induced Ca2 Release in Vascular Myocytes - The Journal of Biological ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 275, No. 13, Issue of March 31, pp. 9596 –9603, 2000 Printed in U.S.A.

Requirement of Ryanodine Receptor Subtypes 1 and 2 for Ca2ⴙ-induced Ca2ⴙ Release in Vascular Myocytes* (Received for publication, December 3, 1999, and in revised form, January 5, 2000)

Fre´de´ric Coussin, Nathalie Macrez‡, Jean-Luc Morel, and Jean Mironneau From the Laboratoire de Physiologie Cellulaire et Pharmacologie Moleculaire, CNRS UMR 5017, Universite´ de Bordeaux II, 146 rue Leó Saignat, 33076 Bordeaux Cedex, France

While the roles of subtypes 1 and 2 of the ryanodine receptors (RYRs) have been studied in cellular systems expressing specifically one or the other of these subtypes (i.e. skeletal and cardiac muscle), the function of these receptors has not been evaluated in smooth muscles. We have previously reported RYR-mediated elementary (Ca2ⴙ sparks) and global Ca2ⴙ responses in rat portal vein myocytes. Here, we investigated the respective roles of all three RYR subtypes expressed in these cells as revealed by reverse transcriptase-polymerase chain reaction. Antisense oligonucleotides targeting each one of the three RYR subtypes were shown to specifically inhibit the expression of the corresponding mRNA and protein without affecting the other RYR subtypes. Confocal Ca2ⴙ measurements revealed that depolarization-induced Ca2ⴙ sparks and global Ca2ⴙ responses were blocked when either RYR1 or RYR2 expression was suppressed. Caffeine-induced Ca2ⴙ responses were partly inhibited by the same antisense oligonucleotides. Neither the corresponding scrambled oligonucleotides nor the antisense oligonucleotides targeting RYR3 affected depolarization- or caffeine-induced Ca2ⴙ responses. Our results show that, in vascular myocytes, the two RYR1 and RYR2 subtypes are required for Ca2ⴙ release during Ca2ⴙ sparks and global Ca2ⴙ responses, evoked by activation of voltage-gated Ca2ⴙ channels.

Ca2⫹ signaling is a common step for activation of all muscle cell types and Ca2⫹ release from the sarcoplasmic reticulum plays an essential role in the regulation of the cytosolic Ca2⫹ concentration. Two families of intracellular Ca2⫹ release channels are known; the inositol 1,4,5-trisphosphate receptor family is activated by the second messenger inositol 1,4,5-trisphosphate, while the ryanodine receptor (RYR)1 family is activated by cytosolic Ca2⫹ and is able to bind the plant alkaloid ryanodine (1, 2). Since the description of a Ca2⫹-induced Ca2⫹ release (CICR) mechanism in skeletal muscle (3), the function of RYR as a Ca2⫹-activated Ca2⫹ release channel has been widely

* This work was supported by grants from CNRS, Centre National des Etudes Spatiales, France and Re´gion Aquitaine (Poˆle Me´dicamentSante´). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ‡ To whom correspondence should be addressed: Laboratoire de Physiologie Cellulaire et Pharmacologie Molećulaire, CNRS UMR 5017, Universite´ de Bordeaux II, 146 rue Leó Saignat, 33076 Bordeaux Cedex, France. Tel.: 33 5 57 57 10 85; Fax: 33 5 57 57 12 27; E-mail: [email protected]. 1 The abbreviations used are: RYR, ryanodine receptor; CICR, Ca2⫹induced Ca2⫹ release; PCR, polymerase chain reaction; RT, reverse transcription.

studied in both skeletal and cardiac muscles, where the mechanisms of RYR activation by plasma membrane depolarization are different. In skeletal muscle, RYR is thought to be operated by a mechanical coupling with the dihydropyridine receptor Ca2⫹ channels without requirement of Ca2⫹ influx (4 – 6). In contrast, the cardiac type of excitation-contraction coupling involves a depolarization-dependent Ca2⫹ influx via dihydropyridine receptor Ca2⫹ channels, which triggers Ca2⫹ release through RYR (7, 8). In smooth muscle, depolarization-induced Ca2⫹ release via RYR has been described and requires Ca2⫹ influx (9, 10). Localized Ca2⫹ release events, called Ca2⫹ sparks, have been shown to be produced by RYRs in smooth muscle as well as in other muscles (11–14). It has been proposed that global Ca2⫹ signals result from the spatiotemporal summation of individual calcium release events, giving rise to Ca2⫹ waves (14 –17). In the last few years, the cloning and sequencing of three genes encoding different RYR subtypes and 10 genes encoding dihydropyridine receptor Ca2⫹ channel subtypes has provided a structural basis for the understanding of the different types of RYR activation by membrane depolarization. Both RYR and dihydropyridine receptor Ca2⫹ channel subtypes involved in depolarization-induced Ca2⫹ release are different between cardiac and skeletal muscle. The skeletal Ca2⫹ release depends on ryanodine receptor subtype 1 (RYR1) activation (18). Despite a recent report showing that in embryonic cardiac myocytes isolated from mutant mice lacking RYR2, the CICR mechanism is not significantly affected (19), the mature cardiac CICR is thought to occur through subtype 2 (RYR2). Since smooth and cardiac muscles share the expression of RYR2 subtype and highly homologous ␣1C L-type Ca2⫹ channel subclones (20 – 24), a cardiac-like mechanism is generally proposed to underlie the vascular or visceral Ca2⫹ channel activation-induced Ca2⫹ release. However, some studies have shown that both RYR1 and RYR3 may also be activated by Ca2⫹ influx upon L-type Ca2⫹ channel activation (18, 25). In the present study, we performed a series of experiments to determine which RYR subtypes are responsible for Ca2⫹ sparks and global Ca2⫹ responses in rat portal vein myocytes. Subtypes of RYR potentially expressed in these cells were first identified by RT-PCR, and then we designed antisense oligonucleotides that specifically targeted each RYR subtype. The efficiency of these antisense oligonucleotides was checked by studying their ability to specifically inhibit RYR subtype expression on one hand and to inhibit Ca2⫹ sparks or global Ca2⫹ responses induced by membrane depolarization or caffeine application on the other. We show for the first time that both RYR1 and RYR2 subtypes are required for Ca2⫹ sparks and global Ca2⫹ responses induced by activation of voltage-gated Ca2⫹ channels. These results suggest the existence of mixed functional Ca2⫹ release channel units composed of RYR1 and RYR2 subtypes in vascular myocytes.

9596

This paper is available on line at http://www.jbc.org

RYR1- and RYR2-dependent Ca2⫹ Events MATERIALS AND METHODS

Cell Preparation—Rats (160 –180 g) were killed by cervical dislocation. The portal vein was cut into several pieces and incubated for 10 min in low Ca2⫹ (40 ␮M) physiological solution (Hanks’ balanced salt solution), and then 0.8 mg/ml collagenase (EC 3.4.24.3), 0.2 mg/ml Pronase E (EC 3.4.24.31), and 1 mg/ml bovine serum albumin were added at 37 °C for 20 min. After this time, the solution was removed, and pieces of portal vein were incubated again in a fresh enzyme solution at 37 °C for 20 min. Tissues were placed in an enzyme-free solution and triturated using a fire-polished Pasteur pipette to release cells. Cells were seeded at a density of 103 cells/mm2 on glass slides imprinted with squares for localization of injected cells. Cells were maintained in short term primary culture in medium M199 containing 2% fetal calf serum, 2 mM glutamine, 1 mM pyruvate, 20 units/ml penicillin, and 20 ␮g/ml streptomycin; they were kept in an incubator gassed with 95% air and 5% CO2 at 37 °C. The myocytes were cultured in this medium for 4 days. RT-PCR—Total RNA was extracted from portal vein media, heart, or skeletal muscle (Fig. 1A) and from about 100 portal vein myocytes (Fig. 1, C and D) using the RNeasy minikit (Qiagen, Hilden, Germany), following the instructions of the supplier. The reverse transcription reaction was performed using Sensiscript RT kit (Qiagen). Total RNA was incubated with random primers (Promega, Lyon, France) at 65 °C for 5 min. After a cooling time of 15 min at 25 °C, RT mix was added, and the total mixture was incubated for 60 min at 37 °C. The resulting cDNA was stored at ⫺20 °C. PCR was performed with 2 ␮l of cDNA (in RT-PCR mix), 1.25 units of HotStartTaq DNA polymerase (Qiagen), a 1 ␮M concentration of each primer, and a 200 ␮M concentration of each deoxynucleotide triphosphate, in a final volume of 50 ␮l. The PCR conditions were 95 °C for 15 min and then 35 cycles at 94 °C for 1 min, 60 °C (RYR1 and RYR2) or 56 °C (RYR3) for 1 min, and 72 °C for 1 min, and at the end of PCR, samples were kept at 72 °C for 10 min for final extension and then stored at 4 °C. Reverse transcription and PCR were performed with a thermal cycler (Techne, Cambridge, UK). Amplification products were separated by electrophoresis (2% agarose gel) and visualized by ethidium bromide staining. Gels were photographed with EDAS 120 and analyzed with KDS1D 2.0 software (Kodak Digital Science, Paris, France). Sense (s) and antisense (as) primer pairs specific for RYR1, RYR2, and RYR3 were designed on the known cloned receptor sequences deposited in the GenBankTM sequence data base (accession nos. X83932, X83933, and X83934, respectively) with Lasergene software (DNASTAR, Madison, WI). The nucleotide sequence and the length of the expected PCR products (in parentheses) for each primer pair were, respectively, as follows: RYR1(s), GAAGGTTCTGGACAAACACGGG; RYR1(as), TCGCTCTTGTTGTAGAATTTGCGG (435 base pairs); RYR2(s), GAATCAGTGAGTTACTGGGCATGG; RYR2(as), CTGGTCTCTGAGTTCTCCAAAAGC (635 base pairs); RYR3(s), AGAAGAGGCCAAAGCAGAGG; RYR3(as), GGAGGCCAACGGTCAGA (269 bp). DNA Sequencing—After electrophoresis, the amplified DNA fragments were cleaned and purified with the Qiaquick gel extraction kit (Qiagen). PCR fragments were sequenced by the Qiagen sequencing service. The deduced DNA sequences of RYR1, RYR2, and RYR3 fragments were 98, 99, and 97% identical, respectively, to the published sequences. Microinjection of Oligonucleotides—Sequences of phosphorothioate antisense oligonucleotides used in the present study were determined by sequence comparison with Lasergene software. Sequence of all three RYR cDNAs were aligned with each other, and specific antisense oligonucleotide sequences were chosen in the region of the cDNA of interest, completely different from the sequences of the two other RYR subtypes. Then antisense and scrambled sequences displaying putative binding to any other mammalian sequences deposited in GenBankTM were discarded. Oligonucleotides were injected into the nuclei of myocytes by a manual injection system (Eppendorf, Hamburg, Germany). Intranuclear oligonucleotide injection with Femtotips II (Eppendorf) was performed as described previously (26). The myocytes were then cultured for 3– 4 days in culture medium, and the glass slides were transferred into the perfusion chamber for physiological experiments. The sequences of as1RYR1 and as2RYR1 are AGCGTGTGCAGCAGGCTCA and GCAATCCGCTCCCGCCCA, corresponding to nucleotides 325–343 and 584 – 601, respectively of RYR1 cDNA deposited in GenBankTM (accession no. X83932); those of as1RYR2 and as2RYR2 are GTGTCCTCACAGAAGTT and TGAAATCTAGTGCAGCCT, corresponding to nucleotides 137–153 and 1587–1604, respectively, of RYR2 cDNA (accession no. X83933); and those of as1RYR3 and as2RYR3 are AAGTCAAGGGCATTTTTG and ACTTAGCCATGACACCAG, corresponding to nucleotides 502–519 and 557–574, respectively, of RYR3 cDNA (accession no. X83934). In some control experiments, myocytes were in-

9597

jected with the following scrambled oligonucleotides: CACGCCTACGCACCTCCG, corresponding to a scrambled sequence of as2RYR1 (nucleotides 584 – 601 of RYR1 cDNA); AGTCGTACATGACTCGTA, corresponding to a scrambled sequence of as2RYR2 (nucleotides 1587–1604 of RYR2 cDNA); and CAGCACTATCAGTACGAC, corresponding to a scrambled sequence of as2RYR3 (nucleotides 557–574 of RYR3 cDNA). Patch Clamp Measurements—Voltage clamp and membrane current recordings were made with a standard patch clamp technique using a List EPC7 patch clamp amplifier (Darmstadt, Eberstadt, Germany). The whole-cell-recording mode was performed with patch clamp pipettes of 2–5-megaohm resistance. Membrane potential and current records were stored and analyzed using pCLAMP software (Axon Instruments, Forster City, CA). Peak current density (picoamps/picofarads) was calculated by dividing the peak inward current at 0 mV by the cell capacitance. The normal physiological solution contained 130 mM NaCl, 5.6 mM KCl, 1 mM MgCl2, 1.7 mM CaCl2, 11 mM glucose, and 10 mM HEPES (pH 7.4, with NaOH). The basic pipette solution contained 130 mM CsCl and 10 mM HEPES (pH 7.3 with CsOH). Cytosolic Ca2⫹ Measurements—For experiments that used membrane depolarization, fluo 3 (60 ␮M) was dialyzed into the cells through the patch clamp pipette. In the other experiments, cells were loaded by incubation in physiological solution containing 4 ␮M fluo 3-acetoxymethylester for 1 h at room temperature. These cells were washed and allowed to cleave the dye to the active fluo 3 compound for 1 h. Images were acquired using the line-scan mode of a confocal Bio-Rad MRC1000 (Bio-Rad, Paris, France) connected to a Nikon Diaphot microscope. Excitation light was delivered by a 25-milliwatt argon ion laser (Ion Laser Technology, Salt Lake City, UT) through a Nikon Plan Apo ⫻60, 1.4 NA objective lens. Fluo 3 was excited at 488 nm, and emitted fluorescence was filtered and measured at 540 ⫾ 30 nm. At the setting used to detect fluo 3 fluorescence, the resolution of the microscope was near 0.4 ⫻ 0.4 ⫻ 1.5 ␮m (x-, y-, and z-axis). Images were acquired in the line-scan mode at a rate of 6 ms/scan. Scanned lines were plotted vertically, and each line was added to the right of the preceding line to form the line-scan image. In these images, time increased from the left to the right, and the position along the scanned line was given by vertical displacement. Fluorescence signals are expressed as pixel per pixel fluorescence ratios (F/F0), where F is the fluorescence during a response and F0 is the rest-level fluorescence of the same pixel. Image processing and analysis were performed by using COMOS, TCSM, and MPL 1000 software (Bio-Rad). BayK 8644, angiotensin II, and caffeine were applied by pressure ejection from a glass pipette for the period indicated on the records. All experiments were carried out at 26 ⫾ 1 °C. RYR Labeling—Three days after injection, myocytes were washed in physiological solution and incubated with BODIPY® FL-X ryanodine (1 ␮M) for 60 min at 37 °C. After incubation, cells were washed and maintained in physiological solution during fluorescence measurements. Images of the stained cells were obtained with the Bio-Rad confocal microscope. Control cells and injected cells on the same glass slide were compared with each other by keeping acquisition parameters constant (gray values, exposure time, aperture). Nonspecific fluorescence was estimated by incubating cells with both 1 ␮M BODIPY® FL-X ryanodine and 10 ␮M ryanodine. Fluorescent labeling was estimated by gray level analysis using MPL software and expressed in arbitrary units of fluorescence. Chemicals and Drugs—Collagenase was obtained from Worthington. Fluo 3, fluo 3-acetoxymethylester, and BODIPY® FL-X ryanodine were from Molecular Probes, Inc. (Leiden, The Netherlands). Caffeine was from Merck (Nogent sur Marne, France). BayK 8644 was from Bayer (Puteaux, France). Angiotensin II was from Neosystem laboratories (Strasbourg, France). Ryanodine was from Calbiochem (Meudon, France). Medium M199 was from ICN (Costa Mesa, CA). Fetal calf serum was from Bio Media (Boussens, France). Streptomycin, penicillin, glutamine, and pyruvate were from Life Technologies, Inc. (Cergy Pontoise, France). All primers and phosphorothioate antisense oligonucleotides were synthesized and purchased from Eurogentec (Seraing, Belgium). All other chemicals were from Sigma. Data Analysis—Data are expressed as means ⫾ S.E.; n represents the number of tested cells. Significance was tested by means of Student’s test. p values ⬍ 0.05 were considered as significant. RESULTS

RYR Subtypes Expressed in Vascular Myocytes—Depending on tissues and species, various RYR subtype expression and Ca2⫹ responses via RYRs have been reported in smooth muscle. This variability prompted us to identify the RYR subtypes expressed

9598

RYR1- and RYR2-dependent Ca2⫹ Events

FIG. 1. Amplification of RYR subtype DNA and efficiency of antisense oligonucleotides directed against the mRNAs of the three RYR subtypes in vascular myocytes. cDNA fragments of RYR1 (lanes 1, 4, 7, and 10), RYR2 (lanes 2, 5, 8, and 11), and RYR3 (lanes 3, 6, 9, and 12) were amplified from rat portal vein (PV) and cardiac (H) and skeletal (Sk) muscles in A; from rat portal vein myocytes 3 days after injection with 10 ␮M as2RYR1, as2RYR2, or as2RYR3 antisense oligonucleotides in C; or from rat portal vein myocytes injected with combinations of antisense oligonucleotides, as indicated in D. The amplified DNA fragments were separated on a 2% agarose gel and visualized by staining with ethidium bromide. Numbers on the left indicate molecular size standards in base pairs (bp). B, mean amplitude of Ca2⫹ responses (⌬F/F0) evoked by 10 mM caffeine in noninjected cells and in cells injected with a mixture of as1RYR1⫹2⫹3 antisense oligonucleotides (at 10 ␮M each) in function of time after injection. Data are means ⫾ S.E., with the number of cells tested indicated in parentheses. Cells were obtained from three different batches. Myocytes were loaded with 4 ␮M fluo 3 acetoxymethylester.

in rat portal vein myocytes by RT-PCR. Since RYR subtype complete cDNA sequences were not known in the rat, we designed primer pairs amplifying fragments of each subtype displaying a common sequence in mouse and rabbit or pig and included in the partial sequences of rat RYR1 and RYR2, recently submitted to GenBankTM. RT-PCR performed on RNA extracts prepared from portal vein myocytes maintained 4 days in primary culture gave the same results as the one performed on RNA extracts prepared from freshly isolated myocytes or from portal vein media (Fig. 1A). The expression of all three RYR subtypes in portal vein myocytes contrasts with the specific expression of RYR2 and RYR3 in cardiac myocytes or RYR1 and RYR3 in skeletal myocytes (Fig. 1A). PCR experiments performed directly on RNA extracts (by omitting the reverse transcription) attested that genomic DNA was not amplified (not shown). Efficiency of RYR Antisense Oligonucleotides—Since our

FIG. 2. Labeling of RYRs by fluorescent BODIPY® FL-X ryanodine in vascular myocytes. Typical labeling of RYRs is shown in a noninjected control cell (A and B) and in cells injected with a mixture of as1RYR1⫹2⫹3 antisense oligonucleotides at 10 ␮M each (C and D) or a mixture of as1RYR1⫹2 (E and F). B, D, and F show part of a cell (white box) with a higher magnification. G, compiled data expressed in arbitrary units (AU) of specific BODIPY® FL-X ryanodine fluorescence measured in control and injected cells. Nonspecific fluorescence in the presence of 10 ␮M ryanodine was subtracted from the total fluorescence. Bars show means ⫾ S.E., with the number of cells tested indicated in parentheses. Cells were obtained from three different batches. 多, values significantly different from those obtained in noninjected cells. Cells were stained 3 days after injection of antisense oligonucleotides and incubated at 37 °C for 1 h in a physiological solution containing 1 ␮M BODIPY® FL-X ryanodine. N, nucleus.

PCR results were in agreement with those of Neylon et al. (20), reporting that all three RYR subtypes are expressed in vascular myocytes, we designed antisense oligonucleotides specifically targeting each RYR subtype mRNA. For each RYR subtype, two antisense sequences were chosen, one targeting the region of the mRNA amplified by PCR (named as2RYR) and the other one (named as1RYR) designed to hybridize the mRNA outside the amplified fragment but close to the start codon. We determined the time course of antisense oligonucleotide efficiency by checking the ability of a mixture of as1RYR1 plus as1RYR2 plus as1RYR3 (10 ␮M each; named as1RYR1⫹2⫹3) to inhibit caffeine-induced Ca2⫹ wave in isolated myocytes (Fig. 1B). The Ca2⫹ responses were dramatically decreased 3 days after injection of the antisense oligonucleotides, and recovery


9599

FIG. 3. Effects of asRYR1, asRYR2, and asRYR3 antisense oligonucleotides on Ca2ⴙ sparks induced by membrane depolarizations in vascular myocytes. A, typical transient and localized Ca2⫹ responses (Ca2⫹ sparks) induced by a depolarizing step from ⫺60 to ⫺20 mV in a noninjected control cell. Traces show (from top to bottom) membrane potential, Ca2⫹ current trace, linescan fluorescence image, and averaged fluorescence from a 2-␮m region (indicated by the small vertical bar) of the linescan image. Ca2⫹ sparks are not observed in cells injected with 10 ␮M as1RYR1 (B) and as1RYR2 (C) antisense oligonucleotides, whereas they are present in cells injected with 10 ␮M as1RYR3 antisense oligonucleotides (D). In this latter cell, a spontaneous Ca2⫹ spark (多) is identified before application of the depolarizing step, which triggers further Ca2⫹ sparks from the same initiation site. Myocytes were loaded with fluo 3 through the patch pipette.

FIG. 4. Effects of asRYR1, asRYR2, and asRYR3 antisense oligonucleotides on global Ca2ⴙ responses induced by membrane depolarizations. Typical Ca2⫹ responses induced by depolarizing steps from ⫺60 to 0 mV in a noninjected control cell (A) and in cells injected with 10 ␮M as1RYR1 (B), as1RYR2 (C), and as1RYR3 (D) antisense oligonucleotides. Traces show (from top to bottom) membrane potential, line-scan fluorescence image, and averaged fluorescence from a 2-␮m region of the line-scan image. Myocytes were loaded with fluo 3 through the patch pipette.

began the fourth day. We noted nonspecific effects of antisense oligonucleotides only at concentrations higher than 50 ␮M (for example, inhibition of G␣q protein expression by 50 ␮M asRYRs and vice versa; n ⫽ 15). Based on this time scale, we verified that mRNA encoding each RYR subtype was specifically decreased by the corresponding as2RYR 3 days after injection. Fig. 1, C and D, illustrate RT-PCR experiments performed on RNA preparations from injected cells located in a marked area of glass slides. The noninjected cells located outside the marked area of each glass slide were used as control and displayed in all cases all three subtypes of RYR (not shown). Each antisense oligonucleotide (Fig. 1C) or combinations of two or three antisense oligonucleo-

tides (Fig. 1D) inhibited the amplification of the targeted RYR subtype mRNAs, while the nontargeted subtypes were still amplified, thus showing the efficiency and specificity of our antisense strategy. Looking at the protein expression level, we used BODIPY®labeled ryanodine to detect RYRs, since this has been previously reported on several cell types (27, 28) and validated by the ability of BODIPY®-labeled ryanodine to inhibit [3H]ryanodine binding on skeletal muscle microsomes (29). BODIPY®labeled ryanodine staining in noninjected portal vein myocytes after 3 days of primary culture revealed a network of RYRs throughout the cytoplasm (Fig. 2A) with some spots of fluorescence in discrete areas probably expressing more RYRs (Fig.

9600


2B). In cells injected with all three as1RYRs, RYR fluorescent staining by binding of BODIPY®-labeled ryanodine was abolished (Fig. 2, C, D, and G). Similar results were obtained with injection of all three as2RYRs. The weak fluorescence detected in as1RYR1⫹2⫹3-injected cells is thought to correspond to the nonspecific fluorescence, since it is not different from the background fluorescence measured in cells incubated with 1 ␮M BODIPY® FL-X ryanodine plus 10 ␮M ryanodine (Fig. 2G). Although the fluorescence was largely decreased in cells injected with as1RYR1⫹2 (Fig. 2, E, F, and G), when compared with control cells, a specific fluorescence (about 30% of the fluorescence measured in control cells) could be distinguished from the background fluorescence observed in as1RYR1⫹2⫹3injected cells, attesting that the expression of RYR3 specifically observed in asRYR1⫹2-injected cells was inhibited by asRYR3 antisense oligonucleotides. Similar results were obtained for the other RYR subtypes, and statistical analysis of BODIPY® FL-X ryanodine fluorescence revealed that each one of the RYR subtypes represented approximately one-third of the total amount of RYR expressed per cell, as shown by the remaining fluorescence in cells injected with asRYR1⫹2, asRYR1⫹3, or

FIG. 5. Effects of asRYR antisense oligonucleotides on amplitude of global Ca2ⴙ responses (A) and maximal Ca2ⴙ current densities (B) induced by depolarizing steps from ⴚ60 to 0 mV in noninjected control cells and in cells injected with 10 ␮M as1RYR1, as1RYR2, and as1RYR3 antisense oligonucleotides. Data are means ⫾ S.E., with the number of cells tested indicated in parentheses. Cells were obtained from four different batches. 多, values significantly different from those obtained in noninjected cells. Myocytes were loaded with fluo 3 through the patch pipette.

asRYR2⫹3 (Fig. 2G). Taken together, these results indicate that the antisense oligonucleotides were efficient and specific in inhibiting expression of RYR subtypes 3 days after injection in the nucleus and that they could be used to identify the role of each RYR subtype in Ca2⫹ responses of vascular myocytes. RYR Subtypes Responsible for Depolarization-induced Ca2⫹ Release—We have previously shown that in venous myocytes, Ca2⫹ sparks or global Ca2⫹ responses can be generated by controlling membrane depolarization (14). Electrophysiological protocols eliciting Ca2⫹ sparks (depolarization from ⫺60 to ⫺20 mV) or global Ca2⫹ responses (depolarization from ⫺60 to 0 mV) were applied on cells injected with the various asRYRs in order to determine which RYR subtypes were required for transducing depolarization-induced Ca2⫹ events. Cells injected with as1RYR1 or as1RYR2 were not able to produce any Ca2⫹ sparks and Ca2⫹ responses in response to depolarizations eliciting normal Ca2⫹ currents (Figs. 3 and 4). In contrast, the Ca2⫹ events activated by membrane depolarizations in as1RYR3-injected cells (Figs. 3D and 4D) were not different from those elicited in control cells (Figs. 3A and 4A). Scrambled RYR1 and scrambled RYR2 antisense oligonucleotides did not affect the Ca2⫹ events activated by depolarization or caffeine (not shown). The properties of Ca2⫹ sparks in as1RYR3-injected cells were similar to those of the Ca2⫹ sparks obtained in control cells (Fig. 3). The mean amplitude of Ca2⫹ sparks was estimated to be 1.04 ⫾ 0.08 ratio units (⌬F/F0) in control cells (n ⫽ 63) versus 0.91 ⫾ 0.12 ratio units in as1RYR3-injected cells (n ⫽ 25). The mean time to reach the peak Ca2⫹ spark, the mean half-time of decay, and the mean full width at halfmaximal amplitude were, respectively, 22.1 ⫾ 0.4 ms, 25.5 ⫾ 0.6 ms, and 1.5 ⫾ 0.1 ␮m in control noninjected cells (n ⫽ 63) and 22.2 ⫾ 0.6 ms, 25.2 ⫾ 0.5 ms, and 1.5 ⫾ 0.1 ␮m in asRYR3-injected cells (n ⫽ 25). It should be noted that spontaneous Ca2⫹ sparks have never been detected in either as1RYR1- or as1RYR2-injected cells (n ⫽ 48), whereas they were observed in as1RYR3-injected and control cells. The mean amplitude of global Ca2⫹ responses in as1RYR3-injected cells was similar to that observed in control noninjected cells, while the responses were almost abolished in as1RYR1- or as1RYR2injected cells (Fig. 5A). The maximal rate of Ca2⫹ increase (56 ⫾ 6 ⌬F/F0䡠s⫺1, n ⫽ 63) in control cells was not significantly affected in as1RYR3-injected cells (48 ⫾ 8 ⌬F/F0䡠s⫺1, n ⫽ 25). The Ca2⫹ channel agonist BayK 8644 has been used to increase the frequency of Ca2⫹ sparks in ventricular myocytes (30). In vascular myocytes, the application of 1 nM BayK 8644 similarly increased the number of Ca2⫹ sparks in noninjected cells and in cells injected with as1RYR3 (Table I). In contrast, in as1RYR1- or as1RYR2-injected cells, BayK 8644 failed to induced any Ca2⫹ sparks (Table I), suggesting that whatever the mode of activation of voltage-gated Ca2⫹ channels (membrane depolarization or Ca2⫹ channel agonist), both RYR1 and RYR2 are required for Ca2⫹ release during Ca2⫹ sparks. We also examined the RYR subtypes involved in the angiotensin II-induced Ca2⫹ release. Angiotensin II-mediated Ca2⫹

TABLE I Effects of antisense oligonucleotides directed against the mRNAs of RYRs on the number of Ca2⫹ sparks per line-scan image evoked by Bay K 8644 and on the mean amplitude of angiotensin II-mediated Ca2⫹ responses Data are means ⫾ S.E. with n indicating the number of cells tested in each condition.

a

Noninjected cells

n

as1RYR1injected cells

n


n


n

Bay K 8644 (1 nM) Ca2⫹ spark/line scan image

2.20 ⫾ 0.40

40

0.14 ⫾ 0.06a

30

0.16 ⫾ 0.07a

30

2.10 ⫾ 0.50

25

Angiotensin II (100 nM) Steady state ⌬F/F0

1.80 ⫾ 0.20

42

0.09 ⫾ 0.03a

21

0.19 ⫾ 0.04a

20

2.00 ⫾ 0.20

22

Values significantly different from those obtained in noninjected cells (p ⬍ 0.05).

RYR1- and RYR2-dependent Ca2⫹ Events responses have been shown to be mediated through a CICR mechanism in venous myocytes (13, 31, 32). We found that as1RYR1 and as1RYR2 suppressed the Ca2⫹ responses induced by angiotensin II (100 nM), whereas as1RYR3 was ineffective (Table I). Taken together, these experiments indicate that RYR1 and RYR2 are co-partners in the constitution of functional Ca2⫹ release units activated upon stimulation of

FIG. 6. Effects of Ca2ⴙ-free solution on global Ca2ⴙ responses induced by membrane depolarizations. A, typical Ca2⫹ response evoked by a depolarizing step from ⫺60 to 0 mV in a noninjected control cell superfused in 1.7 mM Ca2⫹-containing solution. B, in Ca2⫹-free, 0.5 mM EGTA-containing solution for 30 s, Ca2⫹ current and Ca2⫹ response were removed. Traces show (from top to bottom) membrane potential, membrane current, line-scan fluorescence image, and averaged fluorescence from a 2-␮m region of the line-scan image. Similar results were obtained in all of the cells tested (n ⫽ 12). Myocytes were loaded with fluo 3 through the patch pipette.

FIG. 7. Effects of asRYRs antisense oligonucleotides on caffeine-induced Ca2ⴙ responses. Typical Ca2⫹ responses induced by 10 mM caffeine in noninjected control cells (A) and in cells injected with 10 ␮M as1RYR1 (B), as1RYR2 (C), and as1RYR3 (D) antisense oligonucleotides are shown. Traces show (from top to bottom) caffeine application, line-scan fluorescence image, and averaged fluorescence from two 2-␮m regions of the linescan image. The arrow indicates a typical Ca2⫹ spark at the initiation site of the Ca2⫹ wave. Myocytes were loaded with fluo 3-acetoxymethylester.

9601

voltage-gated Ca2⫹ channels. Mechanism of Depolarization-induced Ca2⫹ Release—The identification of both RYR1 and RYR2 as required subtypes for depolarization-induced Ca2⫹ release in smooth muscle prompted us to determine which type of coupling was effective in myocytes maintained in short term primary culture (3– 4 days). The maximal Ca2⫹ current activated by a depolarization to 0 mV in normal physiological solution (1.7 mM Ca2⫹) induced a global Ca2⫹ response (Fig. 6A; n ⫽ 12), whereas the same depolarization applied to the same cells transiently perfused with Ca2⫹-free solution for 30 s did not activate any Ca2⫹ current and Ca2⫹ release (Fig. 6B). We verified that this transient perfusion with a Ca2⫹-free solution did not affect the Ca2⫹ content of the store by applying caffeine on the same cells after the depolarization; all cells responded to caffeine application by global Ca2⫹ responses similar to those obtained in Ca2⫹-containing solution (n ⫽ 12). These experiments support the idea that Ca2⫹ influx through Ca2⫹ channels is needed for RYR activation in vascular myocytes. To ensure that the inhibition of this coupling by asRYR1 and asRYR2 was not due to a “side effect” of antisense oligonucleotides on voltage-gated Ca2⫹ channels, we compared the Ca2⫹ currents obtained from control cells and injected cells from the same glass slides. Analysis clearly shows that the maximal Ca2⫹ current densities recorded in asRYR1-, asRYR2-, or asRYR3-injected cells were similar to control noninjected cells (Fig. 5B). In addition, the current-voltage relationships obtained in the three conditions revealed similar threshold potentials, potentials for maximal current, and apparent reversal potentials (not shown). Taken together, these results indicate that the coupling between voltage-gated Ca2⫹ channels and RYR1/RYR2 Ca2⫹ release units is dependent on Ca2⫹ ions entering the cell and that inhibition of the expression of RYR1 and RYR2 does not affect the voltage-gated Ca2⫹ current. RYR Subtypes Involved in Caffeine-induced Ca2⫹ Release—We have previously shown that caffeine applications (10 mM) trigger Ca2⫹ waves in portal vein myocytes via activation of RYRs (33). We repeated these experiments on cells injected with specific anti-RYR antisense oligonucleotides in order to determine whether caffeine discriminates between RYR sub-


9602

FIG. 8. Effects of asRYRs antisense oligonucleotides on both amplitude (A) and maximal rate of rise (B) of caffeine-induced Ca2ⴙ responses. Caffeine was applied at 10 mM. Bars show means ⫾ S.E. in noninjected cells (open bars) and antisense oligonucleotideinjected cells (filled bars) with the number of cells tested indicated in parentheses. Cells were obtained from six different batches. 多, values significantly different from those obtained in noninjected cells. Myocytes were loaded with fluo 3-acetoxymethylester.

types. As shown in Figs. 7 and 8, injection of as1RYR1, as2RYR1, as1RYR2, or as2RYR2 alone partially inhibited but did not suppress the caffeine-induced Ca2⫹ responses. In contrast to what was observed with the depolarization-induced Ca2⫹ release, co-injection of both asRYR1 and asRYR2 had a greater effect and practically removed the caffeine-induced responses (Fig. 8). Moreover, as1RYR3 and as2RYR3 had no significant effects on the caffeine-induced Ca2⫹ release, and their co-injection with asRYR1 and asRYR2 did not further enhance the inhibition of the caffeine-induced responses (Fig. 1B) when compared with that obtained in cells injected with asRYR1⫹2 (Fig. 8A). Injection of scrambled RYR1 or RYR2 or both did not affect the caffeine-induced Ca2⫹ responses (not shown). As illustrated in Fig. 8, the caffeine-induced Ca2⫹ wave parameters (maximal amplitude and maximal rate of Ca2⫹ increase) were not affected by asRYR3, suggesting that this subtype did not contribute at all to the caffeine-induced Ca2⫹ response in physiological conditions. The Ca2⫹ responses obtained in asRYR1- or asRYR2-injected cells exhibited a decrease in both amplitude and maximal rate of Ca2⫹ increase (Fig. 8). These results suggest that caffeine is able to activate RYR1 or RYR2 independently from each other but that the full caffeine-induced Ca2⫹ response in 1.7 mM Ca2⫹-containing solution requires activation of both subtypes. DISCUSSION

Our results show that, in rat portal vein myocytes, the three known RYR subtypes are expressed and that both RYR1 and RYR2 subtypes are required for Ca2⫹ release during Ca2⫹ sparks and global Ca2⫹ responses induced by activation of voltage-gated Ca2⫹ channels. Up to now, co-expression of the three RYR subtypes has been mainly observed in arterial and venous smooth muscle (Ref. 20; present study). Although RYR3 has been shown to be ubiquitously expressed (34), co-expression of both RYR1 and RYR2 has not been reported in other cell types. The most widely studied models of Ca2⫹ release channels are those of cardiac and skeletal cells expressing RYR

subtypes 2 and 3 and RYR subtypes 1 and 3, respectively. To study the role of each subtype of RYRs in vascular smooth muscle, we designed antisense oligonucleotides able to specifically inhibit the expression of each RYR subtype. As previously reported, appropriate controls are needed to demonstrate the efficiency of antisense oligonucleotides in living cells (35, 36). In the present study, this is demonstrated by evaluating the ability of antisense oligonucleotides to reduce the expression of the targeted mRNA by PCR and of the protein by BODIPY®labeled ryanodine staining of the cells. In addition, the use of antisense oligonucleotides requires checking the specificity of their effects. This latter point has been investigated in several aspects, by showing the following: (i) the specific inhibition of the targeted mRNA by one given antisense oligonucleotide and the lack of effect of the same antisense on the other mRNAs; (ii) the reproducibility of the effect of one antisense oligonucleotide by another antisense sequence targeting the same mRNA; (iii) the lack of effect of scrambled control oligonucleotides; and (iv) the reduction of RYR staining produced by each antisense oligonucleotide compared with the suppression of staining after injection of a mixture of oligonucleotides targeting the three RYR subtypes. Using this antisense strategy, we show, for the first time, that both RYR1 and RYR2 subtypes of ryanodine receptors are required for an efficient CICR in venous myocytes. This point is the main finding of our study and is supported by the fact that in asRYR1- or in asRYR2-injected cells, no CICR could be observed in response to activation of voltage-gated Ca2⫹ channels. This inhibition of CICR mechanism is not due to a sideeffect of antisense injection on Ca2⫹ channels, since neither the Ca2⫹ current densities nor the gating properties of the voltagegated Ca2⫹ channels are affected when compared with noninjected cells. A cross-inhibition of RYR2 mRNA expression by asRYR1 or vice versa can be discarded, since we show that mRNA expression is inhibited only by the corresponding asRYR and not by the others. Moreover, the effects of asRYR1 and asRYR2 are additive in inhibiting the caffeine-induced Ca2⫹ responses, suggesting that different mRNAs are targeted by these antisense oligonucleotides. Since all three RYR subtypes appear to be similarly expressed in portal vein myocytes, the effect of asRYR1 or asRYR2 cannot be related to a dramatic decrease of the total RYR protein. For control, we report that in the same cell batches, asRYR3 decreases the BODIPY®-ryanodine staining by the same extent as asRYR1 or asRYR2 without affecting the Ca2⫹ signals. Requirement of both subtypes RYR1 and RYR2 is observed for activation of Ca2⫹ sparks as well as global Ca2⫹ responses, suggesting that even the elementary Ca2⫹ events result from the activation of mixed Ca2⫹ release units, composed of two different channel-forming proteins. Although never demonstrated, it was generally believed that the smooth muscle CICR was mediated by RYR2, and it was referred as a cardiac-type CICR. We confirm that, in short term cultured vascular myocytes, the coupling between voltage-gated Ca2⫹ channels and RYRs requires a Ca2⫹ influx, but we show that the Ca2⫹ release depends on activation of both RYR1 and RYR2. Accordingly, previous data have reported that skeletal (RYR1) and cardiac (RYR2) ryanodine receptors can be activated by Ca2⫹ influx through voltage-gated Ca2⫹ channels without needing the specific skeletal voltage-sensor coupling (25). Transient knockout of RYR subtypes by antisense oligonucleotides reveals that the cellular distribution of RYRs strongly modulates the Ca2⫹ responses. As long as one of the two RYR1 or RYR2 subtypes is expressed, caffeine produces Ca2⫹ responses of reduced amplitude, whereas membrane depolarizations are ineffective in triggering any Ca2⫹ response on the

RYR1- and RYR2-dependent Ca2⫹ Events same cells. These results indicate that caffeine may activate isolated RYRs everywhere in the scanned line. In contrast, when the cells are stimulated by membrane depolarization or BayK 8644, the Ca2⫹ influx triggering Ca2⫹ sparks is certainly limited to some particular cytoplasmic areas that are in close association with sarcoplasmic reticulum membrane sites possessing RYR1/RYR2 mixed clusters. Consequently, when one RYR subtype is missing, the reduction in the density of RYR channels within the cluster may be large enough to inhibit the Ca2⫹ release unit, whereas caffeine may always activate the remaining RYRs. This proposal is in agreement with immunodetection of RYRs in the confocal sections of portal vein myocytes, showing that RYRs are distributed homogeneously in the sarcoplasmic reticulum with some spots of RYRs in areas corresponding to the cell periphery and to infoldings of the plasma membrane (37). Taken together, these results suggest that the RYR1 proteins co-localize with the RYR2 proteins to form functional Ca2⫹ release units. We propose different hypotheses concerning the respective roles of RYR1 and RYR2 within these Ca2⫹ release units. A first possibility would be that the clusters are composed of RYR1 and RYR2 homotetramers, which can similarly be activated by Ca2⫹. In agreement with the concept that functional RYRs exist as homotetramers (38), we report here existing, although decreased, global Ca2⫹ responses to caffeine when either RYR1 or RYR2 expression has been suppressed. A second possibility would be that RYR1 may be responsible for addressing of RYR2 clusters to the proper plasma membrane sites, since RYR1 has been shown to be tightly bridged to the plasma membrane through an associated protein network in skeletal myocytes (39). A third possibility would be that the Ca2⫹ release unit is reduced to a single Ca2⫹ release channel able to generate a Ca2⫹ spark. Under these conditions, in venous myocytes, this channel might be a heterotetramer made from RYR1 and RYR2 proteins. Although inositol 1,4,5-trisphosphate receptors have been suggested to be organized as homo- or heterotetramers (40, 41), only homotetramers have been reported for RYRs (38). As cellular approaches cannot help to resolve the exact composition of Ca2⫹ release units generating Ca2⫹ sparks, reconstitution experiments are needed to elucidate the contribution of each RYR subtype to CICR in vascular myocytes. Despite a clear inhibition of RYR3 mRNA and protein expression by asRYR3, these antisense oligonucleotides are ineffective in inhibiting Ca2⫹ signals. The lack of effect of asRYR3 on membrane depolarization- and caffeine-induced Ca2⫹ responses together with the complete inhibition of both responses by asRYR1⫹2 suggests that RYR3 is not activated by either Ca2⫹ or caffeine in 1.7 mM Ca2⫹-containing solution. Similarly, knockout mice lacking RYR3 retain the normal excitation-contraction coupling in skeletal muscle (42), although a reduced contractile response was observed (43). A recent study has reported that in adult mice myotubes, Ca2⫹ sparks arise from RYR1, whereas in embryonic muscle, RYR3 contributes together with RYR1 to the generation of larger Ca2⫹ sparks (44). However, RYR3 has been shown to be activated by a higher concentration of caffeine or in high Ca2⫹-containing solution (45, 46)2 and under more physiological conditions when cADPR is produced in T lymphocytes (47). Thus, we do not exclude a role for RYR3 in smooth muscle, but the basic stimulation of these cells by membrane depolarization or caffeine, in normal external Ca2⫹ concentration, does not involve the subtype 3 of RYR. In conclusion, our results show that the co-expression of RYR1 and RYR2 in vascular myocytes is of physiological and functional relevance, since both RYR subtypes are absolutely

required for effective Ca2⫹-induced Ca2⫹ release. This combination of Ca2⫹ release channels suggests that dysfunctions or mutations of RYR1 and RYR2 subtypes might affect vascular smooth muscle. Acknowledgment—We thank N. Biendon for secretarial assistance. REFERENCES 1. 2. 3. 4. 5.

6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36.

37. 38. 39. 40. 41. 42.

43. 44. 45. 46. 47.

2

F. Coussin, N. Macrez, and J. Mironneau, unpublished data.

9603

Berridge, M. J. (1993) Nature 365, 388 –389 Berridge, M. J. (1997) J. Physiol. (Lond.) 499, 291–306 Endo, M., Tanaka, M., and Ogawa, Y. (1970) Nature 228, 34 –36 Schneider, M. F., and Chandler, W. K. (1973) Nature 242, 244 –246 Marks, A. R., Tempst, P., Hwang, K. S., Taubman, M. B., Inui, M., Chadwick, C., Fleischer, S., and Nadal-Ginard, B. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8683– 8687 Rios, E., and Pizarro, G. (1991) Physiol. Rev. 71, 849 –908 Fabiato, A. (1985) J. Gen. Physiol. 85, 247–289 Nabauer, M., Callewaert, G., Cleemann, L., and Morad, M. (1989) Science 244, 800 – 803 Ganitkevich, V. Y., and Isenberg, G. (1995) J. Physiol. (Lond.) 484, 287–306 Kamishima, T., and McCarron, J. G. (1997) J. Physiol. (Lond.) 501, 497–508 Cheng, H., Lederer, W. J., and Cannell, M. B. (1993) Science 262, 740 –744 Nelson, M. T., Cheng, H., Rubart, M., Santana, L. F., Bonev, A. D., Knot, H. J., and Lederer, W. J. (1995) Science 270, 633– 637 Arnaudeau, S., Macrez-Lepreˆtre, N., and Mironneau, J. (1996) Biochem. Biophys. Res. Commun. 222, 809 – 815 Arnaudeau, S., Boittin, F-X., Macrez, N., Lavie, J-L., Mironneau, C., and Mironneau, J. (1997) Cell Calcium 22, 399 – 411 Cannell, M. B., Cheng, H., and Lederer, W. J. (1994) Biophys. J. 67, 1942–1956 Cannell, M. B., Cheng, H., and Lederer, W. J. (1995) Science 268, 1045–1050 Lipp, P., and Niggli, E. (1996) Prog. Biophys. Mol. Biol. 65, 265–296 Takeshima, H., Iino, M., Takekura, H., Nishi, M., Kun, J., Minowa, O., Takano, H., and Noda, T. (1994) Nature 369, 556 –559 Takeshima, H., Komazaki, S., Hirose, K., Nishi, M., Noda, T., and Iino, M. (1998) EMBO J. 17, 3309 –3316 Neylon, C. B., Richards, S. M., Larsen, M. A., Agrotis, A., and Bobik, A. (1995) Biochem. Biophys. Res. Commun. 215, 814 – 821 Sutko, J. L., and Airey, J. A. (1996) Physiol. Rev. 76, 1027–1071 Catterall, W. A. (1991) Cell 64, 871– 874 Bosse, E., Bottlender, R., Kleppisch, T., Hescheler, J., Welling, A., Hofmann, F., and Flockerzi, V. (1992) EMBO J. 11, 2033–2038 Takimoto, K., Li, D., Nerbonne, J. M., and Levitan, E. S. (1997) J. Mol. Cell. Cardiol. 29, 3035–3042 Tanabe, T., Mikami, A., Numa, S., and Beam, K. G. (1990) Nature 344, 451– 453 Macrez-Lepreˆtre, N., Kalkbrenner, F., Schultz, G., and Mironneau, J. (1997) J. Biol. Chem. 272, 5261–5268 Holz, G. G., Leech, C. A., Heller, R. S., Castonguay, M., and Habener, J. F. (1999) J. Biol. Chem. 274, 14147–14156 Zhang, J. J., Williams, A. J., and Sitsapesan, R. (1999) Br. J. Pharmacol. 126, 1066 –1074 Zhang, X., Wen, J., Bidasee, K. R., Besch, H. R., Jr., and Rubin, R. P. (1997) Am. J. Physiol. 273, C1306 –C1314 Satoh, H., Hayashi, H., Blatter, L. A., and Bers, D. M. (1997) Heart Vessels 12, 58 – 61 Macrez-Lepreˆtre, N., Morel, J-L., and Mironneau, J. (1996) J. Pharmacol. Exp. Ther. 278, 468 – 475 Morel, J-L., Macrez-Lepreˆtre, N., and Mironneau, J. (1996) Br. J. Pharmacol. 118, 73–78 Mironneau, J., Arnaudeau, S., Macrez-Lepreˆtre, N., and Boittin, F-X. (1996) Cell Calcium 20, 153–160 Giannini, G., Conti, A., Mammarella, S., Scrobogna, M., and Sorrentino, V. (1995) J. Cell Biol. 128, 893–904 Bennett, C. F., Condon, T. P., Grimm, S., Chan, H., and Chiang, M. Y. (1994) J. Immunol. 152, 3530 –3540 McGraw, K., McKay, R., Miraglia, L., Boggs, R. T., Pribble, J. P., Muller, M., Geiger, T., Fabbro, D., and Dean, N. M. (1997) Anticancer Drug Des. 12, 315–326 Boittin, F-X., Macrez, N., Halet, G., and Mironneau J. (1999) Am. J. Physiol. 277, C139 –C151 Lai, F. A., Misra, M., Xu, L., Smith, H. A., and Meissner, G. (1989) J. Biol. Chem. 264, 16776 –16785 Franzini-Armstrong, C., and Protasi, F. (1997) Physiol. Rev. 77, 699 –729 Joseph, S. K., Lin, C., Pierson, S., Thomas, A. P., and Maranto, A. R. (1995) J. Biol. Chem. 270, 23310 –23316 Wojcikiewicz, R. J., and He, Y. (1995) Biochem. Biophys. Res. Commun. 213, 334 –341 Takeshima, H., Ikemoto, T., Nishi, M., Nishiyama, N., Shimuta, M., Sugitani, Y., Kuno, J., Saito, I., Saito, H., Endo, M., Iino, M., and Noda, T. (1996) J. Biol. Chem. 271, 19649 –19652 Bertocchinni, F., Ovitt, C. E., Conti, A., Barone, V., Scholer, H. R., Bottinelli, R., Reggiani, C., and Sorrentino, V. (1997) EMBO J. 16, 6956 – 6963 Conklin, M. W., Barone, V., Sorrentino, V., and Coronado, R. (1999) Biophys. J. 77, 1394 –13403 Takeshima, H., Yamazawa, T., Ikemoto, T., Takekura, H., Nishi, M., Noda, T., and Iino, M. (1995) EMBO J. 14, 2999 –3006 Sonnleitner, A., Conti, A., Bertocchini, F., Schindler, H., and Sorrentino, V. (1998) EMBO J. 17, 2790 –2798 Guse, A. H., da Silva, C. P., Berg, I., Skapenko, A. L., Weber, K., Heyer, P., Hohenegger, M., Ashamu, G. A., Schulze-Koops, H., Potter, B. V., and Mayr, G. W. (1999) Nature 398, 70 –73