Inducible expression of stem cell associated ... - Wiley Online Library

IJC International Journal of Cancer

Inducible expression of stem cell associated intermediate filament nestin reveals an important role in glioblastoma carcinogenesis Wen Jing Lu1,2*, Feng Lan1,3*, Qihua He1*, Andrew Lee3, Chad Z. Tang3, Lin Dong1, Baojin Lan4, Xiaowen Ma1, Joseph C. Wu3 and Li Shen1 1

Department of Cell Biology, Peking University Health Science Center, Beijing, China Department of Surgery, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong SAR 3 Department of Medicine, Stanford University School of Medicine, Stanford, CA 4 Department of Common Basic, Fujian College of medical occupation and technology, Fuzhou, China

The intermediate filament nestin is transiently expressed in neural stem/progenitor cells during the development of central nervous system. Recently, increasing evidence has shown that upregulation of nestin is related to malignancy of several cancers, especially glioblastoma. However, the function of nestin in carcinogenesis remains unclear. In this study, we investigated the role of nestin in glioblastoma carcinogenesis by comparing subclones of rat C6 glioblastoma cells that were either high or low for nestin expression. We found that while nestin expression did not influence the in vitro proliferation of glioblastoma cells, subclones characterized by high levels of nestin formed tumors in vivo at significantly faster rates than subclones with low expression. Importantly, C6 subclones that expressed nestin at low levels in vitro were also found to give rise to tumors highly positive for the protein, suggesting that induction of nestin plays an important role in glioblastoma carcinogenesis. Derivation of nestin positive tumors from nestin negative human U87 glioblastoma cells in immunodeficient mice further confirmed that a switch to positive expression of nestin is fundamental to the course of glioblastoma development. Blocking the expression of nestin in glioblastoma tumors via intratumor injection of shRNA significantly slowed tumor growth and volume. These results demonstrated that nestin plays a crucial role in development of glioblastoma and may potentially be targeted for treatment of the disease.

Introduction Glioblastoma multiforme (GBM) is the most common and aggressive type of primary brain tumor found in adults.1 Despite recent advances in surgical intervention, chemotherapy, and radiotherapy for neoplasms of the brain, prognosis for GBM remains very poor. The low patient survival rate and lack of robust treatment options for GBM warrant the development of novel therapies for treatment. Recently, several studies have demonstrated that expression of nestin is strongly upregulated in GBM and other glial neoplasms, and that a positive association exists between nestin expression

Key words: nestin, glioblastoma, shRNA, carcinogenesis Additional supporting information can be viewed in the online issue, which is available at wileyonlinelibrary.com. Grant sponsor: Fujian Ministry of Education Project; Grant number: JA08257 *W.J.L., F.L. and Q.H. contributed equally to this work DOI: 10.1002/ijc.25586 History: Received 23 Mar 2010; Accepted 20 Jul 2010; Online 28 Jul 2010 Correspondence to: Li Shen, Peking University Stem Cell Research Center, 38 Xueyuan Road, Haidian, Beijing, China 100191, Tel.: 86-10-82802171, Fax: 86-10-82802171, E-mail: [email protected]

C 2010 UICC Int. J. Cancer: 128, 343–351 (2011) V

and glioblastoma malignancy.2–4 In this study, we sought to investigate the role of nestin in glioblastoma carcinogenesis. We hypothesized that expression of nestin was critical to tumor growth and that targeting nestin for downregulation could be used as a potential treatment for GBM. Nestin has traditionally been noted for its importance as a neural stem cell marker. However, in recent years, expression of nestin has shown to be associated with general proliferation of progenitor cell populations within neoplasms. Several studies have thus targeted nestin as a potential diagnostic and prognostic marker of brain malignancy.3,5 Nestin expression is also closely associated with other types of cancer outside of the brain. Upregulation of nestin in colorectal,6 breast,7 prostate8 and pancreatic9 cancers has been correlated with tumor malignancy and metastasis. In addition to being a marker of neoplastic tissue, nestin is also expressed in a wide variety of developmental and adult progenitor cell populations.10–12 As progenitor cells differentiate, nestin is gradually down-regulated and is replaced by other tissue-specific intermediate filament (IF) proteins, such as glial fibrillary acidic protein (GFAP). Nestin and GFAP generally represent different ends of the spectrum of differentiation and tumorigencity in that as a marker of undifferentiation, nestin expression is generally higher in malignant glioblastoma cancers than in less invasive gliomas, indicating

Cancer Cell Biology

2

Cancer Cell Biology

344

a correlation between nestin expression and malignancy within the glioma tumor group.2,13 It has recently been shown that many proliferating tumor cells express nestin, which contributes to glioblastoma tumorgenesis by giving rise to new tumor cells.3 By comparison, GFAP is specific for cells that have differentiated toward astrocytic lineages and is widely used as an immunohistochemical marker of differentiation within brain tumors.14 Moreover, decrease in GFAP expression has been associated with growth and malignancy in gliomas15 and is more prominent in high-grade than in low-grade glial tumors.16 Within adult tissues composed of differentiated cell types, nestin can also be re-expressed following injury. One example of this reinduction of nestin expression occurs in the formation of glial scars following central nervous system (CNS) injury.17 Generally however, up-regulated expression of nestin in the brain is associated with neoplasms of the CNS, especially glial-derived tumors.2 Although the function of nestin in cancer is poorly understood, a number of recent studies have shown nestin plays a role in the proliferation, migration, and survival of several types of brain tumor cells.18–22 In this study, we investigated the role of nestin in a model of glioblastoma carcinogenesis via subclonal analysis of tumor cells characterized by high and low levels of nestin expression. Our results demonstrated that nestin plays a critical role in the development of GBM, and that this gene may be targeted therapeutically to treat tumor formation. These results should yield significant insight on the function of this protein in glial carcinogenesis.

Material and Method Cell culture

C6 rat glioblastoma cells and U87 human glioblastoma cells were provided by the Xie He Cell Culture Center (Beijing, China). Cells were cultured in DMEM (Hyclone, Logan, UT) supplemented with 10% fetal bovine serum (FBS; Hyclone). Cells were maintained at 37 C in a humidified air chamber with 5% CO2. For induced differentiation of C6 cells by dbcAMP, cells were placed in serum free conditions for 1 h, and 1 mM db-cAMP was added to the medium. The cells were then incubated for 3 days. Construction of the RNA interference-adenovirus vector

The short hairpin RNA expression vector pDC316-GFP-U6 was constructed by inserting a GFP coding sequence and a shRNA expressing cassette with U6 promoter into adenoviral shuttle plasmid pDC316 (AdMax system, Microbix, Toronto, Canada). A self-annealing oligonucleotide targeting rat nestin (target sequence: AAG ATG TCC CTT AGT CTG GAG) was inserted into vector pDC316-EGFP-U6. Scramble oligonucleotide having no homology with Homo sapiens, mice and rat was use to generate a control vector. Recombinant adenovirus was generated by cotransfection of the backbone plasmid pBHGlox4E1, 3Cre (AdMax system) and pDC316EGFP-U6. Adenovirus was subsequently propagated in HEK 293 cells and purified by AdenopureTM adenovirus purification kit (Puresyn, Malvern, PA). The titer of biologically

Inducible expression of nestin

active virus was determined by infecting a known number of 293T cells with serial dilutions of the GFP-containing viruses. A multiplicity of infection of 1 was defined as the amount of AV necessary to positively transfect 100% of C6 cells after 48 h as determined by GFP fluorescence. Subcloning of C6 glioblastoma cells

To obtain subclones of the C6 glioblastoma cell line, a singlecell suspension was prepared at a concentration of 10 cells/ ml and seeded into 96-well plates (100 lL per well). Wells containing no cells or more than one cell were excluded, and wells with only one cell were marked for inclusion in the study. Cells were checked daily to monitor subclone proliferation. After 2 weeks, 20 separated subclones were transferred to six-well plates and expanded. Expression of nestin was subsequently examined by western blot and immunocytofluorescence staining. Four subclones (H1, H2, L1, L2) were chosen for further culture and characterization. Generation of nestin knockdown human U87 cell lines

Nestin positive neuroblastoma cells were transduced by MISSIONV shRNA Lentiviral transduction particles purchased from Sigma (Saint Louis, MO). After selection for puromycin, nestin expression of cells transduced with different viral vectors were examined by western blot and immunostaining. The viral vector taergeting GCAGCACTCTTAACTTACGAT showed 80% knockdown efficiency. U87 cells were then transduced by this knockdown vector and scramble control vector and selected by 10 lg/ml pruomycin for 6 weeks for tumorgenesis assays. R

Tumorigenesis assay

Clonal C6 cells (1 105) and U87 cells (1 106) were injected into the backs of 4-week-old BALB/C-nude mice (supplied by the Experimental Animal Center, Peking University Health Science Center, Beijing, China). Mice were treated according to the guidelines of the Peking University Animal Committee. The size of each tumor was monitored three times a week. When the tumors grew to about 1 cm in diameter, the mice were sacrificed under deep anesthesia with pentobarbital. The tumors were then dissected for tissue protein extraction or fixed with 4% paraformaldehyde in PBS. Cryosections were prepared following routine procedures. Immunohistochemical staining for nestin and GFAP were done on the sections, which were then examined under a fluorescent microscope (Model KX85, Japan). Nestin expression was further examined by immunoblotting. CCK-8 cell proliferation assay

Cell proliferation assays were performed by using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) according to the manufacturer’s instructions. C6 cells were seeded (1000 cell/ 100 ll) in a 96-well plate. At time points for measurement, 10 ll of the CCK-8 solution was added into each well of the plate and incubated for 4 hours. Absorbance was measured at 450 nm using VICTOR 3 1420 Multilabel Plate Reader C 2010 UICC Int. J. Cancer: 128, 343–351 (2011) V

Lu et al.

345

(Perkin Elmer, Waltham, MA). All conditions were done in duplicate and repeated three times. Western blot analysis

Immunocytochemistry staining

Cultured cells were fixed with 4% paraformaldehyde for 30 minutes in PBS (0.1 M, pH 7.4), and then permeablized with PBS containing 0.3% Triton X-100. Fixed cells were incubated with normal goat serum at room temperature for 30 minutes. Subsequently, the cells were incubated with primary antibodies for 2 hours at room temperature. After washing with PBS three times, the cells were incubated with secondary antibody, which were either TRITC labeled goat anti-rabbit IgG or FITC labeled goat anti-mouse IgG (1:200, Santa Cruz, CA) according to the nature of the primary antibodies. After further washing using PBS, photographs were taken on Olympus KX85 immunofluorescent microscope and Apogee Instruments Microscopy Fluorescence System (Model KX85, Japan). The primary antibodies used include mouse anti-nestin (1:100, Santa Cruz, CA), rabbit anti-GAPF (1:500, Chemicon, CA), and mouse anti-GFAP (1:200, Chemicon, CA) antibody. Suppression of tumor growth by nestin shRNA adenovirus (AdNes)

To show AdNes modification of tumor growth in vivo, mice were injected on day 0 with tumor cells (1 105)/100 ll, from the C6 rat glioblastoma cell line (n ¼ 12), tumor cells derived from subclone H1 (n ¼ 12), or tumor cells derived from subclone L1 (n ¼ 12). All injections were done into the subcutaneous areas of the mouse flank in a total volume of 100 ll (n ¼ 4 mice per group). When the tumors had grown to 45 to 55 mm2, the tumors were injected with AdNes or AdNull vectors (1 109 pfu in 20 ll). Control group were mice with tumors but no treatment. The size of each tumor was subsequently monitored three times a week for the next 4 weeks.

Figure 1. Heterogeneity in nestin expression within subpopulations of rat C6 glioma cells (a). Immunofluoresence staining indicates heterogeneous expression of nestin in the rat C6 cell line. Purple arrows mark the cells with high nestin expression, and white arrows mark the cells with low or absent nestin expression. (b). Western blot confirms heterogeneity in nestin expression in different subclones of the C6 cell line. Although the nestin expression levels were different in selected subclones, most of the subclones (17 of 20) express nestin. Three of the subclones have very low or even undetectable levels of nestin expression. The relative nestin expression level of these subclones were obtained by normalization to actin. H1 and H2 subclones have high expression of nestin, while L1 and L2 subclones have very low or absent nestin expression. These subclones are used in further experiments in this study. (Arrow indicates the right bands at 220KD, * marks nestin degradation bands). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Results Screening of rat and human glioblastoma cell lines for nestin expression

To determine the cell models for the study of nestin and glioblastoma carcinogenesis, we screened nestin expression levels in rat C6, human U87, and human U251 glioblastoma cell lines by immunocytofluorescence staining and western blot detection (data not shown). C6 cells were generally characterized by very strong nestin expression, while it was nearly undetectable in U87 and U251 cells. We therefore selected the nestin positive rat C6 glioblastoma cell line for use as a GBM cell model for further investigation. Expression profiles of nestin in rat C6 glioblastoma cells

Statistical analysis

Data are represented as mean 6 standard deviation and analyzed for statistical significance (p < 0.05) using the two tailed, paired student’s t-test. C 2010 UICC Int. J. Cancer: 128, 343–351 (2011) V

Immunostaining of rat C6 glioblastoma cells for nestin revealed a majority of cells positive for nestin expression and a minority of cells very low or completely negative for nestin. To confirm that two stable subpopulations of cells existed

Cancer Cell Biology

Cells were placed in lysis buffer (20 mM Tris-HCl pH 7.4, 1% NP40, 137 mM NaCl, 50 lM EDTA, 0.1% SDS, 0.5% deoxycholate, 1 mM NaF, 20 mM Na4P2O7, 2 mM Na3VO4, protease inhibitor cocktail (Roche), and 1 mM PMSF) and analyzed by immunoblotting (30 lg/lane). Primary antibodies used included anti-mouse-nestin, anti-GFAP, and anti-actin (Santa Cruz, CA). Secondary antibodies used in this study were IRDye 800 anti-mouse and IRDye 800 anti-rabbit Molecular Probes (Rockland Immunochemicals, PA). An Odyssey infrared imaging system (LI-COR, Biosciences, NE) was used to visualize the resulting immunoreactive proteins on a nitrocellulose membrane (Pall, NY). Images were acquired with the Odyssey infrared imaging system and analyzed by the software program as specified in the Odyssey software manual.

Cancer Cell Biology

346


Figure 2. Characterization of subclones with high and low nestin expression (a). Immunostaining of cells of four subclones (H1, H2, L1, L2) at passage 10 and passage 30 reveal that nestin expression or lack therefore is stable over long term culture. (b). Western blot reveals nestin expression of L1 and L2 cells protein is undetectable at passages 10 and 30, while H1 and H2 cells stably express the protein. (c). In vitro proliferation assays of nestin high and low subclones by measurement of CCK8 reveal no difference between subclones. These data are normalized to day 1 absorbance levels. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

within the rat C6 glioblastoma cell line that were either high or low for nestin expression, we isolated 20 subclones of C6 cells and characterized them for expression of nestin by immunofluorescence staining (Fig. 1a). Subclones were divided into one of two categories: high or low. High clones positively expressed nestin at similar fluorescent intensities while low cells were absent for the protein. Western blot further confirmed relative levels of nestin expression in high and low groups (Fig. 1b). For further characterization of subclones, two clones from the high group (H1, H2) and low group (L1, L2) were chosen for further expansion. Characterization of subclones with high/low nestin expression

To test whether subclones derived from high and low subpopulations of C6 cells maintained patterns of nestin expression over long-term culture, we cultured subclonal H1, H2, L1, and L2 cells for 30 passages. Immunostaining and western blot assays were conducted at passage 10 and passage 30, showing that nestin expression is maintained at high levels in H1 and H2 subclones over long-term culture (Figs. 2a and 2b). By comparison, L1 and L2 subclones expressed nestin at nearly absent levels for the duration of the experiment. To compare the growth rate of nestin high and low subclones, we performed a CCK8 proliferation assay. Subclonal

cells derived from H1, H2, L1 and L2 clones were seeded into a 96 well plate at a density of 1000 cells/well. Cell viability was measured by CCK8 every day for 72 hours. Proliferation rates for nestin high and low subclones were not significantly different (Fig. 2c), suggesting that expression of nestin does not affect in vitro proliferation of glioblastoma cells. In vivo re-expression of nestin in tumors derived from nestin low expression subclones

To test whether expression of nestin affects glioblastoma tumor growth in vivo, we injected 1 105 cells derived from H1, H2, L1 and L2 subclones into the dorsal flanks of five nude mice (5 per group Total ¼ 20). Tumor volume was measured at day 7 and 14 after injection. Cells of both nestin high and low subclones formed palpable tumors (45–55 mm2) after 14 days in all animals (Fig. 3a). However, tumors generated by L1 and L2 subclones were significantly smaller than tumors generated by H1 and H2 counterparts (p < 0.05). Tumors derived from L1, L2, H1 and H2 subclones were observed to grow at similar rates once they developed to a palpable size, with the primary difference in growth kinetics being the time required to reach a palpable state. To further characterize tumors derived from C6 cells, we stained cryosections of the tumors for nestin and the astrocyte marker GFAP. Surprisingly, we found that all tumors were positive for both nestin C 2010 UICC Int. J. Cancer: 128, 343–351 (2011) V

Lu et al.

Cancer Cell Biology

347

Figure 3. Nestin is re-expressed in glioblastoma tumors derived from nestin negative rat C6 subclones and U87 cells (a). Tumors derived from nestin positive subclones (H1 and H2) are significantly larger than tumors derived from nestin negative subclones (L1 and L2) at 7 and 14 days after cell transplantation (*p < 0.05). (b). Western blot data reveals nestin is re-expressed in tumors derived from subclones with low or absent nestin expression (L1 and L2). (c). Immunostaining indicates that nestin (green) and GFAP (red) are both expressed in tissues derived from all four subclones. (d). Immunofluoresence staining shows costaining of nestin (red) and GFAP (green) in U87 cells and glioblastoma tissue. In the U87 cell line, the nestin and GFAP expression are undetectable, but are highly expressed in tumor sections derived from these cells. (e). Western blot confirms absence of nestin and GFAP expression in the U87 cell line but presence of these two proteins in glioblastoma tissues derived from U87 cells. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

and GFAP irregardless of whether they were derived from nestin high or low clones (Fig. 3c). Positive nestin and GFAP expression in all tumors were confirmed by western blotting (Fig. 3b). The re-expression of nestin in tumors derived from L1 and L2 subclones led us to hypothesize an important role for nestin for in vivo carcinogenesis of glioblastoma. Nestin re-expression in nestin negative human U87 cell line after tumor formation in nude mice

To confirm the importance of nestin in the development of tumors derived from human cells, we repeated in vivo tumor C 2010 UICC Int. J. Cancer: 128, 343–351 (2011) V

formation assays in nude animals using the nestin negative human U87 glioblastoma cell line. We hypothesized that if nestin plays an important role in the development of glioblastoma, it should be re-expressed by U87 cells during tumor formation in an immunodeficient animal model. Immunofluorescence staining and western blot data confirmed that human tumors grown from nestin negative U87 cells were positive for both nestin and GFAP (Figs. 3d–3e). This data is consistent with that from nestin low rat C6 subclones, suggesting that nestin is a crucial factor in glioblastoma carcinogenesis.


Cancer Cell Biology

348

Figure 4. db-cAMP induces nestin expression in vitro (a). Immunofluoresence staining shows nestin and GFAP expression before and after db-cAMP treatment. Before induction, cells of all four subclones (H1, H2, L1 and L2) are negative for GFAP. After treatment, expression of nestin can be detected in L1 and L2 subclones, (b). Western blot confirms the expression of nestin and GFAP in cells treated with dbcAMP. (c). The relative expression level of Nestin and GFAP normalized to actin reveals an increase in GFAP expression in all clones and nestin expression in L1 and L2 clones. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Modulation of nestin expression in vitro

Upregulation in nestin expression during the course of tumorigenesis from both nestin negative rat C6 and human U87 subclones suggested that environmental cues may be responsible for modulation of protein expression. We therefore set to confirm that expression of nestin can be manipulated during differentiation of rat C6 cells under in vitro culture conditions. db-cAMP has been used in a number of studies to promote differentiation and GFAP expression in rat C6 cells to mimic glioblastoma development.23,24 We applied this model to examine changes in nestin expression during in vitro differentiation of C6 cells. H1, H2, L1 and L2 subclones were treated with db-cAMP for 72 hours. db-cAMP

caused morphological changes in target cells, causing protrusion of thinner and longer cellular processes as well as upregulation in markers of differentiation such as GFAP (Fig. 4a). More importantly, treatment with db-cAMP elicited nestin expression in a number of L1 and L2 subclones and caused loss of nestin expression in some H1 and H2 cells. Western blot confirmed induction of nestin expression in L1 and L2 subclones as well as expression of the astrocyte marker GFAP (Fig. 4b). These results were consistent with data obtained for in vivo differentiation for tumor development and provide proof of principle that nestin expression in glioblastoma cells can be modulated as a result of environmental signaling during the course of differentiation. C 2010 UICC Int. J. Cancer: 128, 343–351 (2011) V

Lu et al.

349

Figure 5. Knockdown of nestin expression in vivo attenuates tumor growth (a). Western blot demonstrates knockdown of nestin in C6 rat cells by shRNA adenovirus. Nestin expression levels are significantly reduced in cells treated with nestin shRNA as compared to the adenovirus-control and mock control groups. (b,c,d). Tumor volumes are dramatically reduced in the nestin shRNA adenovirus group as compared to adenoviral and mock controls 2–3 weeks after shRNA treatment. Compared to mock * p < 0.05; compared to adenoviral

Nestin silencing inhibits tumor formation in vivo

Re-expression of nestin in nestin negative glioblastoma subclones under in vivo and in vitro models of tumorigenesis strongly suggest an important role for this protein during glioblastoma development. We therefore hypothesized that knockdown of nestin in vivo could slow or inhibit tumor growth. Nestin shRNA adenovirus was constructed for in vivo knockdown investigation, and silencing efficiency was verified by infecting C6 cells and conducting western blot (Fig. 5a). C6 cells in which nestin knockdown was confirmed were not observed to have impaired proliferation compared to control cells as determined by CCK8 cell proliferation assays (Supporting Information Fig. S1). 105 normal C6 cells, H1 subclones and L1 subclones were injected into the dorsal flanks of nude mice respectively (n ¼ 12 per group). Once tumor volume reached 50 mm3, each group was divided into three subgroups (mock, adcontrol, adshRNA) and treated with adenovirus or control virus. 1 1010 plaque-forming unit (pfu) of nestin shRNA or control adenovirus was directly injected into each tumor. Mice without any injection were set as a mock control. Tumor volumes of each subgroup were recorded over 2 weeks following shRNA treatment. Animals treated with nestin shRNA injections grew tumors at significantly slower rates than mock or control animals (p < 0.05) (Fig. 5b). To confirm that these results were not specific to the rat C6 glioblastoma line, we also transduced human U87 glioblastoma cells with lentivirus driving nestin shRNA production. Human cells in which nestin shRNA was overexpressed were unable to form tumors as compared to control U87 cells. These data suggest that nestin RNAi could be used to inhibit glioblastoma progression, and that nestin is an important factor in glioblastoma tumorgenesis.

Discussion Nestin is overexpressed in a variety of neuronal tumors, including neurocytomas,25 neuroblastomas,26 glioblastomas,20 C 2010 UICC Int. J. Cancer: 128, 343–351 (2011) V

astrocytomas,20,25 medulloblastomas,27 and Schwannomas.28 However, several recent reports have highlighted the absence of this protein in a majority of glioblastoma cell lines.3,29 For example, Kurihara et al. demonstrated that of seven human glioma/glioblastoma cell lines: U251, KG-1C, NGM5, U87 MG, LN-Z308, NP-2 and T98G, only three cell lines had detectable levels of nestin expression, while nestin was entirely absent in the other cell lines.30 The results of our study indicate that expression of nestin within glial cancers is heterogenous. Nestin high and low subclones isolated from the same rat glioblastoma cell line C6 grew at identical rates in vitro and both gave rise to tumors following transplantation into an immunodeficient animal. Importantly, our results revealed that nestin re-expression in derivatives of nestin negative sublones is necessary for tumor formation to occur. Furthermore, we show that in vivo knockdown of nestin expression via shRNA injection significantly slows tumor growth. These results strongly indicate that nestin plays an important role during glial carcinogenesis and may be targeted for clinical treatment of glioblastoma. Nestin has been implicated as a marker of CNS neoplasia for almost two decades. However, the role of this protein in carcinogenesis is unclear.2 Nestin may be important for glial tumorigenesis by several mechanisms. First, nestin has been implicated as important to the maintenance of a highly proliferative state of undifferentiated cells to repair damaged tissue or sustain growth under various physiological conditions.31 Expression of nestin is thus upregulated in a number of healthy tissues following injury including in skeletal muscle,32 the spinal cord,33 brain34 and liver.35 Nestin is also implicated in the maintenance of progenitor cells in the brain during early development and is a marker of progenitor cell populations in the CNS through adulthood.36 In glial carcinogenesis, nestin may therefore play an important role in maintaining undifferentiated cells and allowing tumor cells to divide at a rapid rate. A recent report by Reimer et. al has shown that in undifferentiated and embryonic tissues, nestin acts to keep cells in a highly proliferative state by

Cancer Cell Biology

control #p < 0.05 (n ¼ 3).

350


Figure 6. Schematic model of inducible expression of nestin in glioblastoma carcinogenesis. [Color figure can be viewed in the

Cancer Cell Biology

online issue, which is available at wileyonlinelibrary.com.]

sequestering the glucocorticoid receptor (GR) within the cell cytoplasm. Retention of GR by nestin prevents its translocation to the nucleus and thereby blocks GR-induced growth arrest.37 In our experiments, nestin negative subclones were observed to proliferate at identical rates in vitro to nestin positive counterparts. However, under in vivo conditions, nestin negative subclones seeded tumors at slower rates than nestin positive cells. Importantly, expression of nestin was observed in all tumors derived from nestin negative clone implying that upregulation in nestin is required for tumors to grow at high rates. The crucial role of nestin in maintaining a proliferative cell state and preventing GR induced growth arrest may account for the discrepancies observed. Although knockdown of nestin was not observed in this study to have an effect upon the in vitro proliferation of gliobastoma cells, further experiments are needed to confirm the exact mechanism that is responsible for the importance of nestin to glial tumorigenesis.

An alternative mechanism by which nestin may be important to development of CNS neoplasia is nestin’s role in promotion of cell survival in progenitor and tumor cell populations. It has been known for some time that downregulation of nestin activates Cdk5/p35 dependent pathways of apoptosis.38,39 Recently another report by Chen et al. has demonstrated that nestin plays a crucial role in development by prevention of apoptosis in neural progenitor cell populations and that suppression of nestin induces apoptosis in these cells.40 In our experiments, knockdown of nestin by in vivo delivery of shRNA was observed to significantly slow tumor growth. Induction of apoptosis in progenitor cell populations may be an active mechanism that accounts for these results. Again, further experiments are needed to confirm whether this mechanism can be applied to treatment of glial neoplasias. If nestin does play a crucial role in prevention of apoptosis in progenitor cell populations, knockdown of the gene may selectively target tumor initiating cancer stem cells and may result in the reduction of primary tumor establishment, growth, and recurrence of these cancers. In conclusion, we have identified that the IF nestin has a heterogenous expression pattern in glioblastoma cell lines and within tumors derived from these cells (Fig. 6). We have demonstrated that nestin re-expression in tumor tissue greatly contributes to glioblastoma carcinogenesis and that nestin may be targeted therapeutically to treat glial tumors. Our identification that nestin expression can be induced in cancer cells as a result of environmental signaling facilitates the understanding of further signaling pathways involved in glial carcinogenesis. This data should yield important findings for future clinical treatments of glioblastoma and improve our understanding of the function of nestin in carcinogenesis.

References 1.

2.

3.

4.

Maher EA, Furnari FB, Bachoo RM, Rowitch DH, Louis DN, Cavenee WK, DePinho RA. Malignant glioma: genetics and biology of a grave matter. Genes Dev 2001;15:1311–33. Dahlstrand J, Collins VP, Lendahl U. Expression of the class VI intermediate filament nestin in human central nervous system tumors. Cancer Res 1992;52: 5334–41. Strojnik T, Rosland GV, Sakariassen PO, Kavalar R, Lah T. Neural stem cell markers, nestin and musashi proteins, in the progression of human glioma: correlation of nestin with prognosis of patient survival. Surg Neurol 2007;68: 133–43; discussion 43–4. Yang XH, Wu QL, Yu XB, Xu CX, Ma BF, Zhang XM, Li SN, Lahn BT, Xiang AP. Nestin expression in different tumours and its relevance to malignant grade. J Clin Pathol 2008;61:467–73.

5.

6.

7.

8.

Ehrmann J, Kolar Z, Mokry J. Nestin as a diagnostic and prognostic marker: immunohistochemical analysis of its expression in different tumours. J Clin Pathol 2005;58:222–3. Teranishi N, Naito Z, Ishiwata T, Tanaka N, Furukawa K, Seya T, Shinji S, Tajiri T. Identification of neovasculature using nestin in colorectal cancer. Int J Oncol 2007;30:593–603. Rogelsperger O, Ekmekcioglu C, Jager W, Klimpfinger M, Konigsberg R, Krenbek D, Sellner F, Thalhammer T. Coexpression of the melatonin receptor 1 and nestin in human breast cancer specimens. J Pineal Res 2009;46:422–32. Kleeberger W, Bova GS, Nielsen ME, Herawi M, Chuang AY, Epstein JI, Berman DM. Roles for the stem cell associated intermediate filament Nestin in prostate cancer migration and metastasis. Cancer Res 2007;67:9199–206.

9.

10.

11.

12.

13.

Kawamoto M, Ishiwata T, Cho K, Uchida E, Korc M, Naito Z, Tajiri T. Nestin expression correlates with nerve and retroperitoneal tissue invasion in pancreatic cancer. Hum Pathol 2009;40:189–98. Hockfield S, McKay RD. Identification of major cell classes in the developing mammalian nervous system. J Neurosci 1985;5:3310–28. Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new class of intermediate filament protein. Cell 1990;60: 585–95. Mokry J, Cizkova D, Filip S, Ehrmann J, Osterreicher J, Kolar Z, English D. Nestin expression by newly formed human blood vessels. Stem Cells Dev 2004;13: 658–64. Kitai R, Horita R, Sato K, Yoshida K, Arishima H, Higashino Y, Hashimoto N, Takeuchi H, Kubota T, Kikuta K. Nestin expression in astrocytic tumors delineates


Lu et al.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.


Nestin and its association with p35. Mol Cell Biol 2003;23:5090–106. Takanaga H, Yoshitake T, Hara S, Yamasaki C, Kunimoto M. cAMP-induced astrocytic differentiation of C6 glioma cells is mediated by autocrine interleukin-6. J Biol Chem 2004;279:15441–7. Segovia J, Lawless GM, Tillakaratne NJ, Brenner M, Tobin AJ. Cyclic AMP decreases the expression of a neuronal marker (GAD67) and increases the expression of an astroglial marker (GFAP) in C6 cells. J Neurochem 1994;63:1218–25. Ying Z, Gonzalez-Martinez J, Tilelli C, Bingaman W, Najm I. Expression of neural stem cell surface marker CD133 in balloon cells of human focal cortical dysplasia. Epilepsia 2005;46:1716–23. Biagiotti T, D’Amico M, Marzi I, Di Gennaro P, Arcangeli A, Wanke E, Olivotto M. Cell renewing in neuroblastoma: electrophysiological and immunocytochemical characterization of stem cells and derivatives. Stem Cells 2006; 24:443–53. Parker K, Pilkington GJ. Morphological, immunocytochemical and flow cytometric in vitro characterisation of a surfaceadherent medulloblastoma. Anticancer Res 2005;25:3855–63. Parfitt JR, McLean CA, Joseph MG, Streutker CJ, Al-Haddad S, Driman DK. Granular cell tumours of the gastrointestinal tract: expression of nestin and clinicopathological evaluation of 11 patients. Histopathology 2006; 48:424–30. Belot N, Rorive S, Doyen I, Lefranc F, Bruyneel E, Dedecker R, Micik S, Brotchi J, Decaestecker C, Salmon I, Kiss R, Camby I. Molecular characterization of cell substratum attachments in human glial tumors relates to prognostic features. GLIA 2001;36:375–90. Kurihara H, Zama A, Tamura M, Takeda J, Sasaki T, Takeuchi T. Glioma/ glioblastoma-specific adenoviral gene expression using the nestin gene regulator. Gene Therapy 2000;7:686–93.

31. Wiese C, Rolletschek A, Kania G, Blyszczuk P, Tarasov KV, Tarasova Y, Wersto RP, Boheler KR, Wobus AM. Nestin expression—a property of multilineage progenitor cells? Cell Mol Life Sci 2004;61:2510–22. 32. Vaittinen S, Lukka R, Sahlgren C, Hurme T, Rantanen J, Lendahl U, Eriksson JE, Kalimo H. The expression of intermediate filament protein nestin as related to vimentin and desmin in regenerating skeletal muscle. J Neuropathol Exp Neurol 2001;60:588–97. 33. Shibuya S, Miyamoto O, Auer RN, Itano T, Mori S, Norimatsu H. Embryonic intermediate filament, nestin, expression following traumatic spinal cord injury in adult rats. Neuroscience 2002;114:905–16. 34. Tamagno I, Schiffer D. Nestin expression in reactive astrocytes of human pathology. J Neuro-Oncol 2006;80:227–33. 35. Gleiberman AS, Encinas JM, Mignone JL, Michurina T, Rosenfeld MG, Enikolopov G. Expression of nestin-green fluorescent protein transgene marks oval cells in the adult liver. Dev Dyn 2005;234:413–21. 36. Lendahl U, Zimmerman LB, Mckay RDG. Cns stem-cells express a new class of intermediate filament protein. Cell 1990;60: 585–95. 37. Reimer R, Helmbold H, Szalay B, Hagel C, Hohenberg H, Deppert W, Bohn W. Nestin modulates glucocorticoid receptor function by cytoplasmic anchoring. PLos One 2009;4. 38. Sahlgren CM, Mikhailov A, Vaittinen S, Pallari HM, Kalimo H, Pant HC, Eriksson JE. Cdk5 regulates the organization of nestin and its association with p35. Mol Cell Biol 2003;23:5090–106. 39. Sahlgren CM, Pallari HM, He T, Chou YH, Goldman RD, Eriksson JE. A nestin scaffold links Cdk5/p35 signaling to oxidant-induced cell death. EMBO J 2006; 25:4808–19. 40. Chen HL, Yuh CH, Wu KK. Nestin is essential for zebrafish brain and eye development through control of progenitor cell apoptosis. PLos One 2010;5.

Cancer Cell Biology

14.

tumor infiltration. Brain Tumor Pathol 2010;27:17–21. Bonnin JM, Rubinstein LJ. Immunohistochemistry of central nervous system tumors. Its contributions to neurosurgical diagnosis. J Neurosurg 1984; 60:1121–33. Sampath P, Weaver CE, Sungarian A, Cortez S, Alderson L, Stopa EG. Cerebrospinal fluid (vascular endothelial growth factor) and serologic (recoverin) tumor markers for malignant glioma. Cancer Control 2004;11:174–80. Chumbalkar VC, Subhashini C, Dhople VM, Sundaram CS, Jagannadham MV, Kumar KN, Srinivas PN, Mythili R, Rao MK, Kulkarni MJ, Hegde S, Hegde AS, et al. Differential protein expression in human gliomas and molecular insights. Proteomics 2005;5:1167–77. Michalczyk K, Ziman M. Nestin structure and predicted function in cellular cytoskeletal organisation. Histol Histopathol 2005;20:665–71. Wei LC, Shi M, Cao R, Chen LW, Chan YS. Nestin small interfering RNA (siRNA) reduces cell growth in cultured astrocytoma cells. Brain Res 2008;1196: 103–12. Dahlstrand J, Lardelli M, Lendahl U. Nestin mRNA expression correlates with the central nervous system progenitor cell state in many, but not all, regions of developing central nervous system. Brain Res Dev Brain Res 1995;84:109–29. Almqvist PM, Mah R, Lendahl U, Jacobsson B, Hendson G. Immunohistochemical detection of nestin in pediatric brain tumors. J Histochem Cytochem 2002;50:147–58. Chou YH, Khuon S, Herrmann H, Goldman RD. Nestin promotes the phosphorylation-dependent disassembly of vimentin intermediate filaments during mitosis. Mol Biol Cell 2003;14: 1468–78. Sahlgren CM, Mikhailov A, Vaittinen S, Pallari HM, Kalimo H, Pant HC, Eriksson JE. Cdk5 regulates the organization of

351