAA 170
180
160
-ATA-G 200
190
AC-GAA-AATTAT*CTG*CGA AAA-GAG-CAC-TTTTCAC.CAT.TAT.AT Hpa I 210 220 G-A C'G-T TAA C'C-C G A-T G C-T C A.T A T-A G C-T T
BcIl G-GITG*A T C.AIA T-C 31 238
Xba
I
FIG. 2. Nucleotide sequence of the region in pPL703 extending from the PstI site to the BclI site. The presumed translation initiation codon TTG for cat-86 and the ribosome binding site, AGGAGG, are boxed. Horizontal arrows show the 14-bp inverted-repeat sequences. Underlined triplets are the 12 translation termination codons between PstI and the structural gene. The sequence GAAAGGA, positions 68 to 74, is shown by a dashed box. This sequence has a calculated AG of binding to 16S rRNA of -14 kcal (58.62 kJ)/mol. Restriction sites for PstI, AhaIII, HpaI, and BcIl are shown. This nucleotide sequence has been previously reported (7).
either before or after being mixed with a cell-free extract of 1A422. Electrophoresis was at 200 V for 25 min in Trisglycine buffer at pH 7.0. After electrophoresis, the gels were stained for 3-galactosidase activity by using 200 ,ug of 5bromo 4 chloro 3 indolyl - D -galactoside (X-gal). This method is a slight modification of a procedure previously described by Eicher and Washburn (10). RESULTS Cm inducibility of cat-86 is independent of the promoter that is used to transcriptionally activate the gene. Plasmid pPL603 is a promoter-cloning vector for B. subtilis (Fig. 1). Insertion of various promoter-containing restriction fragments into the unique EcoRI site of pPL603 activates expression of the downstream cat-86 gene, and the expression is characteristically Cm inducible (31). However, pPL603 contains an endogenous promoter that activates expression of cat-86 at a late stage of sporulation in B. subtilis (19). This sporulation promoter is within a 203-bp EcoRI-PstI fragment, designated the P1 fragment, which is located 144 bp upstream from cat-86 (18). Replacement of P1 with a 21-bp multicloning site linker from M13mp7 generated pPL703 (Fig. 1). Expression of cat-86 in pPL703 is Cm inducible when the gene is transcriptionally activated by insertion of a 284-bp, promoter-containing EcoRI fragment from phage SPO2 (8, 23). To determine whether Cm inducibility of cat-86 in pPL703 was completely independent of the promoter used to activate the gene, we cloned different -
-
-
-
-
promoter-containing fragments into pPL703 within the synthetic linker. In each case, expression of cat-86 was Cm inducible (Table 1). In the promoter-containing derivative of pPL703, designated pPL603E, the site of initiation of cat-86 transcripts has been located within the 203-bp, promotercontaining fragment designated P2 (8). Thus, we feel that each inserted promoter fragment probably also contains the site of transcription initiation. These data indicate that Cm inducibility is independent of the promoter and that cat-86 transcripts are probably initiated more than 144 bp upstream from the cat gene. Expression of lacZ fused to cat-86 at codon 30 and codon 2 is Cm inducible. To determine whether the product of the cat86 gene played a role in its own regulation, we previously inserted a restriction fragment containing the mouse dihydrofolate reductase gene into cat-86 at a BclI site in codon 29 (7). Expression of the inserted heterologous gene in this construction, pPL708-TR2, was dependent on the inserted promoter and was Cm inducible. Moreover, inducibility was retained after removal of all B. pumilus DNA 3' to codon 29 of cat-86 (8). Since the restriction fragment harboring the mouse dihydrofolate gene contains a series of translation termination codons preceding the coding region, it is likely that the first 13% (approximately) of the cat-86 product was synthesized in B. subtilis as a truncated peptide. The first 13% of the cat-86 protein product and the first 13% of the pC194 cat product, as deduced from the nucleotide sequences of the two genes, show regions of amino acid
4
MONGKOLSUK, AMBULOS, AND LOVETT
J. BACTERIOL.
Aha III
EcoRl
Hind ill Xba I 11 //
Pst I-Aha III of + Sma I - Pst I pPL603E (150 bp) locZ
Neor Blunt end liqation
Insert at Pst I Aha III/Sma
EcoRI
EcoRI
BomH I Sal I Pst I
-pBR322 sequences EcoRI
Bce I X bo I
Xbo I
N eo'
I
Delete Sal I - Xbo I
Delete Sal I - Xba I
Bcl I/SmaI Joint
AhaIllI/Smal Joint cat-86 lacZ TTG TTT | GGG GAT 1 2 codon
EcoRI
EcoRI
;
Sall/Xbal
Sal I/Xba I
Neor
Neor FIG. 3. Diagram of the construction of pPL31ac3O and pPL31ac2. The vector plasmid pMC1871. Details of the construction are provided in the text.
is
pPL603E,
and the source of the
lacZ gene is
VOL. 160, 1984
CHLORAMPHENICOL INDUCIBILITY
TABLE 1. Cm inducibility of cat-86 in promoter-containing derivatives of pPL703a Plasmid
CAT sp act -Cm +Cm
pPL703 pPL603E
0.02 0.03
0.04 0.67
pPL703-E2.8
0.07
0.45
pPL703-B1.3
0.08
0.51
pPL703-S1.2
0.07
0.88
5
potentially within the amino-terminal region of the catlac fusion product specified by pPL31ac30. The construction of pPL31ac30 is described above. The plasmid is a derivative of pPL603E containing lacZ inserted in frame immediately after codon 30 of cat-86. All cat-86 coding sequences 3' to codon 30 were deleted (Fig. 3). B. subtilis BGSC 1A422 (recE4 leuB6) harboring pPL31ac30 formed beige colonies after 24 h of growth on tryptose blood agar base containing X-gal (40 p.g/ml) and neomycin sulfate (10 ,ug/ml). On the same medium supplemented with a subinihibitory level of Cm, 0.05 or 0.1 ,ug/ml, the colonies showed an intense blue color due to the Cm induction of Pgalactosidase and its subsequent cleavage of X-gal. Induction of 1A422 (pPL31ac3O) in Penassay broth with 0.1 ,ug of Cm per ml resulted in a 10 fold increase in 3-galactosidase activity during a 40-min incubation period (Fig. 4). To eliminate the entire cat-86 coding region, lacZ was fused in frame to codon 2 of cat-86 and all downstream cat sequences were deleted (Fig. 3). This plasmid, pPL31ac2, was transformed into B. subtilis 1A422 where it conferred resistance to neomycin. On media containing neomycin sulfate and X-gal, 1A422 (pPL3lac2) produced beige colonies after 24 h of growth, and on the same medium containing 0.1 ,ug of Cm per ml the colonies were intensely blue. In broth cultures, 1A422 (pPL31ac2) showed a 10-fold increase in ,galactosidase activity during a 40-min exposure to 0.1 Fg of Cm per ml (Fig. 4). Resolution of ,-galactosidase from B. subtilis by electrophoresis through cellulose acetate. Functional f-galactosidase from E. coli is a large protein composed of four identical subunits, and each subunit consists of 1,023 amino acid residues (15). Based on our calculations, the form of ,Bgalactosidase specified by pMC1871 should have an identical net charge to that of the native enzyme from E. coli. In the was
Promoter insert
None 203-bp EcoRI-PstI fragment (P2 fragment [8]) 2.8-kb EcoRl fragment of B. subtilis DNA 1.3-kb BamHI fragment of B. subtilis DNA 1.2-kb Sall fragment of
Bacillus licheniformis ATCC 9945 DNA a B. subtilis BGSC1A422 (recE4 leuB6) harboring the individual plasmids was grown in Penassay broth containing 5 pLg of neomycin sulfate per ml to mid-log phase. Each culture was split, and 1 ,g of Cm per ml was added to one. Incubation was continued for 2 h at 37°C. Specific activity is expressed as micromoles of Cm acetylated per minute per milligram of protein.
sequence similarity (12, 13). Thus, the possibility existed that the extreme amino-terminal end of Cm acetyltransferase was involved in the Cm regulation of gene expression. To determine whether the truncated 13% peptide of cat-86 was essential to Cm-inducible gene expression, we fused the E. coli lacZ gene in correct frame to cat-86 at codon 30 and at codon 2. The lacZ gene was selected because the gene had been previously shown to be capable of expression in B. subtilis (6). In addition, heterologous peptides fused to the amino terminus of the lacZ product, ,-galactosidase, appear not to interfere with the ,B-galactosidase catalytic activity (5). Lastly, it was hoped that the tertiary structure of functional ,-galactosidase would disrupt any regulatory activity that
pPL3 1c 30
pPL3 lac 2
-0 ._
4._
+ Cm 0) 0
0)
.0 a
0
-
cs
76
0
10
20
30
40
0
10
20
30
40
Minutes FIG. 4. Cm-inducible expression of lacZ in B. subtilis containing pPL31ac3O or pPL31ac2. B. subtilis 1A422 (recE4 leuB6) harboring either pPL31ac3O or pPL31ac2 was grown in Penassay broth containing 10 jig of neomycin sulfate per ml. During early exponential growth, the culture was split and a subinhibitory concentration of Cm (0.1 ,ug/ml) was added to one. Samples (5 ml each) were periodically withdrawn, and turbidity was measured at 600 nm. Cells in each sample were assayed for ,-galactosidase activity (17) after being made permeable by the Tristoluene procedure (6). ,-Galactosidase activity is expressed in Miller units (17).
MONGKOLSUK, AMBULOS, AND LOVETT
6
J. BACTERIOL.
Cathodle Originl
Am_ 1
2
3
23
_ _. 4
4
5
6
6
7
7
Anode FIG. 5.
harboring pPL3lac2 B. Subtilis Deharboring and pPL31ac3s . Lysates of plasmidpPL31ac2 containing cells were prepared from Cm-induced and uninduced cells. electtrnnhnred thriouh cellulosep acetate. and stained for B-
charge of native P-galactosidase from either B. subtilis or E. coli would be very similar. Extracts from B. subtilis 1A422 containing either pPL3lac2 or pPL31ac3O were prepared from cells grown with and without 0.1 ,ug of Cm per ml. These were subjected to electrophoresis at pH 7.0 through cellulose acetate (nondenaturing conditions) in parallel with authentic P-galactosidase from E. coli. The gels were then stained for Pgalactosidase activity. Extracts from uninduced cells contained no detectable P-galactosidase activity, whereas extracts from cells induced with Cm contained a discrete species of enzyme that migrated slightly slower than authentic ,-galactosidase from E. coli (Fig. 5). This indicated that ,-galactosidase from B. subtilis was much more positively charged than the authentic enzyme from E. coli. However, this reduction in migration rate appears to be an artifact of the B. subtilis cell extracts, since mixing authentic ,3-galactosidase from E. coli with an extract of plasmid-free B. subtilis (BGSC 1A422) caused the authentic E. coli enzyme to migrate with the ,B-galactosidase from B. subtilis (Fig. 5, lane 5). These experiments demonstrate that the lacZ gene is expressing in B. subtilis and the expression is Cm inducible. Expression of lacZ requires an inserted promoter. The promoter in pPL603E that controls expression of cat-86 is within the P2 restriction fragment (Fig. 1; 8). To determine whether P2 was necessary for lacZ expression, we eliminated P2 from pPL31ac3O in the following manner. pPL31ac3O and pPL703 each contain single sites sensitive to PstI and BglII. PstI cuts both plasmids 144 bp upstream from the cat86 translation initiation codon, and BglII cuts within the neomycin resistance determinant in the pUBilO portion of both plasmids. The PstI-BglII fragment (5.1 kb) from pPL31ac3O contains lacZ. This fragment was purified from agarose gels and ligated with the 2.2-kb PstI-BglII fragment from pPL703. The resulting plasmid, pPL7lac30, specifies neomycin resistance in B. subtilis but is unable to specify -
andro pPL733lTharesutingLlasatespP7ofcplasmid-ie
galactosidase (see the text). Wells 1 through 4 contained protein from extracts of 1A422 carrying, respectively, (pPL3lac2) induced; (pPL31ac2) uninduced; (pPL31ac3O) induced; (pPL31ac3O) uninduced. Well 6 contained authentic ,B-galactosidase from E. coli. Well 5 contained authentic 3-galactosidase mixed with a cell-free extract of 1A422. Well 7 contained one-half the same extract applied to well 3. Extracts from 1A422 containing no plasmid, grown with and without Cm, contained no 13-galactosidase and are not shown on this gel.
lacZ gene in pMC1871, the first eight codons of the wild-type have been replaced with a synthetic linker (24). This linker contains a codon for aspartate GAT (24). Thus, the aspartate codon in position five of wild-type lacZ is compensated for by the aspartate codon in the linker in terms of the charge of the gene product. Fusion of the lacZ gene from pMC1871 to AhaIII site in cat-86 (pPL31ac2) should produce no charge difference in the product compared with wild-type P-galactosidase, whereas fusion to cat-86 at BclI (pPL31ac3O) should introduce into the product three negatively charged amino acid residues-aspartate and two glutamates-and seven positively charged amino acid residuestwo lysines, two arginines, and three histidines. Thus, the cat-lac fusion protein specified by pPL31ac3O should contain a net increase of four positive charges relative to the subunit protein in authentic f3-galactosidase. This is a small increase in a very large protein, and it was thought that the overall
BI'rIs
I,
doint
gene
'Sol I/XbaI
Neor FIG. 6. Diagram of pPL71ac3O. pPL7Iac3O (7.3 kb) consists of the 5.1-kb PstE-BgIII segment of pPL31ac3O joined to the 2.2-kb PstIBglII segment of pPL703. The cat-lac fusion gene in pPL7lac3O lacks a promoter. PstI is a unique restriction site (boxed in the figure) into which promoters can be cloned that activate the cat-lac fusion gene.
CHLORAMPHENICOL INDUCIBILITY
VOL. 160, 1984
galactosidase since the lacZ gene now lacks a promoter (Fig. 6). Hence, the P2 fragment in pPL31ac3O was essential for lacZ expression in B. subtilis. To demonstrate that the lacZ gene in pPL7Iac3O could be expressed, we cloned B. subtilis restriction fragments into the unique PstI site that occurs 144 bp upstream from the cat-lac fusion gene (Fig. 6). Transformants of 1A422 were selected on tryptose blood agar base containing neomycin sulfate (10 ,ug/ml), Cm (0.1 ,ug/ml), and X-gal (40 ,ug/ml). Approximately 20% of the transformant colonies were blue, and each of 10 blue colonies contained pPL71ac3O harboring an inserted piece of DNA that could be released by cleavage with PstI. pPL71ac30 therefore can be used in cloning restriction fragments that have promoter activity. Donnelly and Sonenshein (6) and Zukowski et al. (34) have previously noted the usefulness of promotercloning plasmids that utilize the expression of genes that produce a color reaction as a visual means to identify the insertion of promoters. In principle, pPL7Iac3O is a comparable vector. We anticipated that expression of the cat-lac fusion gene in pPL71ac3O would be Cm inducible regardless of the promoter chosen to activate the gene, and each of two promoter-containing derivatives of the plasmid tested exhibited Cm-inducible P-galactosidase activity similar to that shown in Fig. 4. DISCUSSION The Cm inducibility of the cat-lac fusion gene in pPL31ac2 provides the first definitive evidence that inducibility is independent of the transcription and translation products of the cat-86 coding region. Since inducibility is retained by using five different promoter-containing fragments, the inducibility signals are located in the 144-bp sequence that intervenes between the site of promoter insertion and the cat gene. This 144-bp region contains 12 translation termination codons and can theoretically specify only very short peptides. Therefore, we suspect that the gene products involved in Cm induction are probably provided by the host. The B. subtilis ribosome is the site of action of Cm (29), and we feel it likely that the interaction of Cm-modified ribosomes with specific sequences in the region of RNA upstream from cat86 blocks formation of the secondary structure that would, in the absense of Cm, sequester the cat ribosome binding site. The mechanism by which the ribosomes may destabilize or block the formation of the RNA stem loops is not known. A working model that we feel provides a possible explanation involves recognition of sequences in cat mRNA upstream from the inverted repeat region by the 30S ribosomal subunit through complementary base pairing with 16S rRNA. Subsequent association of a Cm-modified 50S subunit may form a 70S ribosome dead-end complex stably associated with mRNA at a precise site upstream from the inverted repeats. If this interaction is concomitant with transcription, the physical presence of the dead-end ribosomal complex on the mRNA may block formation of secondary structure in the downstream RNA. This model requires that sequences upstream from the inverted repeats share extensive homology with 16S rRNA, and inspection of regions 5' to the inverted repeats of both cat-86 (Fig. 2) and the pC194 cat gene (13) reveals sequences with extensive homology to the extreme 3' end of B. subtilis 16S rRNA, 3'UCUUUCCUCC.... For example, ca. 30 bases upstream from the first of the two inverted repeat sequences preceding cat-86 is the sequence 5'GAAAGGA (positions 68 through 74 in Fig. 2). This sequence exhibits a calculated AG
7
of binding to 16S rRNA of -14 kcal (58.62 kJ)/mol (28) and should therefore be a strong binding site for the 30S ribosomal subunit (20). If this model is correct, then selected deletions from the 144-bp region preceding cat-86 that do not enter the inverted repeat sequences may result in the loss of inducible expression of cat-86. Byeon and Weisblum (4) have suggested a different model for cat induction, in which it is proposed that the Cm-modified 50S ribosomal subunit, independent of the 30S subunit, selects and binds to sequences in the inverted-repeat region of the cat mRNA that are complementary to a region of 23S rRNA. The result is destabilization of the secondary structure in the vicinity of the ribosome binding site. Both models are speculative and require rigorous testing. However, the present study clearly delimits the sequences essential for Cm induction of cat-86 to a transcribed region that immediately precedes the gene. The possibility that Cm inducibility of cat-86 is the result of posttranscriptional control remains speculative and is based exclusively on the identification of the cat-86 ribosome binding site within an inverted-repeat sequence that precedes the coding region. Indeed, an experiment designed to test for posttranscriptional control by monitoring cat-86 mRNA levels in induced and uninduced cells has demonstrated that induced cells contain significantly higher levels of cat-86 mRNA (8). This does not eliminate posttranscriptional control from consideration, but the results may indicate that Cm regulates cat-86 expression at least partially at a transcriptional level (11). Our results with cat-86 differ from those reported by Byeon and Weisblum (4) for the pC194 cat gene in which the cat mRNA levels were the same in induced and uninduced cells. It is therefore conceivable that these two cat genes are regulated by somewhat different mechanisms. ACKNOWLEDGMENTS
We thank William Vollmar for performing the ,B-galactosidase assays and Gerry Barcak for advice on the gel electrophoresis. This investigation was supported by a research grant (PCM8202701) from the National Science Foundation.
1. 2. 3.
4.
LITERATURE CITED Ambulos, N. P., Jr., J. H. Chow, S. Mongkolsuk, L. H. Preis, W. R. Voilman II, and P. S. Lovett. 1984. Constitutive variants of the pC194 cat gene exhibit DNA alterations in the vicinity of the ribosome binding site sequence. Gene 28:171-176. Bott, K. F., and G. A. Wilson. 1967. Development of competence in the Bacillus subtilis transformation system. J. Bacteriol. 94:562-570. Bradford, M. M. 1976. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. Byeon, W.-H., and B. Weisbium. 1984. Post-transcriptional regulation of chloramphenicol acetyl transferase. J. Bacteriol. 158:543-550.
5. Casadaban, M., A. Arias-Martinex, S. K. Shapira, and J. Chou. 1983. 1-Galactosidase gene fusions for analysing gene expression in E. coli and yeast. Methods Enzymol. 100:293-308. 6. Donnelly, C. E., and A. L. Sonenshein. 1984. Promoter-probe
plasmid for Bacillus subtilis. J. Bacteriol. 157:965-967.
7. Duvall, E. J., D. M. Williams, P. S. Lovett, C. Rudolph, N. Vasantha, and M. Guyer. 1983. Chloramphenicol-inducible gene expression in Bacillus subtilis. Gene 24:170-177. 8. Duvall, E. J., D. M. Williams, S. Mongkolsuk, and P. S. Lovett. 1984. Regulatory regions that control expression of two chloramphenicol-inducible cat genes cloned in Bacillus subtilis. J.
Bacteriol. 158:784-790.
8
MONGKOLSUK, AMBULOS, AND LOVETT
9. Ehrlich, S. D. 1977. Replication and expression of plasmids from Staphylococcus aureus in Bacillus subtilis. Proc. Natl. Acad. Sci. U.S.A. 74:1680-1682. 10. Eicher, E. M., And L. L. Washburn. 1978. Assignment of genes to regions of mouse chromosomes. Proc. Natl. Acad. Sci. U.S.A. 75:946-950. 11. Fisher, R., and C. Yanofsky. 1983. A complementary DNA oligomer releases a transcription pause complex. J. Biol. Chem. 258:9208-9212. 12. Harwood, C. R., D. M. Wiliams, and P. S. Lovett. 1983. Nucleotide sequence of a Bacillus pumilus gene specifying chloramphenicol acetyltransferase. Gene 24:163-169. 13. Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150:815-825. 14. Jalanko, A., I. Palva, and H. Soderlund. 1981. Restriction maps of pUB110 and pBD9. Gene 14:325-328. 15. Kalnins, A., K. Otto, U. Ruther, and B. Muller-Hill. 1983. Sequence of the lacZ gene of Escherichia coli. EMBO J. 2:593597. 16. Messing, J., R. Crea, and P. H. Seeburg. 1981. A system for shotgun DNA sequencing. Nucleic Acids Res. 9:308-311. 17. Miller, J. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 18. Mongkolsuk, S., Y.-W. Chiang, R. R. Reynolds, and P. S. Lovett. 1983. Restriction fragments that exert promoter activity during postexponential growth of Bacillus subtilis. J. Bacteriol. 155:1399-1406. 19. Mongkolsuk, S., and P. S. Lovett. 1984. Selective expression of a plasmid cat gene at a late stage of Bacillus subtilis sporulation. Proc. Natl. Acad. Sci. U.S.A. 81:3457-3460. 20. Murray, C. L., and J. C. Rabinowitz. 1982. Species specific translation: characterization of B. subtilis ribosome binding sites, p. 271-285. In A. Ganesan, J. Hoch, and S. Chang (ed.), Molecular cloning and gene regulation in bacilli. Academic Press, Inc., New York. 21. Pheiffer, B. H., and S. B. Zimmerman. 1983. Polymer-stimulated ligation: enhanced blunt- or cohesive-end ligation of DNA or deoxyribooligonucleotides by T4 DNA ligase in polymer solutions. Nucleic Acids Res. 11:7854-7871. 22. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467.
J. BACTERIOL. 23. Schoner, R. G., D. M. Williams, and P. S. Lovett. 1983. Enhanced expression of mouse dihydrofolate reductase in Bacillus subtilis. Gene 22:47-57. 24. Shapira, S. K., J. Chou, F. V. Richaud, and M. J. Casadaban. 1983. New versatile plasmid vectors for expression of hybrid proteins coded by a cloned gene fused to lacZ gene sequences encoding an enzymatically active carboxyterminal portion of galactosidase. Gene 25:71-82. 25. Shaw, W. V. 1%7. The enzymatic acetylation of chloramphenicol by extracts of R factor resistant Escherichia coli. J. Biol. Chem. 242:687-693. 26. Shaw, W. V. 1975. Chloramphenicol acetyltransferase from chloramphenicol resistant bacteria. Methods Enzymol. 43:342357. 27. Shaw, W. V. 1983. Chloramphenicol acetyltransferase: enzymology and molecular biology. Crit. Rev. Biochem. 14:1-43. 28. Tinoco, I., Jr., P. N. Borer, B. Dengler, M. D. Levine, 0. C. Uhlenbeck, D. M. Crothers, and J. Gralla. 1973. Improved estimation of secondary structure in ribonucleic acids. Nature (London) New Biol. 246:40-41. 29. Vazquez, D. 1979. Inhibitors of protein biosynthesis. Mol. Biol. Biochem. Biophys. 30:108-112. 30. Williams, D. M., E. J. Duvall, and P. S. Lovett. 1981. Cloning restriction fragments that promote expression of a gene in Bacillus subtilis. J. Bacteriol. 146:1162-1165. 31. Williams, D. M., R. G. Schoner, E. J. Duvall, L. H. Prels, and P. S. Lovett. 1981. Expression of Escherichia coli trp genes and the mouse dihydrofolate reductase gene cloned in Bacillus subtilis. Gene 16:199-206. 32. Wilson, C. R., S. E. Skinner, and W. V. Shaw. 1981. Analysis of two chloramphenicol resistance plasmids from Staphylococcus aureus: insertional inactivation of Cm resistance, mapping of restriction sites, and construction of cloning vehicles. Plasmid 5:245-258. 33. Winshell, E., and W. V. Shaw. 1969. Kinetics of induction and purification of chloramphenicol acetyltransferase from chloramphenicol-resistant Staphylococcus aureus. J. Bacteriol. 98:1248-1257. 34. Zukowski, M. M., D. F. Gaffney, D. Speck, M. Kauffmann, A. Findell, A. Wisecup, and J. P. LeCocq. 1983. Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene. Proc. Natl. Acad. Sci. U.S.A. 80:1101-1105.
