Induced Expression of Murine TLR9 Gene - CiteSeerX

The Journal of Immunology

A Distal Regulatory Region Is Required for Constitutive and IFN-␤-Induced Expression of Murine TLR9 Gene Zhu Guo,* Sanjay Garg,* Karen M. Hill,* Lakshmi Jayashankar,* Myesha R. Mooney,† Mary Hoelscher,* Jacqueline M. Katz,* Jeremy M. Boss,† and Suryaprakash Sambhara1* TLR9 is critical for the recognition of unmethylated CpG DNA in innate immunity. Accumulating evidence suggests distinct patterns of TLR9 expression in various types of cells. However, the molecular mechanism of TLR9 expression has received little attention. In the present study, we demonstrate that transcription of murine TLR9 is induced by IFN-␤ in peritoneal macrophages and a murine macrophage cell line RAW264.7. TLR9 is regulated through two cis-acting regions, a distal regulatory region (DRR) and a proximal promoter region (PPR), which are separated by ⬃2.3 kbp of DNA. Two IFN-stimulated response element/IFN regulatory factor-element (ISRE/IRF-E) sites, ISRE/IRF-E1 and ISRE/IRF-E2, at the DRR and one AP-1 site at the PPR are required for constitutive expression of TLR9, while only the ISRE/IRF-E1 motif is essential for IFN-␤ induction. In vivo genomic footprint assays revealed constitutive factor occupancy at the DRR and the PPR and an IFN-␤-induced occupancy only at the DRR. IRF-2 constitutively binds to the two ISRE/IRF-E sites at the DRR, while IRF-1 and STAT1 are induced to bind to the two ISRE/IRF-E sites and the ISRE/IRF-E1, respectively, only after IFN-␤ treatment. AP-1 subunits, c-Jun and c-Fos, were responsible for the constitutive occupancy at the proximal region. Induction of TLR9 by IFN-␤ was absent in STAT1ⴚ/ⴚ macrophages, while the level of TLR9 induction was decreased in IRF-1ⴚ/ⴚ cells. This study illustrates the crucial roles for AP-1, IRF-1, IRF-2, and STAT1 in the regulation of murine TLR9 expression. The Journal of Immunology, 2005, 175: 7407–7418.

T

oll-like receptors are key components of innate immune system that detect invading pathogens and initiate host defense responses (1, 2). Upon recognition of conserved pathogen-associated molecular patterns that are unique to microorganisms, TLRs activate signaling pathways that lead to the secretion of proinflammatory cytokines and chemokines, secretion of antibacterial peptides, initiation of an inflammatory response, and an optimal priming environment for adaptive immune responses to infection or potentially vaccination (3). Of the identified TLRs in human and mouse, TLR9 is considered to be critical in recognition of unmethylated CpG DNA, a common feature that is found in bacterial DNA (4, 5). Bacterial DNA and CpG oligodeoxynucleotides (ODNs)2, the synthetic ligands for TLR9, activate APCs and T cells (6, 7) and stimulate proliferation of B cells, as well as Ab production (8, 9). CpG ODNs also selectively induce Th1-biased responses even in the presence of a strong Th2 adjuvant such as alum and are used as a potent adjuvant in many model systems (10). Ligation of TLR9 triggers the myeloid differentiation factor 88 (MyD88)-dependent signaling pathway that is shared by other

*Influenza Branch, Division of Viral and Rickettssial Diseases, Centers for Disease Control and Prevention, Atlanta, GA 30333; and †Department of Microbiology and Immunology, Emory University, Atlanta, GA 30322 Received for publication February 9, 2005. Accepted for publication September 12, 2005. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1

Address correspondence and reprint requests to Dr. Suryaprakash Sambhara, Centers for Disease Control and Prevention, 1600 Clifton Road, MS: G16, Atlanta, GA 30333. E-mail address: [email protected]

2 Abbreviations used in this paper: ODN, oligodeoxynucleotide; DC, dendritic cell; pDC, plasmacytoid DC; hTLR9, human TLR9; IRF, IFN regulatory factor; ISRE, IFN-stimulated response element; mTLR9, murine TLR9; DRR, distal regulatory region; PPR, proximal promoter region; RLM, RNA ligase mediated; CAT, chloramphenicol acetyltransferase; IVGF, in vivo genomic footprint; DMS, dimethyl sulfate; siRNA, short interference RNA; GAS, ␥-IFN activation sequence; ISGF3, IFN-stimulated gene factor 3.

Copyright © 2005 by The American Association of Immunologists, Inc.

members of the TLR family (11, 12). This pathway culminates in the activation of NF-␬B, as well as the MAPKs ERK, p38, and JNK (13). Studies of various types of cells have revealed distinct expression patterns of TLR9. Murine splenic dendritic cell (DC) subtypes and bone marrow-derived DCs express similar levels of TLR9 mRNA (14, 15), while LPS induces TLR9 expression in immature DCs (16). Splenic macrophages, as well as activated peritoneal macrophages, express TLR9, which, along with other TLRs, are down-regulated with aging (17). Microglia in the CNS express TLR9 and initiate innate immune responses to CpG ODNs (18), while expression of TLR9 in B cells is indicated by the immunomodulatory effects of CpG ODNs (19). In humans, TLR9 is predominantly expressed in plasmacytoid DCs (pDCs) (20 –22), although B cells also express marked levels of TLR9 and directly respond to stimulation by CpG ODNs (23, 24). Monocytes, NK cells, and T cells express low levels of TLR9 and fail to respond to CpG ODNs (Ref. 20; M. Hoelscher, unpublished observations). Limiting data are available on the regulation of TLR genes. So far, only the promoter regions for TLR2, TLR3, and TLR4 of human and mouse and human TLR9 (hTLR9) have been defined, and diverse mechanisms that regulate these TLRs have been described previously (25). For instance, expression of TLR2 in murine macrophages is up-regulated by LPS, peptidoglycan, mycobacterial products, and various cytokines, including TNF-␣ (26 – 29). An NF-␬B binding site upstream of TLR2 gene is required for TNF induction. TLR3 is induced by type I IFN in murine macrophages, and STAT1 and IFN regulatory factor (IRF)-1 mediate the up-regulation through binding to an IFN-stimulated response element (ISRE) site located at the proximal promoter of TLR3 (30). Murine TLR4 mRNA is expressed differentially in various types of tissues with its strongest presence in the lung, heart, and spleen (31). Cellular stimulation with TLR4 ligand LPS down-regulates expression of TLR4 in murine macrophages (32, 33), an observation that might be related to changes in mRNA stability of TLR4 (34). 0022-1767/05/$02.00

7408 Although the interaction between TLR9, its ligand, and the downstream TLR9-mediated signaling pathway have been well studied, the regulation mechanism of TLR9 transcription remains largely unknown. Recently, the 5⬘ region of hTLR9 gene was cloned and characterized (35). Four cis-acting elements— cAMP response element, 5⬘-PU box, 3⬘-PU box, and a c/EBP site—were found to be required for optimal transcription of hTLR9, and decreased binding of transcription factors to these elements were observed in CpG ODN-mediated suppression of hTLR9. To understand transcriptional regulation of murine TLR9 (mTLR9), we cloned and analyzed the 5⬘ flanking region of the mTLR9 gene. We demonstrated that constitutive expression of mTLR9 requires two cis-acting elements, a distal regulatory region (DRR) and a proximal promoter region (PPR), that are separated by ⬃2.3 kbp of DNA. Furthermore, two ISRE/IRF-Es and one AP-1 site were found to be located within the DRR and the PPR, respectively. Constitutive expression of TLR9 required the two ISRE/IRF-E and the AP-1 sites and induction of TLR9 by IFN-␤ involved the ISRE/IRF-E1 site in the distal region. In addition, we also showed the essential roles of AP-1, IRF-1, IRF-2, and STAT1 in transcriptional regulation of the mTLR9 gene. Thus, in comparison to hTLR9, this study demonstrates that TLR orthologues are regulated in species-specific manner. The data also establish a key regulatory role of IFN-␤ in enhancing the ability of macrophages to respond to infections.

Materials and Methods Cell lines and thioglycollate-elicited peritoneal macrophages The murine macrophage-like cell line RAW264.7 was obtained from American Type Culture Collection, and cells were grown in DMEM (Invitrogen Life Technologies) supplemented with 10% FBS (HyClone), 100 U/ml penicillin, and 100 ␮g/ml streptomycin. Female BALB/c mice were purchased from Harlan Sprague Dawley. Female C57BL/6J wild-type and IRF-1⫺/⫺ mice were purchased from The Jackson Laboratory. Female 129S6 wild-type and STAT1⫺/⫺ mice were purchased from Taconic Farms. All of the mice used were 2–3 mo old and were maintained in an environmentally controlled facility. Thioglycollate-elicited peritoneal macrophages were isolated as described previously (17).

TLR ligands and cytokines LPS (Escherichia coli, O26:B6), poly(I:C), IFN-␤, and IFN-␥ were purchased from Sigma-Aldrich. Cells were treated with LPS, poly(I:C), IFN-␤, IFN-␥, or CpG ODNs at final concentrations of 100 ng/ml, 100 ␮g/ml, 100 U/ml, 100 U/ml, or 10 ␮g/ml, respectively.

Real-time RT-PCR Total RNA was isolated from cells using the RNAeasy kit (Qiagen). For each sample, 1 ␮g of total RNA was reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen Life Technologies) according to the manufacturer’s directions. The RT reaction was diluted 1/10, and 2 ␮l of the diluted sample was added to an 18-␮l PCR assay mixture containing 0.5 ␮M of each primer and 1⫻ SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich). PCR was conducted in a Mx3000P real-time PCR system (Stratagene) with a hot start activation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 61°C for 30 s, and 72°C for 30 s. Two sets of PCR assays were performed for each sample using the following primers specific for cDNA of TLR9 and GAPDH: TLR9 forward, 5⬘-ACTGAGCAC CCCTGCTTCTA-3⬘, and TLR9 reverse, 5⬘-AGATTAGTCAGCGGCAG GAA-3⬘; and GAPDH forward, 5⬘-CTCATGACCACAGTCCATGC-3⬘, and GAPDH reverse, 5⬘-CACATTGGGGGTAGGAACAC-3⬘. The threshold cycle number for TLR9 was normalized to that of GAPDH cDNA, and the resulting value was converted to a linear scale. Unless otherwise specified, all assays were performed at least three times from independent RNA preparations.

Cloning of the 5⬘ flanking region of TLR9 and sequence analysis Two methods, chromosome walking and direct PCR amplification, were used to clone the 5⬘ flanking region of TLR9. GenomeWalker kits from BD Biosciences was used according to the manufacturer’s directions, and two TLR9-specific primers were used in the assay: GSP1, 5⬘-GTTG

IFN-␤-MEDIATED INDUCTION OF MURINE TLR9 GACAGGTGGACGAAGTCAGAGT-3⬘ and GSP2, 5⬘-GGATACGGTT GGAGATCAAGGAGAGG-3⬘. For direct PCR amplification, the following primers were designed and used based on the sequence of mouse chromosome 9 genomic contig from GenBank: 5⬘TLR9-1, 5⬘-ATACGCG TAGGTGGATAGGCAGGTTGTG-3⬘, 3⬘TLR9-2, 5⬘-ATCTCGAGGTT GGACAGGTGGACGAAGT-3⬘, and 3⬘TLR9-3, 5⬘-ATCTCGAGGACG GAGAACCTGTGAGAGC-3⬘. Genomic DNA from spleen of BALB/c mice was purified by standard protocol and applied as template in a 100 ␮l of PCR assay containing 100 ng of genomic DNA, 200 ␮M dNTP, 0.25 ␮M of each primer, 1⫻ reaction buffer, and 5 U of Herculase Hotstart DNA polymerase (Stratagene). PCR was performed for a total of 30 cycles with denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 4.5 min. The amplified PCR products were cloned using Zero Blunt TOPO PCR cloning kit from Invitrogen Life Technologies and sequenced using BigDye Terminator version 3.1 cycle sequencing kit and a 3100 genetic analyzer from Applied Biosystems. The sequencing results were analyzed by promoter analysis software from Genomatix for transcription factor binding sites and transcription start site.

5⬘ RACE-PCR 5⬘ RACE-PCR was performed to determine the 5⬘ end of TLR9 mRNA using FirstChoice RNA ligase-mediated (RLM)-RACE kit from Ambion. Five TLR9-specific primers were separately used to amplify the cDNA ends: RACE1, 5⬘-ACAAGGGGTGCAGAGTCCTT-3⬘, RACE2, 5⬘-CAT GTTGGGAGATGGAGGATTCT-3⬘, RACE3, 5⬘-AGGCTTCAGCTCA CAGGGTAG-3⬘, RACE4, 5⬘-CTGTACCAGGAGGGACAAGG-3⬘, and RACE5, 5⬘-ATCTCGAGTCTCCCGAGGCTCCCTCT-3⬘. The amplified products were cloned and sequenced as described above.

Plasmid construction For constructs used in Fig. 3, A and B, the 5⬘ flanking regions of TLR9 with different lengths were PCR amplified and cloned into pCAT3-Basic vector through MluI and XhoI sites. For constructs used in Fig. 3C, except for pTLR9(⌬⫺20163⫺565), the 5⬘ flanking region was PCR amplified and cloned into pTLR9(⫺643929) through the MluI site. pTLR9 (⌬⫺20163⫺565) was made by inserting PCR-amplified product into pTLR9(⫺5643929) through MluI site. For constructs used in Fig. 4, sitedirected mutagenesis was performed by overlap PCR and the PCR products were cloned into pCAT3-Basic vector through MluI and XhoI sites. Genomic DNA from spleens of BALB/c mice was used as template, and the PCR primers for each construct are listed in Table I. All constructs were verified by DNA sequencing and prepared using EndoFree plasmid maxiprep kit from Qiagen.

Transient transfection assays Transient transfections were conducted using FuGENE 6 transfection reagent from Roche, and protocols from manufacturer were followed. Briefly, for each sample 1 ⫻ 106 RAW264.7 cells were seeded into 1 well of a 6-well plate 24 h before transfection. In each transfection, 1 ␮g of reporter construct DNA and 0.5 ␮g of alkaline phosphatase-expression plasmid DNA were mixed with diluted FuGENE 6 reagent. The mixture was added into cell cultures and incubated for 36 h. For IFN-␤-treated samples, IFN-␤ was added 24 h posttransfection, and the culture continued to be incubated for another 12 h. The cells were harvested and analyzed by chloramphenicol acetyltransferase (CAT) ELISA using kits from Roche. The CAT data from at least three independent experiments were normalized by transfection efficiency as determined by alkaline phosphatase activities, averaged, and plotted as OD with the SD from the mean.

In vivo genomic footprint (IVGF) IVGF was performed as previously described (36, 37) with minor modifications. Briefly, RAW264.7 cells treated with or without IFN-␤ were exposed to dimethyl sulfate (DMS) for 1 min to methylate DNA in vivo. Genomic DNA was isolated from DMS-treated cells, and strand scission was conducted by adding 10% piperidine into DNA followed by incubation at 90°C for 30 min. The digested DNA was purified by evaporation in speed vacuum and ethanol-precipitation, and for each sample, 3 ␮g of cleaned DNA was applied in primer extension using primer 1. The extended product was ligated to a common linker by incubation at 16°C for overnight using T4 DNA ligase. The ligated DNA was purified and applied in PCR containing primer 2 and the longer linker primer. Finally, the PCRamplified product was labeled by primer extension using 32P-end-labeled primer 3, precipitated and resuspended in loading buffer. The samples were electrophoresed on a denaturing polyacrylamide gel and analyzed by autoradiography. The top strand of the PRR was analyzed with the following primer set: primer 1, 5⬘-GCTAAGAACTGGGGTCCTACCAT-3⬘; primer

The Journal of Immunology

7409

Table I. Primers for making TLR9 CAT-reporter constructs Constructs

pTLR9(⫺2569⬃929) pTLR9(⫺2048⬃929) pTLR9(⫺1533⬃929) pTLR9(⫺1056⬃929) pTLR9(⫺564⬃929) pTLR9(⫺64⬃929) pTLR9(413⬃929) pTLR9(⫺2569⬃71) pTLR9(⫺2452⬃71) pTLR9(⫺2365⬃71) pTLR9(⫺2253⬃71) pTLR9(⫺2126⬃71) pTLR9(D⫺2016⬃⫺65) pTLR9(D⫺1504⬃⫺65) pTLR9(D⫺977⬃⫺65) pTLR9(D⫺508⬃⫺65) pTLR9(D⫺2016⬃⫺565) pTLR9mlSRE/IRF-E1b pTLR9mlSRE/IRF-E2 pTLR9mGAS1 pTLR9mGAS2 pTLR9mGC pTLR9mAP-1

Sequences (5⬘ 3 3⬘)

Primers a

F Ra F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R F R

ATACGCGTAGGTGGATAGGCAGGTTGTG ATCTCGAGGACGGAGAACCTGTGAGAGC ATACGCGTTGGATTTCAGCCCAGTGTAA ATCTCGAGGACGGAGAACCTGTGAGAGC ATACGCGTCCTGCCAAGTACTCCCTGAC ATCTCGAGGACGGAGAACCTGTGAGAGC ATACGCGTTGCAATTGGTCCTCCCTAAG ATCTCGAGGACGGAGAACCTGTGAGAGC ATACGCGTGCAGCCTACCTCAGAAGCTC ATCTCGAGGACGGAGAACCTGTGAGAGC ATACGCGTCCACCTGCTCTTTCAGGGTA ATCTCGAGGACGGAGAACCTGTGAGAGC ATACGCGTAGCCTAGATGGAACCCAACC ATCTCGAGGACGGAGAACCTGTGAGAGC ATACGCGTAGGTGGATAGGCAGGTTGTG ATCTCGAGTCTCCCGAGGCTCCCTCT ATACGCGTCCAAAGGAGAAGGTGACAGC ATCTCGAGTCTCCCGAGGCTCCCTCT ATACGCGTCAGGGAAGTGAACCCCATAA ATCTCGAGTCTCCCGAGGCTCCCTCT ATACGCGTAAGGCAGAGGATGGCAGAT ATCTCGAGTCTCCCGAGGCTCCCTCT ATACGCGTTGAAAACCAGGTGCAGATTG ATCTCGAGTCTCCCGAGGCTCCCTCT ATACGCGTAGGTGGATAGGCAGGTTGTG ATACGCGTCCCACCCCCAAATTATACTG ATACGCGTAGGTGGATAGGCAGGTTGTG ATACGCGTGTGGTGGGAGTCAGGGAGTA ATACGCGTAGGTGGATAGGCAGGTTGTG ATACGCGTCTCTGTGCACCTCCCTTTGT ATACGCGTAGGTGGATAGGCAGGTTGTG ATACGCGTGTCAGACTCCAGACCCCAGA ATACGCGTAGGTGGATAGGCAGGTTGTG ATACGCGTCCCACCCCCAAATTATACTG GAAACAAAACTGCGTACCAGCGGCCATAAAGAAAC TGGCCGCTGGTACGCAGTTTTGTTTCTTTATGGGGTTC GAAACAAAAATGCGTACCAGTGGCTGGGCATGTG CAGCCACTGGTACGCATTTTTGTTTCTTTATGGCCG CGTATCGGTCGGTGGAGATGCAGAGTGGGA TCTCCACCGACCGATACGCCCAGTCAGACTCCA ACTATAGCTGTCGGAGATGTGAAGGCTGCCGT ATCTCCGACAGCTATAGTATCTCCCACTCTGCATC ATTGTGCATGTAGGAGGAGAGTGGAAAGAGG TCCTCCTACATGCACAATCAGCCAAAGGGTAT GATGTGGATCGCATTGTACCACCTGCTCTTTC TACAATGCGATCCACATCATTTGCATAGTCAGAT

a

F, forward primer; R, reverse primer. For site-directed mutants, only internal primers are listed. The external primers are the same as that used for pTLR9(⫺2569⬃71). The underlined letters indicate mutated nucleotides. b

2, 5⬘-CCCGAGGCTCCCTCTGACAAACT-3⬘; and primer 3, 5⬘-CTCT GACAAACTGGGCGGCAGAGAATGATGT-3⬘. The bottom strand of the PRR was analyzed with the following primer set: primer 1, 5⬘-ATCT GGTTTCTCATTGACCTTGG-3⬘; primer 2, 5⬘-GGGTTTTGGTTCCTTC CCACAGC-3⬘; and primer 3, 5⬘-CCTTCCCACAGCTCTTTGGGGGG TGG-3⬘. The bottom strand of the DRR was analyzed with the following primer set: primer 1, 5⬘-GGCTTAATGTCTCTCCAGGGTCT-3⬘; primer 2, 5⬘-GCTCTAGTCACCAGGGCCAAAGG-3⬘; and primer 3, 5⬘CAGGGCCAAAGGAGAAGGTGACAGCCA-3⬘. No functional primer set was found to analyze the top strand of the DRR.

EMSA EMSA was performed as previously described (38) with 4 ␮g of nuclear extract from either untreated control or RAW264.7 cells treated with IFN-␤ for 2 h. The reaction buffer contained 15 mM HEPES (pH 7.9 at 4°C), 50 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 10 mM DTT, 5 ␮g of BSA, 6% glycerol, 0.025% of Nonidet P-40, 590 ng of poly(dI-dC)-poly(dI-dC), and 500 ng of salmon sperm DNA. EMSA probes were made by annealing complementary oligonucleotides and labeled using [␥32P]ATP and T4 DNA kinase. The top-strand sequences for the probes of ISRE/IRF-E1, ISRE/IRF-E2 and AP-1 sites are the following with the binding motifs

being underlined: ISRE/IRF-E1, 5⬘-AAAGAAACAAAACTGAAAAC CAGCGGCCAT-3⬘; ISRE/IRF-E2, 5⬘-AAAGAAACAAAAATGAAAAC CAGTGGCTGG-3⬘; and AP-1, 5⬘-CAAATGATGTGTGACTCATTGTA CCACCTG-3⬘. Unlabeled DNA described above was used as specific competitors in their own EMSAs, and unlabeled ISRE/IRF-E1 and AP-1 DNA was used as nonspecific competitors for EMSAs of AP-1 and ISRE/ IRF-E1, respectively. In addition, unlabeled dsDNA from Santa Cruz Biotechnology containing consensus IRF-1 site (sc-2575) or mutated IRF-1 site (sc-2576) was also used as competitor DNA. Unless otherwise specified, 80 ng of competitor DNA was added into each competitive binding reaction. Polyclonal Abs against STAT1 (sc-592), IRF-1 (sc-640), IRF-2 (sc-498), IRF-3 (sc-9082), IRF-7 (sc-9083), c-Jun (sc-45), and c-Fos (sc52) were purchased from Santa Cruz Biotechnology, and polyclonal Ab for STAT2 (07-140) was purchased from Upstate. One microgram of Ab was used in each supershift assay.

Short interference RNA (siRNA) assay Transfection of siRNAs targeting GAPDH, c-Jun, or IRF-2 was performed using TransIT-TKO from Mirus with a final concentration of siRNA of 100 nM according to manufacturer’s instructions. The siRNAs targeting c-Jun

7410 or IRF-2 were purchased from Dharmacon. The scrambled negative control siRNA and the siRNA targeting GAPDH were obtained from Ambion.

Results Expression of murine TLR9 in macrophages is induced by IFN-␤ To understand regulation of TLR9 in response to extracellular stimuli, cells of murine macrophage-like cell line RAW264.7 were left untreated or treated with TLR ligands (LPS, CpG ODNs, and poly(I:C)) or cytokines (IFN-␤ and IFN-␥) for different lengths of time. Total RNA was collected from the control and treated cells and TLR9 transcript levels were analyzed by real-time RT-PCR. Of the stimuli tested, IFN-␤ induced the highest level of TLR9 expression (8-fold) that peaked after 4h of treatment (Fig. 1A). IFN-␥ induced TLR9 expression but to a much lower level (2.8fold). To confirm IFN-␤-mediated induction of TLR9 in primary macrophages, thioglycolate-elicited peritoneal macrophages were isolated and treated with LPS, CpG ODNs, or IFN-␤, followed by extraction of total RNA and real-time RT-PCR analysis of TLR9 mRNA. The results showed that IFN-␤ was a very potent inducer of TLR9 expression, although the induction level (5.9-fold) was slightly lower than that observed in RAW264.7 cells (Fig. 1B). Ligation of TLR3 or TLR4 with their cognate ligands, poly(I:C) and LPS, respectively, has been known to initiate a MyD88-independent signaling pathway that leads to induction of IFN-␤ (39 – 44). Interestingly, activation of RAW264.7 cells with poly(I:C) or LPS failed to induce expression of TLR9 even after 24 h of treatment. To exclude the possibility that RAW264.7 cells are insensitive to LPS, expression of TLR2, a LPS-inducible TLR, was examined by real-time RT-PCR. The results showed that TLR2 was induced by LPS and indicated functional response to LPS in RAW264.7 cells (Fig. 1C). Similarly, TLR2 was induced in thioglycolate-elicited peritoneal macrophages (Fig. 1D). Because LPSmediated induction of TLR2 requires activation of NF-␬B (26), the above results suggested that activation of NF-␬B alone was not sufficient to induce TLR9 expression in macrophages.

FIGURE 1. Expression of TLR9 is induced by IFN-␤. RAW264.7 cells (A and C) and peritoneal macrophages from BALB/c mice (B and D) were treated with various ligands or cytokines for different lengths of time as indicated. Total RNA was isolated, and real-time RT-PCR was performed to analyzed the expression of TLR9 (A and B) and TLR2 (C and D). The results are plotted as fold induction over untreated cells. The average of three independent experiments is shown with SD.

IFN-␤-MEDIATED INDUCTION OF MURINE TLR9 Cloning of the 5⬘ flanking region of murine TLR9 gene and determination of its transcription start site To further analyze the regulatory mechanism of TLR9 expression, the 5⬘ flanking region of murine TLR9 gene was cloned by two methods: chromosomal walking and direct PCR amplification. The largest cloned fragments were 1356 and 3728 bp by chromosomal walking and direct PCR, respectively, and both fragments were analyzed by DNA sequencing. Sequence alignment showed 99.8% homology between these two fragments (data not shown), and the sequence of direct PCR-amplified fragment is shown in Fig. 2A. In addition, alignment of the regions of 2660 bp upstream of the start codons of human and mouse TLR9 revealed 49.7% homology (data not shown). The transcription start site of TLR9 was determined by RLMRACE PCR using mRNA derived from IFN-␤-stimulated RAW264.7 cells. Sequence analysis of the 77 clones from RLMRACE PCR showed three major start sites for TLR9 transcription with locations mapped to nt 2570, 2598, and 2615 numbered from the 5⬘ end of the cloned TLR9 upstream (Fig. 2, A and B), indicating multiple transcription start sites within a range of ⬃75 bp. The occurrence of multiple transcription start sites is indicative of transcription from a TATA-less promoter that usually contains initiator element (45, 46). Indeed, examination of DNA sequence in the vicinity of TLR9 transcriptional start sites revealed no TATA box. However, an initiator element with the sequence of 5⬘TCACTTC-3⬘ was located 10 bp upstream of the most 5⬘ major transcription start site (Fig. 2A). This initiator is likely to be responsible for the transcriptional initiation, and thus nt 2570 is assigned as ⫹1 site for TLR9 transcription. Identification of cis-acting elements within the upstream region of murine TLR9 gene To identify the cis-acting elements required for TLR9 expression, PCR products generating 5⬘ deletions in the 3498-bp upstream of the TLR9 gene were cloned 5⬘ to the CAT gene (Fig. 3A). To analyze the activity of the TLR9/CAT reporters, the constructs

The Journal of Immunology

7411

FIGURE 2. Structure and sequence of the mTLR9 promoter. A, The nucleotide sequence is numbered from the 5⬘ end of the cloned fragment of 3728 bp. The deduced amino acid sequence is shown above the exons. The underlined sequences indicate sites similar to the consensus factor binding sites denoted above the sequence. The dark bent arrows represent the positions of major transcription start sites (TSS). The size of the arrows correlates with the number of fragments obtained for each TSS.  indicates the 5⬘ ends of the published full-length cDNA with their respective GenBank accession number being denoted. The potential initiator (Inr) element is indicated by dots below the sequence. B, The number of cloned 5⬘ cDNA end of TLR9 for each TSS is indicated by y-axis, and the position of each TSS is indicated by nucleotide location numbered from the 5⬘ end of the 3728-bp fragment at x-axis. The percentage of cloned 5⬘ cDNA end for each TSS is denoted above the corresponding column.

were transiently transfected into RAW264.7 cells, treated with IFN-␤ or left untreated and assayed by ELISA for CAT protein (Fig. 3A). Of the tested constructs, the construct pTLR9(⫺25693929) containing 3498 bp of TLR9 DNA expressed high constitutive levels of CAT protein and exhibited induction (2-fold) when the cells were treated with IFN-␤. Deletion of the 5⬘ end of TLR9 upstream from ⫺2569 to ⫺2049 greatly reduced CAT expression from pTLR9(⫺20483929) in control and IFN-␤-treated cells, indicating the existence of a critical cis-acting element within the deleted region that was essential for basal as well as inducible expression of TLR9. Further deletion of 1.5 kbp at the 5⬘ end of TLR9 upstream caused slightly enhanced levels of CAT expression from pTLR9(⫺15333929), pTLR9 (⫺10563929) and pTLR9(⫺5643929), although the expression levels were incomparable to that from pTLR9(⫺25693929), the

full-length construct. Deletion of the 5⬘ flanking region of TLR9 from ⫺564 to ⫺65 completely abolished CAT expression from pTLR9 (⫺643929) and pTLR9(4133929), implying proximal promoter function of this region. To further delineate the cis-acting element at the 5⬘ end of the TLR9 upstream region, a series of small deletion mutants spanning the 5⬘ end of the TLR9 upstream from ⫺2569 to ⫺2126 were generated (Fig. 3B). Except for pTLR9(⫺2253371) and pTLR9(⫺2126371), the other three constructs shown in Fig. 3B were able to express high levels of CAT protein and respond to IFN-␤ by a 2- to 3-fold increase in CAT expression. The two constructs that failed to be induced by IFN-␤ contained a deletion from ⫺2365 to ⫺2254, which we will therefore refer to as the DRR of the TLR9 gene.

7412

IFN-␤-MEDIATED INDUCTION OF MURINE TLR9

FIGURE 3. Identification of a DRR and a PRR required for basal and IFN␤induced expression of TLR9. A and B, PCR products from the 5⬘ flanking region of the TLR9 gene were cloned into MluI and XhoI sites 3⬘ to the CAT reporter gene of pCAT3-Basic vector and labeled pTLR9 (⽧3⽧), where the “⽧” indicates the 5⬘ and 3⬘ ends of each fragment. C, A series of CAT-reporter vectors of TLR9 upstream with internal deletions were constructed as described under Materials and Methods. The construct labeled with pTLR9(⌬F3F) represents a CAT-reporter construct of TLR9 that contains an internal deletion with the start and end positions indicated by the “F”. The above constructs were transiently transfected into RAW264.7 cells and treated with IFN␤ or left untreated as indicated. Lysate from the transfected cells was analyzed by CAT ELISA, and the data from at least three independent experiments are averaged and plotted as OD with SD. Regions important for TLR9/ CAT expression are indicated by the vertical gray boxes. ⴱ indicates p ⬍ 0.05 and ⴱⴱ indicates p ⬍ 0.005 when the values of the IFN-␤-treated samples are compared with that of the corresponding controls.

To understand whether the TLR9 DRR is required to drive basal expression of TLR9, a series of internal deletion mutants spanning the TLR9 upstream from ⫺2016 to ⫺65 were constructed (Fig. 3C). One of the mutant constructs, pTLR9(⌬320163⫺65), expressed higher-than-background level of CAT protein and exhibited a small induction (1.8-fold) response to IFN-␤ treatment when compared with pTLR9(⫺643929). The result indicated that the upstream region from ⫺2569 to ⫺2017 alone is insufficient for optimal expression from the 5⬘ flanking region of TLR9. Smaller internal deletions within the TLR9 upstream region failed to enhance expression of the reporter (pTLR9(⌬⫺15043⫺65), pTLR9(⌬⫺9773⫺65) and pTLR9(⌬⫺5083⫺65)). However, the deletion mutant pTLR9(⌬⫺20163⫺565) exhibited enhanced basal expression of CAT protein and no induction response to IFN-␤ treatment. In comparison to other internal deletion mutants, the TLR9 upstream sequence in pTLR9(⌬⫺20163⫺565) retained the region from ⫺564 to ⫺65, suggesting an activation function of this 500-bp region, which was absent from pTLR9(⫺643929) (Fig. 3A). Therefore, this region will be referred to as the PPR of

the TLR9 gene. Therefore, the PPR together with the DRR are required to drive the basal expression of TLR9. It should be noted that the induction fold of TLR9 expression by IFN-␤ was lower in reporter assay (2- to 3-fold) compared with that in real time RTPCR analysis (8-fold; Fig. 1), indicating that chromatin structure which native TLR9 gene is assembled into may play a role in modulating TLR9 induction by IFN-␤. Sequence analysis of the DRR and the PPR of the TLR9 gene revealed several putative regulatory motifs, including two ISRE/ IRF-E sites, ISRE/IRF-E1 (⫺2341 to ⫺2322) and ISRE/IRF-E2 (⫺2311 to ⫺2293) in the DRR; two ␥-IFN activation sequence (GAS) sites, GAS1 (⫺507 to ⫺489) and GAS2 (⫺472 to ⫺454), one Sp1 site (⫺155 to ⫺141), and one AP-1 site (⫺78 to ⫺68) in the PPR. To confirm the role of each putative transcription factor binding site in TLR9 transcription, mutations were introduced into the above sites and the resultant promoter activity was examined by CAT assays (Fig. 4). Mutation at ISRE/IRF-E1 caused the strongest reduction in CAT expression and no response to IFN-␤treatment from pTLR9mISRE/IRF-E1. Mutations at ISRE/IRF-E2

The Journal of Immunology

7413

FIGURE 4. Identification of two ISRE/IRF-E sites required for basal and IFN-␤-induced expression, and one AP-1 site for basal expression of TLR9. CAT-reporter constructs of the TLR9 gene with site-directed mutations were constructed and analyzed as described in Fig. 3 legend. Crossed-out boxes indicate mutations in the putative motifs. The data from three independent experiments are averaged and plotted with SD. ⴱ indicates p ⬍ 0.05 and ⴱⴱ indicates p ⬍ 0.005 when the values of the control and IFN-␤-treated samples are compared.

and AP-1 greatly impaired promoter activity from pTLR9mISRE/ IRF-E2 and pTLR9mAP-1, while their response to IFN-␤ remained intact. In contrast, CAT expression from pTLR9mGAS1, pTLR9mGAS2, and pTLR9mGAS1/2 was similar to that from the wild-type construct pTLR9(⫺2569371), and the mutation at the Sp1 site (the GC box) enhanced basal promoter activity from pTLR9mGC. The above results suggested that ISRE/IRF-E1, ISRE/IRF-E2 together with AP-1 were required for basal level of TLR9 expression, and TLR9 induction by IFN-␤ might be mainly mediated through the ISRE/IRF-E1 motif.

Examination of in vivo occupancy of transcription factors at the PPR and the DRR of TLR9 upstream To accurately identify the sequence and the potential transcription factors involved in IFN␤ regulation of TLR9, IVGF was performed on the PPR and the DRR using RAW264.7 cells treated with or without IFN-␤. When compared with the in vitro methylated DNA control, the PPR showed constitutive in vivo protection from DMS methylation at guanines corresponding to AP-1 site (Fig. 5, A and B, and summarized in Fig. 6), including guanines at

FIGURE 5. Constitutive occupancies at the AP-1 and the two ISRE/IRF-E sites are revealed by IVGF. Autoradiographs of IVGF conducted on the AP-1 and the two ISRE/IRF-E sites are shown. RAW264.7 cells were treated with IFN-␤ for the indicated lengths of time or left untreated, followed with DMS. DNA was prepared and IVGF was conducted as described in Materials and Methods. A, Top strand of the AP-1 site; B, bottom strand of the AP-1 site; C, bottom strand of the two ISRE/IRF-E sites. In vitro methylated DNA controls are shown in lane V. Putative regulatory motifs and the transcription start site are indicated. Open and solid circles indicate bases exhibiting constitutive protection or hypersensitivity, respectively. Open triangles signify bases exhibiting IFN-␤-induced protection. The numbers beside circles and triangles indicate the locations of corresponding nucleotides relative to the transcription start site (⫹1). The results are representatives of at least three independent experiments.

7414

IFN-␤-MEDIATED INDUCTION OF MURINE TLR9 (G-9, G-7, G-4, G-1 and G ⫹ 7) might indicate formation of transcription initiation complex at that region. IVGF analysis of the DRR displayed hypersensitivity to DMS at the two ISRE/IRF-E sites, including guanines in ISRE/IRF-E1 (G2340, G-2328, and G-2327) and ISRE/IRF-E2 (G-2297). This indicated constitutive factor occupancy that might be required for regulation of TLR9 basal transcription by these two elements. IFN␤-induced occupancy at the DRR was indicated by adenosine at nt ⫺2357 that became hyposensitive after treatment with IFN-␤ for 60 min, compared with the in vivo control without IFN-␤ treatment. Thus, the IVGF data support the CAT fusion reporter data by identifying numerous sites of constitutive protein occupancy within the PPR and the DRR, and one site of IFN-␤-induced occupancy within the DRR.

FIGURE 6. Summary of the IVGF data from the ISRE/IRF-E sites (A) and the AP-1 site (B). The positions of the bases are indicated relative to the transcription start site of the TLR9 gene. Open and solid circles indicate bases exhibiting constitutive protection or hypersensitivity, respectively. Open triangles signify bases exhibiting IFN-␤-induced protection. The boxed regions highlight putative regulatory motifs.

nt ⫺79, ⫺77, ⫺75, ⫺73, and ⫺71. This indicated that the AP-1 site was constitutively occupied by transcription factors in vivo. In addition, guanines upstream of AP-1 (G-88, G-87, and G-82) and downstream of AP-1 (G-67, G-63, G-61, G-60, G-57, G-51, G-40, and G-29) showed constitutive protection or hypersensitivity (G-64 and G-55), suggesting occupancy of this region by multiple factors. Constitutive protection of guanines near the initiation site

Determination of factors that bind to the DRR and the PPR of TLR9 EMSAs were conducted with nuclear extract prepared from IFN␤-treated and control RAW264.7 cells to identify factors that interact with the putative ISRE/IRF-E1 site of the DRR (Fig. 7, A–C) and the AP-1 site of the PPR (Fig. 7, D and E). For the ISRE/ IRF-E1 site, complex b was shown in EMSAs with nuclear extract from control and IFN␤-treated cells (Fig. 7, A–C). EMSAs with nuclear extract from IFN-␤-treated cells identified several shifted complexes that were less abundant (complex a) or not present (complexes c, d, & e) when extracts from control untreated cells were used (Fig. 7, A–C). The specificity of the bound complexes

FIGURE 7. Identification of factors binding to the ISRE/IRF-E1 site (A–C) and the AP-1 site (D and E). Autoradiographs of EMSAs with nuclear extract (NE) prepared from untreated control (control) or IFN-␤-treated (⫹IFN-␤) RAW264.7 cells are shown (A–E). Competitor (Comp) DNA including nonspecific competitor (NC) and specific competitor (SC), specific Ab (␣ⴱ, ⴱ indicates transcription factor), and nonspecific (NS) Ab are added as described in Materials and Methods and Results. Complexes a, b, c, d, e, and f indicate formed protein-DNA complexes as described in Results. The light arrows indicate the altered mobility of the complexes as a result of antiserum interaction. Western blot assays of IRF-1, IRF-2, STAT1, and phosphorylated STAT1 (p-STAT1; F) were performed. The results are representatives of at least three independent experiments.

The Journal of Immunology was demonstrated by competition for complex formation with unlabeled probe DNA but not with nonspecific DNA (Fig. 7A, lanes 3, 4, 7, and 8). Except for complex e, formation of complexes a, b, c, and d was competed with DNA containing a consensus IRF-1 binding motif, but not with DNA containing mutated consensus IRF-1 motif (Fig. 7B, lanes 2, 3, 10, and 11), indicating recognition of IRF-1 motif by factors in complexes a, b, c, and d. To further understand which factors bind to ISRE/IRF-E1 site, supershift assays were performed using Abs against different STATs and IRFs. Supershift assays with IRF-2 Ab using nuclear extract from control and IFN␤-treated cells identified further shifted complexes with concurrent disappearance of complex b (Fig. 7B, lanes 6 and 14), suggesting that IRF-2 constitutively binds to ISRE/IRF-E1. In supershift assays using nuclear extract from IFN-␤-treated cells, IRF-1 Abs were able to supershift complex a, c and d (Fig. 7B, lane 13), and STAT1 Abs supershifted complex e (Fig. 7B, lane 12), suggesting that IRF-1 and STAT1 translocate into nucleus to bind to ISRE/IRF-E1 after induction by IFN-␤. Type I IFN is known to induce translocation of IFN-stimulated gene factor-3 (ISGF3) complex that consists of STAT1, STAT2, and IRF-9 into nucleus (47). To understand whether ISGF3 binds to ISRE/IRF-E1, supershift assays using STAT2 Ab were performed. STAT2 Ab was shown to further shift complex e (Fig. 7C, lane 4), indicating that STAT1 and STAT2 bind to ISRE/ IRF-E1 as components of ISGF3 complex. Supershift assays with Abs against IRF-3 and IRF-7 failed to shift any complex (Fig. 7B, lanes 7, 8, 15, and 16), suggesting that these factors may not bind to ISRE/IRF-E1 site.

7415 Sequence comparison of ISRE/IRF-E1 and ISRE/IRF-E2 showed that the two sites were highly homologous (Fig. 6). To understand whether ISRE/IRF-E2 is recognized by similar factors as ISRE/IRF-E1, EMSAs of ISRE/IRF-E1 using ISRE/IRF-E2 site DNA as cold competitor were performed. Complexes a, b, c, and d, but not complex e, were competed by ISRE/IRF-E2 DNA (Fig. 7A, lanes 5 and 9), implying that IRF-2 constitutively binds to ISRE/IRF-E2, and IRF-1, but not STAT1, is induced to bind to ISRE/IRF-E2 by IFN-␤. Consistent with the DNA binding activities of IRF-1, IRF-2, and STAT1 as revealed by EMSAs, little changes in IRF-2 expression were observed during the course of IFN-␤ treatment (Fig. 7F). In contrast, the expression levels of IRF-1 and STAT1 as well as the level of STAT1 phosphorylation at Tyr701 were markedly induced by IFN-␤. Thus, IFN-␤ may induce the binding of IRF-1 to the two ISRE/IRF-E sites through enhancing de novo production of IRF-1, while activate the function of STAT1 by inducing its expression and phosphorylation. For the AP-1 site, one very robust protein-DNA complex was identified in EMSAs using nuclear extract from control or IFN␤treated cells (complex f; Fig. 7, D and E). The specificity of the bound complex was demonstrated by competition for complex formation with unlabeled probe DNA but not with nonspecific competitor DNA (Fig. 7D, lanes 3, 4, 6, and 7). Supershift assays with Abs against c-Jun or c-Fos identified further shifted complexes (Fig. 7E, lanes 2, 3, 6, and 7), indicating that c-Jun and c-Fos form heterodimers to bind to the AP-1 site of the PPR. Supershift assays with nonspecific Ab failed to further shift complex f (Fig. 7E, lanes 4 and 8), indicating the specificity of Abs against c-Jun and

FIGURE 8. IRF-1, STAT1, AP-1, and IRF-2 are required for TLR9 expression. Peritoneal macrophages from C57BL/6J wild type (wt) and IRF-1 knockout mice (IRF-1⫺/⫺) in A or 129S6 wild type (wt) and STAT1 knockout mice (STAT1⫺/⫺) in B were treated with IFN-␤ for 4 h or left untreated as indicated. Total RNA was isolated from above cells and analyzed for TLR9 expression by real-time RT-PCR assays. The results are plotted as fold induction over untreated cells. The average of three real-time RT-PCR experiments is shown with SD. C, RAW264.7 cells were transfected with siRNA targeting GAPDH, c-Jun, IRF-2, or scrambled negative control siRNA (NC, NC1, NC2). Total cell lysate was collected 72 h posttransfection and analyzed by Western blot for the expression of IRF-2 and c-Jun. D, Total RNA from siRNA-transfected RAW264.7 cells was collected 72 h posttransfection. Basal expression of TLR9 was determined by real-time RT-PCR. The results are plotted as percentage over negative control siRNA-transfected cells. The average of three independent experiments is shown with SD. NC siRNA was purchased from Ambion, and the other siRNAs were purchased from Dharmacon.

7416 c-Fos. The above results suggest that IRF-2 and AP-1 (consisting of c-Jun and c-Fos) may constitutively bind to the two ISRE/IRF-E sites and the AP-1 site, respectively. IFN-␤ treatment induces binding of IRF-1 to the ISRE/IRF-E1 and ISRE/IRF-E2 sites, and only the ISRE/IRF-E1 site is bound by ISGF3 after IFN-␤ induction. Determination of the roles of IRF-1, STAT1, AP-1, and IRF-2 in TLR9 expression To further understand the roles of IRF-1 and STAT1 in TLR9 expression, thioglycollate-elicited peritoneal macrophages from knockout mice for IRF-1 or STAT1 were isolated, and treated with IFN-␤ or left untreated. The cell viability was not compromised as determined by trypan blue staining (data not shown). Real time RT-PCR assays on RNA extracted from above cells showed that in comparison to wild type, the level of TLR9 induction by IFN-␤ was decreased in IRF-1⫺/⫺ cells, while the induction response to IFN-␤ was abolished in STAT1⫺/⫺ cells (Fig. 8, A and B). In addition, siRNA-mediated knockdown of c-Jun or IRF-2 expression in RAW264.7 cells led to reduced basal level of TLR9 expression (Fig. 8, C and D). The specificity of TLR9 down-regulation mediated by siRNA was further confirmed by testing three negative controls and siRNAs to RIG-I and Tollip (Fig. 8D). Consistent with the results obtained from EMSAs, these results indicated that induction of TLR9 by IFN-␤ required both IRF-1 and STAT1, while AP-1 and IRF-2 were important for the basal expression of TLR9.

Discussion In this study, we have analyzed transcriptional regulation of murine TLR9 in macrophages through in vivo and in vitro assays. We showed for the first time that expression of murine TLR9 is induced by IFN␤, and this induction response requires a DRR located ⬃2.4 kbp upstream of the transcriptional start site of TLR9. The DRR together with a PPR were required for the basal level of TLR9 expression. Two ISRE/IRF-E sites and one AP-1 site were identified within the DRR and the PPR, respectively. These sites were constitutively occupied by transcription factors as identified by IVGF. EMSAs revealed that IRF-1 and ISGF3 are induced and are likely to bind to the DRR in response to IFN␤ treatment, and IRF-2 and AP-1 may constitutively bind to the DRR and the PPR, respectively. The essential roles of IRF-1 and STAT1 in IFN␤-mediated induction of TLR9 were demonstrated by disrupted TLR9 induction in macrophages of IRF-1⫺/⫺ and STAT1⫺/⫺ mice. The first line of defense of innate immunity against bacterial and viral infection is accomplished through the functions of TLRs expressed on macrophages, NK cells, and neutrophils. Of the conserved pathogen-associated molecular patterns recognized by TLRs, TLR9 recognizes unmethylated CpG motifs that are present in bacterial DNA and synthetic CpG ODNs (4, 5). In addition, viral DNA from some DNA viruses, including HSV-1 (48), HSV-2

FIGURE 9. Summary of proposed model for the basal and IFN-␤-induced expression of mTLR9 gene.

IFN-␤-MEDIATED INDUCTION OF MURINE TLR9 (49), and murine CMV (50), contains abundant CpG motifs, and can be recognized by TLR9 in vitro and in vivo. Thus, during bacterial or viral infection, type I IFN produced by macrophages or pDCs would up-regulate TLR9 expression, leading to amplified responses of these cells to TLR9 ligands and ultimately activating NF-␬B and MAPKs ERK, p38, and JNK signaling events (11, 12). Levels of TLR9 expression have been shown to correlate with responsiveness to CpG ODNs in macrophages (17), DCs (51), and B cells (52). Because large amounts of type I IFN are induced in DCs by CpG ODNs (6), it will be interesting to understand whether expression of TLR9 in DCs is regulated in an autocrine manner by CpG ODNs. One of the unique features of TLR9 regulation is the requirement of the DRR that is located ⬃2.4 kbp upstream of the transcription start site for basal and induced expression. Based on the above observation the following model for IFN-␤-induction of the TLR9 gene is proposed (Fig. 9). During constitutive or basal TLR9 expression, IRF-2 and AP-1 constitutively bind to the DRR and the PPR, respectively, and facilitate basal expression of TLR9. In the basal state, IRF-2 is likely to bind to both ISRE/IRF-E1 and ISRE/ IRF-E2 as suggested by the detection of IRF2-containing complex b and the capacity of ISRE/IRF-E2 probe to compete for complex b. After IFN-␤ treatment, IRF-2 may still bind to the two ISRE/ IRF-E sites, while IRF-1 and ISGF3 induced by IFN-␤ are translocated into the nucleus and can bind to the DRR. IRF-1 may bind to the two ISRE/IRF-E sites but ISGF3 may only bind to the ISRE/ IRF-E1 based on the observation that IRF-1 interacted with the ISRE/IRF-E1 to form complexes a, c, and d and that these complexes could be competed by ISRE/IRF-E2 competitor DNA. In contrast, the ISRE/IRF-E2 site failed to compete for complex e that contained ISGF3. IRF-1 and IRF-2 might separately bind to the DRR as homodimers because no complexes containing both IRF-1 and IRF-2 were identified in EMSAs. However, interactions among IRF-1, IRF-2 and ISGF3 may occur due to their close proximity to each other at the two ISRE/IRF-E sites. In basal and induced states, the DRR may communicate with the PPR to facilitate expression of TLR9. To overcome the distance of ⬃2.3 kbp of DNA between the DRR and the PPR, a DNA loop from the DRR to the PPR may form through the interaction between factors at the ISRE/IRF-E and AP-1 sites. The looped structure might facilitate recruitment of RNA polymerase II to the promoter region and lead to higher efficacy of transcriptional initiation of TLR9. The binding patterns of ISRE/IRF-E1 are reminiscent of that of the ISRE/IRF-E site at the 5⬘ flanking region of murine TLR3 (30). Constitutive binding of IRF-2 and IFN-␤-induced recruitment of IRF-1 to this ISRE/IRF-E site are shown to be required for basal and induced expression of TLR3. IRF-2 is originally identified as a transcription repressor of IRF-1-mediated activation of the IFN-␤ gene and other promoters that are induced by IRF-1 (53, 54). In the present study, TLR9 might be one of the few genes, including TLR3 (30), VCAM-1 (55), and histone H4 (56, 57), whose expression is positively regulated by IRF-2. It appears that no competitive binding of ISGF3, IRF-1, and IRF-2 to the DRR occurs in vitro based on the observation that the formation of complex b by IRF-2 and ISRE/IRF-E1 probes was not inhibited in EMSAs using nuclear extract isolated from IFN-␤-treated cells. The essential role of STAT1 in IFN-␤-induced expression of TLR9 was demonstrated by aborted induction of TLR9 in STAT1 knockout macrophages after IFN-␤ treatment. It has been well established that type I IFN signaling results in phosphorylation of STAT1 and STAT2, which in combination with IRF-9, form a heterotrimeric complex ISGF3 to activate IFN-inducible genes (58). Several Abs against IRF-9 from commercial sources were tested in supershift assays, and all of them failed to shift complex

The Journal of Immunology e (data not shown). However, based on the fact that complex e contains both STAT1 and STAT2 as identified by supershift assays, it is highly possible that ISGF3 complex is formed after IFN-␤ treatment, translocates into the nucleus, binds to the DRR of the TLR9 gene, and activates TLR9 expression. Although the sequences of ISRE/IRF-E1, ISRE/IRF-E2 and IRF-E consensus site are highly homologous, the latter two sequences failed to compete for complex e formed by ISGF3 and ISRE/IRF-E1 probe, implying an unique binding motif within ISRE/IRF-E1 sequence that is recognized by ISGF3 with high affinity. This observation is in line with the results of the reporter assay that revealed almost complete abolishment of response to IFN-␤ from reporter constructs containing mutations at the ISRE/IRF-E1 site. Despite the presence of 49.7% of sequence homology between the 5⬘ flanking regions of the TLR9 genes of human and mouse, expression of TLR9 in these two species is regulated in a speciesspecific manner. Notably, hTLR9 is mainly found in pDCs and B cells, while mTLR9 is expressed in myeloid DCs, macrophages and B cells (59). A recent report demonstrates that constitutive expression of hTLR9 in a myeloma cell line requires functions of multiple transcription factors, including CREB1, Ets2, Elf1, Elk1, and C/EBP␣ (35). A completely different strategy is found to maintain basal level of mTLR9 expression as revealed by our study that demonstrates the essential roles of IRF-2 and AP-1 in regulation of constitutive expression of mTLR9. Therefore, like TLR2, TLR3 and TLR4, the difference in transcriptional regulation of human and mouse TLR9 genes represents another example where regulation of TLR expression is not evolutionarily conserved. We could not confirm the results of a previous study that demonstrates induced expression of murine TLR9 in response to LPS treatment in RAW264.7 cells (60). One possible difference between the two studies is that phenol-extracted LPS purified by the researchers was used in the previous study at a final concentration of 10 ng/ml, whereas phenol-purified LPS from commercial resource at a final concentration of 100 ng/ml was used here. However, the absence of TLR9 induction by LPS in our system is not due to insensitivity of cells to LPS treatment, because LPS-mediated induction of TLR2 still can be observed. Interestingly, LPS and poly(I:C) fail to induce TLR9 expression in RAW264.7 cells even after 24 h of treatment, although both ligands are known to be capable of inducing type I IFN (39 – 44). This might be attributed to the low level of type I IFN induced by LPS or poly(I:C) in RAW264.7 cells. IVGF analyses demonstrate constitutive occupancy at the AP-1 and the ISRE/IRF-E sites. This observation is consistent with the essential roles of the PPR and the DRR in the basal expression of TLR9. In addition, an IFN-␤-inducible hyposensitivity to DMS at adenosine of nt ⫺2357 5⬘ upstream of the ISRE/IRF-E1 site is also identified by IVGF. This site does not overlap with any known consensus sequence for transcription factor, and the induced change by IFN-␤ at this site may indicate the presence of a novel element. Interestingly, extensive changes of sensitivity to DMS treatment at the region between the AP-1 site and the ⫹1 are also revealed by IVGF when the footprint patterns of the in vivo samples are compared with that of the in vitro control. These changes may imply occupancy of this region by other transcription factors as well as components of the transcription machinery. We have shown that expression and function of TLR9 declines with aging which may contribute to cytokine imbalance in response to infection or vaccination by modulating the priming environment (17). It will be interesting to examine whether decreased expression of TLR9 in aging is regulated at the transcriptional level. Understanding the mechanism of TLR9 transcription and its down-regulation in aging may identify strategies to enhance the

7417 efficacy of vaccines, such as those against influenza, for which the elderly are a major target population.

Disclosures The authors have no financial conflict of interest.

References 1. Akira, S., and K. Takeda. 2004. Functions of Toll-like receptors: lessons from KO mice. C. R. Biol. 327: 581–589. 2. Akira, S., and S. Sato. 2003. Toll-like receptors and their signaling mechanisms. Scand. J. Infect. Dis. 35: 555–562. 3. Werling, D., and T. W. Jungi. 2003. Toll-like receptors linking innate and adaptive immune response. Vet. Immunol. Immunopathol. 91: 1–12. 4. Takeshita, F., I. Gursel, K. J. Ishii, K. Suzuki, M. Gursel, and D. M. Klinman. 2004. Signal transduction pathways mediated by the interaction of CpG DNA with Toll-like receptor 9. Semin. Immunol. 16: 17–22. 5. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408: 740 –745. 6. Hemmi, H., T. Kaisho, K. Takeda, and S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J. Immunol. 170: 3059 –3064. 7. Lore, K., M. R. Betts, J. M. Brenchley, J. Kuruppu, S. Khojasteh, S. Perfetto, M. Roederer, R. A. Seder, and R. A. Koup. 2003. Toll-like receptor ligands modulate dendritic cells to augment cytomegalovirus- and HIV-1-specific T cell responses. J. Immunol. 171: 4320 – 4328. 8. He, B., X. Qiao, and A. Cerutti. 2004. CpG DNA induces IgG class switch DNA recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL-10. J. Immunol. 173: 4479 – 4491. 9. Vollmer, J., R. Weeratna, P. Payette, M. Jurk, C. Schetter, M. Laucht, T. Wader, S. Tluk, M. Liu, H. L. Davis, and A. M. Krieg. 2004. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur. J. Immunol. 34: 251–262. 10. Wagner, H. 2002. Interactions between bacterial CpG-DNA and TLR9 bridge innate and adaptive immunity. Curr. Opin. Microbiol. 5: 62– 69. 11. Akira, S., and H. Hemmi. 2003. Recognition of pathogen-associated molecular patterns by TLR family. Immunol. Lett. 85: 85–95. 12. Ashkar, A. A., and K. L. Rosenthal. 2002. Toll-like receptor 9, CpG DNA and innate immunity. Curr. Mol. Med. 2: 545–556. 13. Kaisho, T., and S. Akira. 2001. Toll-like receptors and their signaling mechanism in innate immunity. Acta. Odontol. Scand. 59: 124 –130. 14. Edwards, A. D., S. S. Diebold, E. M. Slack, H. Tomizawa, H. Hemmi, T. Kaisho, S. Akira, and C. Reis e Sousa. 2003. Toll-like receptor expression in murine DC subsets: lack of TLR7 expression by CD8␣⫹ DC correlates with unresponsiveness to imidazoquinolines. Eur. J. Immunol. 33: 827– 833. 15. Boonstra, A., C. Asselin-Paturel, M. Gilliet, C. Crain, G. Trinchieri, Y. J. Liu, and A. O’Garra. 2003. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential Toll-like receptor ligation. J. Exp. Med. 197: 101–109. 16. An, H., Y. Yu, M. Zhang, H. Xu, R. Qi, X. Yan, S. Liu, W. Wang, Z. Guo, J. Guo, et al. 2002. Involvement of ERK, p38 and NF-␬B signal transduction in regulation of TLR2, TLR4 and TLR9 gene expression induced by lipopolysaccharide in mouse dendritic cells. Immunology 106: 38 – 45. 17. Renshaw, M., J. Rockwell, C. Engleman, A. Gewirtz, J. Katz, and S. Sambhara. 2002. Cutting edge: impaired Toll-like receptor expression and function in aging. J. Immunol. 169: 4697– 4701. 18. Olson, J. K., and S. D. Miller. 2004. Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs. J. Immunol. 173: 3916 –3924. 19. Liu, N., N. Ohnishi, L. Ni, S. Akira, and K. B. Bacon. 2003. CpG directly induces T-bet expression and inhibits IgG1 and IgE switching in B cells. Nat. Immunol. 4: 687– 693. 20. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, and G. Hartmann. 2002. Quantitative expression of Toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168: 4531– 4537. 21. Jarrossay, D., G. Napolitani, M. Colonna, F. Sallusto, and A. Lanzavecchia. 2001. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur. J. Immunol. 31: 3388 –3393. 22. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, and Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194: 863– 869. 23. Kato, A., T. Ogasawara, T. Homma, J. Batchelor, S. Imai, H. Wakiguchi, H. Saito, and K. Matsumoto. 2004. CpG oligodeoxynucleotides directly induce CXCR3 chemokines in human B cells. Biochem. Biophys. Res. Commun. 320: 1139 –1147. 24. Vollmer, J., R. D. Weeratna, M. Jurk, H. L. Davis, C. Schetter, M. Wullner, T. Wader, M. Liu, A. Kritzler, and A. M. Krieg. 2004. Impact of modifications of heterocyclic bases in CpG dinucleotides on their immune-modulatory activity. J. Leukocyte Biol. 76: 585–593. 25. Rehli, M. 2002. Of mice and men: species variations of Toll-like receptor expression. Trends Immunol. 23: 375–378.

7418 26. Liu, Y., Y. Wang, M. Yamakuchi, S. Isowaki, E. Nagata, Y. Kanmura, I. Kitajima, and I. Maruyama. 2001. Up-regulation of Toll-like receptor 2 gene expression in macrophage response to peptidoglycan and high concentration of lipopolysaccharide is involved in NF-␬B activation. Infect. Immun. 69: 2788 –2796. 27. Matsuguchi, T., K. Takagi, T. Musikacharoen, and Y. Yoshikai. 2000. Gene expressions of lipopolysaccharide receptors, Toll-like receptors 2 and 4, are differently regulated in mouse T lymphocytes. Blood 95: 1378 –1385. 28. Wang, T., W. P. Lafuse, and B. S. Zwilling. 2001. NF-␬B and Sp1 elements are necessary for maximal transcription of Toll-like receptor 2 induced by Mycobacterium avium. J. Immunol. 167: 6924 – 6932. 29. Wang, T., W. P. Lafuse, and B. S. Zwilling. 2000. Regulation of Toll-like receptor 2 expression by macrophages following Mycobacterium avium infection. J. Immunol. 165: 6308 – 6313. 30. Heinz, S., V. Haehnel, M. Karaghiosoff, L. Schwarzfischer, M. Muller, S. W. Krause, and M. Rehli. 2003. Species-specific regulation of Toll-like receptor 3 genes in men and mice. J. Biol. Chem. 278: 21502–21509. 31. Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, and D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J. Exp. Med. 189: 615– 625. 32. Matsuguchi, T., T. Musikacharoen, T. Ogawa, and Y. Yoshikai. 2000. Gene expressions of Toll-like receptor 2, but not Toll-like receptor 4, is induced by LPS and inflammatory cytokines in mouse macrophages. J. Immunol. 165: 5767–5772. 33. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085–2088. 34. Fan, J., A. Kapus, P. A. Marsden, Y. H. Li, G. Oreopoulos, J. C. Marshall, S. Frantz, R. A. Kelly, R. Medzhitov, and O. D. Rotstein. 2002. Regulation of Toll-like receptor 4 expression in the lung following hemorrhagic shock and lipopolysaccharide. J. Immunol. 168: 5252–5259. 35. Takeshita, F., K. Suzuki, S. Sasaki, N. Ishii, D. M. Klinman, and K. J. Ishii. 2004. Transcriptional regulation of the human TLR9 gene. J. Immunol. 173: 2552–2561. 36. Ping, D., P. L. Jones, and J. M. Boss. 1996. TNF regulates the in vivo occupancy of both distal and proximal regulatory regions of the MCP-1/JE gene. Immunity 4: 455– 469. 37. Guo, Z., G. H. Boekhoudt, and J. M. Boss. 2003. Role of the intronic enhancer in tumor necrosis factor-mediated induction of manganous superoxide dismutase. J. Biol. Chem. 278: 23570 –23578. 38. Ping, D., G. H. Boekhoudt, E. M. Rogers, and J. M. Boss. 1999. Nuclear factor-␬B p65 mediates the assembly and activation of the TNF-responsive element of the murine monocyte chemoattractant-1 gene. J. Immunol. 162: 727–734. 39. Vogel, S. N., and M. Fenton. 2003. Toll-like receptor 4 signalling: new perspectives on a complex signal-transduction problem. Biochem. Soc. Trans. 31: 664 – 668. 40. Schilling, D., K. Thomas, K. Nixdorff, S. N. Vogel, and M. J. Fenton. 2002. Toll-like receptor 4 and Toll-IL-1 receptor domain-containing adapter protein (TIRAP)/myeloid differentiation protein 88 adapter-like (Mal) contribute to maximal IL-6 expression in macrophages. J. Immunol. 169: 5874 –5880. 41. Toshchakov, V., B. W. Jones, P. Y. Perera, K. Thomas, M. J. Cody, S. Zhang, B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, and S. N. Vogel. 2002. TLR4, but not TLR2, mediates IFN-␤-induced STAT1␣/␤-dependent gene expression in macrophages. Nat. Immunol. 3: 392–398. 42. Kawai, T., O. Takeuchi, T. Fujita, J. Inoue, P. F. Muhlradt, S. Sato, K. Hoshino, and S. Akira. 2001. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J. Immunol. 167: 5887–5894.

IFN-␤-MEDIATED INDUCTION OF MURINE TLR9 43. Matsumoto, M., K. Funami, H. Oshiumi, and T. Seya. 2004. Toll-like receptor 3: a link between Toll-like receptor, interferon and viruses. Microbiol. Immunol. 48: 147–154. 44. Oshiumi, H., M. Matsumoto, K. Funami, T. Akazawa, and T. Seya. 2003. TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon ␤ induction. Nat. Immunol. 4: 161–167. 45. Javahery, R., A. Khachi, K. Lo, B. Zenzie-Gregory, and S. T. Smale. 1994. DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol. Cell. Biol. 14: 116 –127. 46. Lo, K., and S. T. Smale. 1996. Generality of a functional initiator consensus sequence. Gene 182: 13–22. 47. Aaronson, D. S., and C. M. Horvath. 2002. A road map for those who don’t know JAK-STAT. Science 296: 1653–1655. 48. Krug, A., G. D. Luker, W. Barchet, D. A. Leib, S. Akira, and M. Colonna. 2004. Herpes simplex virus type 1 activates murine natural interferon-producing cells through Toll-like receptor 9. Blood 103: 1433–1437. 49. Lund, J., A. Sato, S. Akira, R. Medzhitov, and A. Iwasaki. 2003. Toll-like receptor 9-mediated recognition of herpes simplex virus-2 by plasmacytoid dendritic cells. J. Exp. Med. 198: 513–520. 50. Krug, A., A. R. French, W. Barchet, J. A. Fischer, A. Dzionek, J. T. Pingel, M. M. Orihuela, S. Akira, W. M. Yokoyama, and M. Colonna. 2004. TLR9dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function. Immunity 21: 107–119. 51. Bauer, S., C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira, H. Wagner, and G. B. Lipford. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad Sci. USA 98: 9237–9242. 52. Bernasconi, N. L., N. Onai, and A. Lanzavecchia. 2003. A role for Toll-like receptors in acquired immunity: up-regulation of TLR9 by BCR triggering in naive B cells and constitutive expression in memory B cells. Blood 101: 4500 – 4504. 53. Yamamoto, H., M. S. Lamphier, T. Fujita, T. Taniguchi, and H. Harada. 1994. The oncogenic transcription factor IRF-2 possesses a transcriptional repression and a latent activation domain. Oncogene 9: 1423–1428. 54. Taniguchi, T., N. Tanaka, K. Ogasawara, S. Taki, M. Sato, and A. Takaoka. 1999. Transcription factor IRF-1 and its family members in the regulation of host defense. Cold Spring Harb. Symp. Quant. Biol. 64: 465– 472. 55. Jesse, T. L., R. LaChance, M. F. Iademarco, and D. C. Dean. 1998. Interferon regulatory factor-2 is a transcriptional activator in muscle where it regulates expression of vascular cell adhesion molecule-1. J. Cell Biol. 140: 1265–1276. 56. Vaughan, P. S., C. M. van der Meijden, F. Aziz, H. Harada, T. Taniguchi, A. J. van Wijnen, J. L. Stein, and G. S. Stein. 1998. Cell cycle regulation of histone H4 gene transcription requires the oncogenic factor IRF-2. J. Biol. Chem. 273: 194 –199. 57. Vaughan, P. S., F. Aziz, A. J. van Wijnen, S. Wu, H. Harada, T. Taniguchi, K. J. Soprano, J. L. Stein, and G. S. Stein. 1995. Activation of a cell cycleregulated histone gene by the oncogenic transcription factor IRF-2. Nature 377: 362–365. 58. Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19: 623– 655. 59. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5: 987–995. 60. An, H., H. Xu, Y. Yu, M. Zhang, R. Qi, X. Yan, S. Liu, W. Wang, Z. Guo, Z. Qin, and X. Cao. 2002. Up-regulation of TLR9 gene expression by LPS in mouse macrophages via activation of NF-␬B, ERK and p38 MAPK signal pathways. Immunol. Lett. 81: 165–169.