To elucidate the mechanisms, a cell cycle-DNA content analysis was performed on splenic T cells of murine CMV (MCMV)-infected BALB/c mice. T cells from ...
JOURNAL OF VIROLOGY, Aug. 1995, p. 4769–4775 0022-538X/95/$04.0010 Copyright 1995, American Society for Microbiology
Vol. 69, No. 8
Induction of Apoptosis of T Cells by Infecting Mice with Murine Cytomegalovirus HIROKI YOSHIDA,1* HIROSHI SUMICHIKA,1 SHINJIRO HAMANO,1 XIANGDONG HE,1 YOICHI MINAMISHIMA,2 GENKI KIMURA,3 AND KIKUO NOMOTO1 Department of Immunology1 and Department of Virology,3 Medical Institute of Bioregulation, Kyushu University, Fukuoka, and Department of Microbiology, Miyazaki Medical College, Miyazaki,2 Japan Received 21 February 1995/Accepted 18 April 1995
Cytomegalovirus (CMV) is associated with several lymphocyte dysfunctions, but the precise mechanisms of the dysfunctions are still unclear. To elucidate the mechanisms, a cell cycle-DNA content analysis was performed on splenic T cells of murine CMV (MCMV)-infected BALB/c mice. T cells from mice infected with 3 3 103 PFU of MCMV contained a higher percentage of hypodiploid nuclei after 12 or 24 h of culture than those from naive mice. T cells from infected mice also contained a larger amount of fragmented DNA. Taken together, these results suggested that infection with MCMV induced the apoptotic cell death of T cells. This induction of apoptosis accounted for the dysfunction of lymphocytes, at least partially. Flow cytometric analysis showed that T cells as well as B cells from MCMV-infected mice expressed an augmented level of Fas antigen, an apoptosis-associated cell surface molecule, which might be the cause of the apoptosis of cells. T cells from MCMV-infected C57BL/6-lpr/lpr mice with mutations at the lpr/fas locus, however, also showed a substantial level of apoptosis, which was reproducibly lower than that seen in C57BL/6 mice. Therefore, it was suggested that the Fas-mediated pathway contributed to but was not sufficient for the induction of apoptosis and that mechanisms other than the Fas-associated pathway were also involved in the induction of apoptosis. Human cytomegalovirus (CMV) is a member of the betaherpesvirus subfamily of the herpesvirus group. In immunocompetent hosts, CMV infection is effectively controlled and the virus persists in a latent state. However, in immunocom-
promised hosts, such as patients with AIDS or patients who have undergone bone marrow transplantation, the virus is a serious pathogen associated with significant morbidity and mortality in a variety of clinical syndromes involving interstitial
FIG. 1. Decrease in number and low responsiveness of splenocytes after infection with MCMV. (a) Female BALB/c mice were inoculated intraperitoneally with 3 3 103 PFU of MCMV on day 0. On days 3, 5, 7, 10, and 14, the total number of spleen cells was determined by trypan blue staining (open squares). The closed square shows the total number of spleen cells of mock-infected mice on day 14. (b) Nylon wool-nonadherent T cells were obtained from naive or infected mice. Cells were cultured in the presence of ConA (5 mg/ml) in 200 ml of complete culture medium at 2 3 105 cells per well, together with the same number of spleen cells irradiated with 30 Gy, in the presence or absence of 50 U of IL-2 per ml for 72 h at 378C. During the last 6 h, the cells were pulsed with [3H]thymidine, and the incorporation of [3H]thymidine was measured by liquid scintillation counting.
* Corresponding author. Mailing address: Department of Immunology, Medical Institute of Bioregulation, Kyushu University, 3-1-1, Maidashi, Higashi-ku, Fukuoka, 812-82 Japan. Phone: 92-641-1151. Fax: 92-641-1315. 4769
4770
YOSHIDA ET AL.
J. VIROL.
FIG. 3. Apoptosis of T cells from MCMV-infected mice: determination by DNA fragmentation. T cells from naive or infected mice were obtained and cultured for 0 or 12 h as described in the legend to Fig. 2. The fraction containing small fragmented DNA was separated from T cells as described in Materials and Methods and was dissolved in 50 ml of Tris-EDTA buffer. Ten microliters of each sample was applied to a NuSieve 3:1 gel and electrophoresed; this was followed by ethidium bromide staining.
FIG. 2. Apoptosis of T cells from MCMV-infected mice: determination by flow cytometry. Nylon wool-nonadherent splenic T cells were obtained from naive mice or mice infected with 3 3 103 PFU of MCMV 5 days previously. Cells were cultured in the presence or absence of ConA (5 mg/ml) for 0, 12, and 24 h at 378C and were stained with propidium iodide. Flow cytometric detection of apoptosis was performed as described in Materials and Methods. The number on each panel shows the percentage of hypodiploid nuclei (region K). The bottom panel shows the apoptosis in freshly isolated T cells from mice infected with 104 PFU 5 days previously.
antigen(s) (9, 12), mechanisms of the suppressed lymphocyte function are still unclear. In this paper, we provide evidence that T cells from mice infected with MCMV are prone to apoptotic cell death, which might, at least in part, account for the suppressed T-cell functions. Furthermore, we demonstrate that the expression of Fas antigen, a gene product which is involved in programmed cell death (41, 44), is implicated in the apoptotic cell death seen in MCMV infection. MATERIALS AND METHODS
pneumonitis, colitis, hepatitis, and immunosuppression (2, 18, 21). Murine CMV (MCMV), because of its similarities in structure and biology to human CMV, has provided useful models for acute, chronic, and latent human CMV infection. Infections with some types of viruses are associated with changes in lymphocyte activity. A number of immunologic aberrations in patients with human CMV infection have been reported (24, 25). For MCMV infection, some functional abnormalities of lymphocyte responses also have been reported. These abnormalities include depressed lymphocyte responses to mitogens (3, 28, 39), depressed responses in mixed leukocyte cultures (20), depressed antibody responses to several antigens (35), and low efficacies of priming of T cells to several antigens (10, 40). These abnormalities are often accompanied by a reduction in T-cell numbers (7, 11, 32, 38). Although some of these abnormalities might be attributed to the suppressed expression of a major histocompatibility complex and/or viral
Mice. Female BALB/c mice and female C57BL/6 mice were purchased from Japan SLC, Inc. (Hamamatsu, Japan). C57BL/6-lpr/lpr mice obtained from Shizuoka Laboratory Animal Center (Shizuoka, Japan) were bred under specificpathogen-free conditions at our institute. All mice were used at 8 to 10 weeks of age. Virus and infection of mice. The Smith strain of MCMV was used in all experiments. Salivary gland-passaged MCMV was prepared by homogenizing salivary glands of BALB/c mice that had been infected with 104 PFU of MCMV 3 weeks previously. The virus stock gave a titer of 107 PFU/ml. BALB/c mice were inoculated intraperitoneally with 3 3 103 PFU of MCMV in a volume of 200 ml of Hanks’ balanced salt solution on day 0. C57BL/6 and C57BL/6-lpr/lpr mice were infected with 3 3 104 PFU of MCMV. In vitro proliferation of T cells. Nylon wool-nonadherent T cells (.90% purity) were cultured in the presence of concanavalin A (ConA) (5 mg/ml) in 200 ml of complete culture medium in 96-well round-bottomed plates (Corning Glass Works, Corning, N.Y.) at 2 3 105 cells per well, together with the same number of spleen cells that had been irradiated with 30 Gy, in the presence or absence of 50 U of interleukin-2 (IL-2) (kindly provided by Takeda Chemical Industries, Ltd., Osaka, Japan) per ml. (In this report, the units for IL-2 are Japan reference units.) Cells were cultured for 72 h at 378C with 5% CO2 and pulsed with [3H]thymidine 6 h before harvest, and the incorporation of [3H]thymidine was measured by liquid scintillation counting.
VOL. 69, 1995
APOPTOSIS OF T CELLS IN MCMV INFECTION
4771
FIG. 4. Flow cytometric analysis of Fas expression in MCMV-infected mice. A single-cell suspension of splenocytes from naive mice or infected mice was aliquoted (106 cells per sample). Cells were stained with phosphatidylethanolamine-labelled anti-Fas monoclonal antibody along with fluorescein isothioyanate-labelled anti-CD3ε, anti-CD4, anti-CD8 monoclonal antibody, or anti-B220. The surface expression of each molecule was analyzed with an EPICS XL flow cytometer. The shaded area in each panel shows the fluorescence pattern of unstained samples.
Flow cytometric detection of apoptotic cells. Flow cytometric detection of apoptosis was performed as described by Fried et al. (14) and Nicoletti et al. (33). Briefly, nylon wool-nonadherent splenic T cells (106) were suspended in 1 ml of hypotonic fluorochrome solution (propidium iodide [50 mg/ml] in 0.1% sodium citrate plus 0.1% Triton X-100 [Sigma]). Cell suspensions were placed at 48C in the dark overnight before the flow cytometric analysis. The propidium iodide fluorescence of individual nuclei was measured with an EPICS XL flow cytometer (Coulter, Hialeah, Fla.). Detection of DNA fragmentation. Fragmented DNA was extracted from splenic T cells as described elsewhere (37). Briefly, nylon wool-nonadherent T cells were cultured at a concentration of 106/ml in the presence or absence of ConA (5 mg/ml) for 0, 12, and 24 h. Cells were pelleted by centrifugation for 10 min at 200 3 g and 48C. Cell pellets were lysed with 500 ml of TTE solution (Tris-EDTA buffer [pH 7.4] containing 0.2% Triton X-100) by vigorous vortexing. The fraction containing small fragmented DNA was separated from intact chromatin by centrifugation for 10 min at 13,000 3 g and 48C. Supernatants (500 ml) containing fragmented DNA were mixed with 100 ml of ice-cold 5 M NaCl and 700 ml of ice-cold isopropanol and placed at 2208C overnight to precipitate DNA. DNA pellets were precipitated by centrifugation, washed with 70% ethanol, dried, and dissolved with 50 ml of Tris-EDTA buffer. Ten microliters of each sample was applied to a NuSieve 3:1 gel (FMC BioProducts, Rockland, Maine) and electrophoresed; this was followed by ethidium bromide staining. Flow cytometric analysis of Fas expression. A single-cell suspension of splenocytes from naive mice or mice infected with 3 3 103 PFU of MCMV 5 days previously was aliquoted (106 cells per sample). Cells were stained with phosphatidylethanolamine-labelled anti-Fas monoclonal antibody (Pharmingen, San Diego, Calif.) along with fluorescein isothiocyanate-labelled anti-CD3ε (1452C11, generously provided by J. A. Bluestone, Chicago University, Chicago, Ill.), anti-CD4 (Gibco BRL, Gaithersburg, Md.), anti-CD8 monoclonal antibody (Gibco BRL), and anti-B220 (Pharmingen). The surface expression of each molecule was analyzed with an EPICS XL flow cytometer (Coulter). Detection of virus DNA in T cells by PCR amplification. DNA was extracted from nylon wool-nonadherent splenic T cells of mice. Briefly, 106 T cells were lysed in 200 ml of 13 PCR buffer (Perkin-Elmer, Branchburg, N.J.) (103 PCR buffer is 100 mM Tris-HCl [pH 8.3] and 500 mM KCl) in the presence of 0.5% Tween 20 and 100 mg of proteinase K (Boehringer Mannheim GmbH, Mannheim, Germany) per ml for 45 min at 568C. After inactivation of proteinase K by a 10-min incubation of samples at 958C, aliquots were subjected to PCR amplification. PCR amplification of the immediate-early (IE) gene of MCMV and exon 2 of the CD3d chain was performed as follows. A series of serial dilutions (1/10) of DNA extracted from T cells as described above was prepared. Twenty microliters of each diluted sample was applied for amplification of the IE gene or exon 2 of CD3d with 2.5 U of Taq DNA polymerase (AmpliTaq; Perkin-Elmer) in the presence of deoxynucleoside triphosphates and an appropriate pair of primers. The sense and antisense primers are as follows: IE sense; TAGGAGAGGGCA CAGAGGATT; IE antisense, ATGGAAACAGAAACTTACTTG; CD3d exon 2 sense, CTTCAAGATACAAGTGACCG; CD3d exon 2 antisense, TTCGGT AATGGACTTGCACA.
The PCR products were electrophoresed through a 1.8% agarose gel; this was followed by ethidium bromide staining. In vitro infection of T cells with MCMV. Nylon wool-nonadherent T cells were infected with MCMV at a multiplicity of infection of 0.5 or mock infected for 1 h. The cells were then washed and cultured in complete medium for 12, 24, or 48 h. In other experiments, BALB/c embryonic fibroblasts or NIH 3T3 cells were infected or mock infected with MCMV likewise. Flow cytometric detection of apoptotic cells was performed as described above.
RESULTS Decrease in number of spleen cells and unresponsiveness of spleen cells after infection with MCMV. Figure 1a shows representative data for the spleen cell number after infection with 3 3 103 PFU of MCMV. The total cell number decreased on day 3 after infection and increased on day 5 and thereafter. On day 5 after infection, when the virus titer in the spleen reached its peak (data not shown), nylon wool-nonadherent T cells were stimulated with ConA (5 mg/ml), with or without 50 U of IL-2, in the presence of irradiated spleen cells (Fig. 1b). As has been reported previously (39), T cells from infected mice showed a remarkably low response to the stimulation with ConA, even in the presence of IL-2. The results were highly reproducible in three independent experiments. Apoptotic cell death of T cells from infected mice. To examine the reason for the low degree of responsiveness of the T cells from infected mice, we performed a cell cycle-DNA content analysis. Spleen T cells from naive mice or mice infected with MCMV 5 days previously were cultured for 0, 12, and 24 h in the presence or absence of ConA (5 mg/ml) (Fig. 2). Freshly isolated T cells had a few percent hypodiploid DNA, with a slightly higher percentage of hypodiploid DNA in T cells from infected mice. After 12 h of culture, however, T cells from infected mice showed more than 25% hypodiploid DNA, whereas T cells from naive mice had as much as 8% hypodiploid DNA. The percentage of hypodiploid DNA increased after 24 h of culture and was much higher in T cells from infected mice than in those from naive mice. These data from the cell cycle-DNA content analysis indicated that T cells from infected mice had a higher percentage of apoptotic nuclei with a smaller content of DNA. When mice were infected with 104
4772
YOSHIDA ET AL.
J. VIROL.
FIG. 6. Detection of a viral gene in splenic T cells by PCR. DNA was extracted from splenic T cells of mice as described in Materials and Methods. PCR amplification of the IE gene of MCMV and the CD3d chain was performed on a series of serial dilutions (1/10) of DNA samples (lanes 1 to 5) or without DNA samples (lane 6) with an appropriate pair of primers. The PCR products were electrophoresed and visualized with ethidium bromide staining.
FIG. 5. Apoptosis in C57BL/6 and C57BL/6-lpr/lpr mice. C57BL/6 or C57BL/ 6-lpr/lpr mice were infected with 3 3 104 PFU of MCMV. On day 5 after infection, splenic T cells were obtained from infected mice or naive mice of both strains. Cells were cultured for 0 or 12 h at 378C and were stained with propidium iodide. Flow cytometric detection of apoptosis was performed as described in Materials and Methods. The number on each panel shows the percentage of hypodiploid nuclei (region K).
PFU of the virus, even freshly isolated T cells showed extensive apoptosis (Fig. 2, bottom). Next, we examined DNA fragmentation in the nuclear extracts by the electrophoretic method. Figure 3 clearly shows the extensive DNA fragmentation, which is another characteristic of apoptotic cell death, in T cells from infected mice after 12 h of culture irrespective of whether the cells were stimulated with ConA. Therefore, as substantiated by flow cytometric analysis and fragmentation of DNA, apoptotic death was shown to be extensively induced in T cells from infected mice and was thought to account, at least partially, for the low degree of responsiveness of T cells of infected mice. The possibility of the so-called anergic state being the reason for the low responsiveness is unlikely, as the T cells still showed the low responsiveness in the presence of 50 U of IL-2 per ml (Fig. 1b). On day 3 after infection, when the numbers of spleen cells were at their nadir, T cells showed
apoptosis patterns almost comparable to, or slightly less extensive than, those on day 5 (data not shown). Increased Fas antigen expression in T cells from infected mice. Apoptotic cell death is induced with several kinds of reagents, cytokines, and stimulations. Among them, stimulation via Fas antigen, which is a cell surface protein belonging to the tumor necrosis factor receptor family (41, 44), is one of the well-known mechanisms to mediate apoptosis. The involvement of Fas antigen in some virus infections, including human immunodeficiency virus infection, has been reported (4, 17). We therefore examined the expression of Fas antigen on T cells, and also on B cells, from infected mice (Fig. 4). In naive mice, CD31 cells, CD41 cells, CD81 cells, and B2201 cells were almost negative for Fas expression (Fig. 4, lower panels). In mice infected with MCMV 5 days previously, however, the expression of Fas antigen was augmented on CD31 cells, CD41 cells, and B2201 cells (Fig. 4, upper panels). The expression of Fas antigen on CD81 cells was not altered. Thus, the Fas system appeared to be involved in the apoptosis of T cells from MCMV-infected mice. Since the expression of Fas antigen was augmented on B cells from infected mice, apoptotic cell death was thought to occur in B cells also. Because of the spontaneous induction of apoptotic cell death in splenic B cells (5), however, it was difficult to clearly demonstrate the difference in apoptosis by flow cytometric or electrophoretic analysis (data not shown). Apoptotic cell death in C57BL/6-lpr/lpr mice. Since the augmented expression of Fas antigen was implicated in the induction of apoptotic cell death in MCMV-infected mice, we evaluated apoptosis in C57BL/6-lpr/lpr mice (Fig. 5). In C57BL/6lpr/lpr mice, mutations at the lpr (lymphoproliferation) locus, which maps to the fas locus, cause the impaired expression of Fas antigen (1) and the ‘‘lymphoaccumulation’’ which occurs because the cells are less susceptible to death than their normal counterparts (6). Naive C57BL/6 mice and C57BL/6-lpr/lpr mice showed almost equivalent percentages of apoptosis of T cells after 12 h of culture in the presence of ConA (9.1 and 11.9%, respectively). When mice were infected with 104 PFU of MCMV 5 days previously, C57BL/6-lpr/lpr mice showed a lower percentage of hypodiploid cells than C57BL/6 mice (24.8 and 37.8%, respectively). The results were similar to those obtained without ConA stimulation (data not shown) and were highly reproducible in three independent experiments. The involvement of Fas antigen, therefore, was implicated in the
VOL. 69, 1995
APOPTOSIS OF T CELLS IN MCMV INFECTION
4773
FIG. 7. Effect of in vitro infection on T cells. Nylon wool-nonadherent T cells of BALB/c mice were infected with MCMV at a multiplicity of infection of 0.5 or mock infected with diluted homogenates of salivary glands for 1 h. The cells then were washed and cultured in complete medium for 12, 24, or 48 h. A cell cycle-DNA content analysis was performed. The number on each panel shows the percentage of hypodiploid nuclei (region K).
induction of apoptosis, indicating at the same time that another factor(s) was also involved. Detection of a viral gene in T cells. Infections with some types of viruses have been reported to induce apoptosis (13, 15, 22, 26, 29, 31, 34, 36, 42). On day 5 after infection with 3 3 103 PFU of MCMV, spleens contained approximately 0.8 3 103 to 1.0 3 103 PFU of MCMV per organ as determined by the conventional plaque assay (data not shown). However, PCR amplification of the IE gene of MCMV showed that 5 3 103 T cells contained a clearly detectable level of the IE gene (at least 1/10 of the copy number of the CD3 gene) (Fig. 6). Thus, it was suggested that T cells contained a substantial amount of MCMV genes, though most of the genes appeared to be nonproductive. We therefore examined whether the infection of cells with MCMV itself induced apoptosis. First, nylon woolnonadherent T cells were infected with MCMV at a multiplicity of infection of 0.5 or mock infected for 1 h. Cells then were washed and cultured for 12, 24, or 48 h, and a DNA content analysis was performed (Fig. 7). T cells infected with virus in vitro showed levels of apoptosis similar to or rather lower than those of mock-infected T cells. The percentages of apoptotic cells in in vitro-infected or mock-infected cells were slightly higher than that in untreated cells (Fig. 2 and 7), which might result from treatment of cells with salivary gland homogenates. Moreover, neither embryonic fibroblasts nor NIH 3T3 cells showed apoptosis after in vitro infection with MCMV (data not shown). DISCUSSION T lymphocytes become activated in response to adequate stimulation to undergo proliferation or to be effector cells; this is accompanied by the expression of a variety of genes, including those for various cytokines or effector molecules (43). Under several circumstances, however, T lymphocytes respond to the stimulation by a programmed cell death response or apoptosis rather than activation. The regulation of responses to the stimulation to death or activation is critical for normal
immune responses, and the factors influencing this balance include the differentiation state of the responding T lymphocytes, costimulatory molecules on the antigen-presenting cells, various cytokines, and expression of apoptosis-associated molecules such as Bcl-2 (19) or Fas (44). In our study, we demonstrated that T cells from mice infected with MCMV were prone to apoptotic cell death. This apoptotic cell death may, at least partially, account for the decrease in the number of spleen cells and the low level of responsiveness of the T cells of infected mice (Fig. 1) and the altered functions of lymphocytes of infected mice. We did not examine the apoptosis in B cells, because B cells (or whole spleen cells) showed spontaneous apoptosis after culture (5) and therefore it was difficult to quantitatively evaluate the apoptosis. Flow cytometric analysis, however, demonstrated that the decrease in the number of spleen cells involved not only T cells but also B cells (data not shown). Moreover, the expression of Fas antigen was also augmented on B cells (Fig. 4; see below). It was strongly suggested that apoptosis was also induced in B cells during infection with MCMV. Koga et al. have reported the apoptosis of immature thymocytes only when they are stimulated with anti-CD3 antibody in vivo in mice persistently infected with MCMV (27). In our experimental system with acute MCMV infection, apoptosis was induced without any stimulation. Stimulation with ConA did not seem to affect the results (Fig. 2 and 3). Moreover, freshly isolated T cells also showed extensive apoptosis when mice were infected with 104 PFU of the virus (Fig. 2). It was suggested that the mechanisms of the induction of apoptosis might differ in acute and persistent infections. Alternatively, the mechanisms might differ for different organs, although the thymus in acutely infected mice showed no apparent evidence of apoptosis (data not shown). Selgrade et al. have reported low responsiveness of lymphocytes to stimulation with mitogens, which continued up to day 21 (39). Although on day 14 after infection, when spleens contained no detectable virus by a conventional plaque assay, T cells showed an almost normal response to stimulation with ConA and showed no apparent
4774
YOSHIDA ET AL.
evidence of apoptosis under our experimental conditions (data not shown), T cells (and possibly B cells) in the later phase of infection might be functionally different from normal cells and might show aberrant behavior when stimulated. Koga et al. (27) demonstrated an altered calcium influx in thymocytes of latently infected mice, and such an intracellular functional alteration, if any, might also account for the depressed cell functions. Augmented expression of Fas antigen was observed on T cells as well as B cells of infected mice. Among several mechanisms associated with apoptosis, therefore, the Fas-mediated pathway was implicated in the induction of apoptosis. Augmented expression of Fas was also reported to occur in infection with other type of viruses (4, 16, 17, 26, 42). To our surprise, however, C57BL/6-lpr/lpr mice showed a substantial level of apoptosis (Fig. 5). Since the percentage of apoptotic nuclei was reproducibly lower in C57BL/6-lpr/lpr mice than in C57BL/6 mice, the involvement of the Fas-mediated pathway was strongly suggested as well. The apoptosis observed in C57BL/6-lpr/lpr mice might result from the leaky phenotype of the lpr mutation or might suggest other mechanisms to induce apoptosis. The involvement of other mechanisms associated with apoptosis, including nitric oxide, oxidative stress (8), and cytokines such as tumor necrosis factor alpha (30), was also implicated, and the relative importance of such mechanisms compared with that of the Fas-mediated pathway has yet to be evaluated. CD81 cytotoxic T lymphocytes (CTL) induce apoptotic cell death in their target cells by releasing certain serine esterases and perforin along with the Fas-mediated system (23). One may argue that the apoptosis in our system might result from the effect of CTL. The involvement of CD81 CTL is unlikely, however, because CD81 T cells began to increase in number on day 7 or later after infection (data not shown). Moreover, bulk CTL activity against syngeneic cells pulsed with the immunogenic peptide of the IE gene product was not observed on day 5 (data not shown). Although the decrease in number and the low degree of responsiveness of splenocytes are detrimental to the host, apoptotic cell death might be of benefit to the host. As shown in Fig. 6, spleen T cells contained a substantial number of copies of the viral IE gene (approximately 1/10 of the number of T cells). However, by a conventional plaque assay, 0.8 3 103 to 1 3 103 PFU of virus per spleen, at most, was detected (data not shown). Therefore, most of the viruses (or more precisely, viral genes) were not productive, indicating the existence of a mechanism to clear virus or to prevent viral proliferation by apoptotic cell death. Since in vitro infection with the virus did not induce apoptosis in T cells or in fibroblasts (Fig. 7 and data not shown), the elaboration of a factor(s) expressed on and/or produced by nylon wool-adherent cells was implicated in the induction of apoptosis. This factor(s) might also directly affect the responsiveness of T cells by means other than the induction of apoptosis. REFERENCES 1. Adachi, M., R. Watanabe-Fukunaga, and S. Nagata. 1993. Aberrant transcription caused by the insertion of an early transposable element in an intron of the fas antigen gene of lpr mice. Proc. Natl. Acad. Sci. USA 90: 1756–1760. 2. Alford, C. A., and W. J. Britt. 1990. Cytomegalovirus, p. 629–660. In B. N. Fields (ed.), Virology. Raven Press, New York. 3. Allan, J. E., G. R. Shellam, and J. E. Grundy. 1982. Effect of murine cytomegalovirus infection on mitogen responses in genetically resistant and susceptible mice. Infect. Immun. 36:235–242. 4. Ameisen, J. C., J. Estaquier, and T. Idziorek. 1994. From AIDS to parasite infection: pathogen-mediated subversion of programmed cell death as a mechanism for immune dysregulation. Immunol. Rev. 142:9–51.
J. VIROL. 5. Baixeras, E., L. Bosca, C. Stauber, A. Gonzalez, A. C. Carrera, J. A. Gonzalo, and C. Martinez-A. 1994. From apoptosis to autoimmunity: insights from the signaling pathways leading to proliferation or to programmed cell death. Immunol. Rev. 142:53–91. 6. Bossu, P., G. G. Singer, P. Andres, R. Ettinger, A. Marshak-Rothstein, and A. K. Abbas. 1993. Mature CD41 T lymphocytes from MRL/lpr mice are resistant to receptor-mediated tolerance and apoptosis. J. Immunol. 151: 7233–7239. 7. Brideau, R. J., and J. A. W. Nicholas. 1987. Pyrimidinone (bropirimine) mediated alteration of T lymphocyte subsets during murine cytomegalovirus infection. Clin. Exp. Immunol. 68:613–620. 8. Buttke, T. M., and P. A. Sandstrom. 1994. Oxidative stress as a mediator of apoptosis. Immunol. Today 15:7–10. 9. Campbell, A. E., and J. S. Slater. 1994. Down-regulation of major histocompatibility complex class I synthesis by murine cytomegalovirus early gene expression. J. Virol. 68:1805–1811. 10. Campbell, A. E., J. S. Slater, and W. S. Futch. 1989. Murine cytomegalovirus-induced suppression of antigen-specific cytotoxic T lymphocyte maturation. Virology 173:268–275. 11. Carney, W., and M. Hirsch. 1981. Mechanisms of immunosuppression in cytomegalovirus mononucleosis. II. Virus-monocyte interactions. J. Infect. Dis. 144:47–54. 12. Del Val, M., H. Hengel, H. Hacker, U. Hartlaub, T. Ruppert, P. Lucin, and U. H. Koszinowski. 1992. Cytomegalovirus prevents antigen presentation by blocking the transport of peptide-loaded major histocompatibility complex class I molecules into the medial-Golgi compartment. J. Exp. Med. 176:729–738. 13. Fesq, H., M. Bacher, M. Nain, and D. Gemsa. 1994. Programmed cell death (apoptosis) in human monocytes infected by influenza A virus. Immunobiology 190:175–182. 14. Fried, J., A. G. Perez, and B. D. Clarkson. 1978. Rapid hypotonic method for flow cytofluorometry of monolayer cell cultures. Some pitfalls in staining and data analysis. J. Histochem. Cytochem. 26:921–933. 15. Hinshaw, V. S., C. W. Olsen, S. N. Dybdahl, and D. Evans. 1994. Apoptosis: a mechanism of cell killing by influenza A and B viruses. J. Virol. 68:3667– 3673. 16. Hiramatsu, N., N. Hayashi, K. Katayama, K. Mochizuki, Y. Kawanishi, A. Kasahara, H. Fusamoto, and T. Kamada. 1994. Immunohistochemical detection of Fas antigen in liver tissue of patients with chronic hepatitis C. Hepatology 19:1354–1359. 17. Hiromatsu, K., Y. Aoki, M. Makino, Y. Matsumoto, T. Mizuochi, Y. Gotoh, K. Nomoto, J. Ogasawara, S. Nagata, and Y. Yoshikai. 1994. Increased Fas antigen expression in murine retrovirus-induced immunodeficiency syndrome, MAIDS. Eur. J. Immunol. 24:2446–2451. 18. Ho, M. 1991. Observations from transplantation contributing to the understanding of pathogenesis of CMV infection. Transplant. Proc. 23:104–109. 19. Hockenbery, D., G. Nunez, C. Milliman, R. D. Schreiber, and S. J. Korsmeyer. 1990. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature (London) 348:334–336. 20. Howard, R. J., S. Miller, and J. S. Najarian. 1974. Cytomegalovirus induced immune suppression. II. Cell-mediated immunity. Clin. Exp. Immunol. 18: 119–126. 21. Jacobson, M. A., and J. Milles. 1988. Serious cytomegalovirus disease in the acquired immunodeficiency syndrome: clinical findings, diagnosis, and treatment. Ann. Intern. Med. 108:585–594. 22. Jeurissen, S. H., F. Wagenaar, J. M. Pol, A. J. van der Eb, and M. H. Noteborn. 1992. Chicken anemia virus causes apoptosis of thymocytes after in vivo infection and of cell lines after in vitro infection. J. Virol. 66:7383– 7388. 23. Ka ¨gi, D., F. Vignaux, B. Ledermann, K. Bu ¨rki, V. Depraetere, S. Nagata, H. Hengartner, and P. Golstein. 1994. Fas and perforin pathways as major mechanisms of T cell-mediated cytotoxicity. Science 265:528–530. 24. Kantor, G. L., L. S. Goldberg, B. L. Johnson, M. M. Derechin, and E. V. Barnett. 1970. Immunologic abnormalities induced by post-perfusion cytomegalovirus infection. Ann. Intern. Med. 73:553–558. 25. Klemola, E., R. von Essen, O. Wager, K. Haltia, A. Koivunieme, and I. Salmi. 1969. Cytomegalovirus mononucleosis in previously healthy individuals. Five new cases and follow-up of 13 previously published cases. Ann. Intern. Med. 71:11–19. 26. Kobayashi, N., Y. Hamamoto, N. Yamamoto, A. Ishii, M. Yonehara, and S. Yonehara. 1990. Anti-Fas monoclonal antibody is cytocidal to human immunodeficiency virus-infected cells without augmenting viral replication. Proc. Natl. Acad. Sci. USA 87:9620–9624. 27. Koga, Y., K. Tanaka, Y. Y. Lu, T. M. Oh, M. Sasaki, G. Kimura, and K. Nomoto. 1994. Priming of immature thymocytes to CD3-mediated apoptosis by infection with murine cytomegalovirus. J. Virol. 68:4322–4328. 28. Loh, L., and J. B. Hudson. 1980. Immunosuppressive effect of murine cytomegalovirus. Infect. Immun. 27:54–60. 29. Lowe, S. W., and H. E. Ruley. 1993. Stabilization of the p53 tumor suppressor is induced by adenovirus 5 E1A and accompanies apoptosis. Genes Dev. 7:535–545. 30. Matthews, N., M. L. Neale, S. K. Jackson, and J. M. Stark. 1987. Tumour cell killing by tumour necrosis factor: inhibition by anaerobic conditions,
VOL. 69, 1995
31. 32.
33.
34.
35. 36.
37.
free-radical scavengers and inhibitors of arachidonate metabolism. Immunology 62:153–155. Mymryk, J. S., K. Shire, and S. T. Bayley. 1994. Induction of apoptosis by adenovirus type 5 E1A in rat cells requires a proliferation block. Oncogene 9:1187–1193. Nicholas, J. A., M. E. Levely, R. J. Brideau, and A. E. Berger. 1987. During recovery from cytomegalovirus infection T-lymphocyte subsets become selectively responsive to activation and have depressed interleukin 2 (IL2) secretion and IL2 receptor expression. Microb. Pathog. 2:37–47. Nicoletti, I., G. Migliorati, M. C. Pagliacci, F. Grignani, and C. Riccardi. 1991. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 139: 271–279. Noteborn, M. H., D. Todd, C. A. Verschueren, H. W. de Gawn, W. L. Curran, S. Veldkamp, A. J. Douglas, M. S. McNulty, A. J. van der Eb, and G. Koch. 1994. A single chicken anemia virus protein induces apoptosis. J. Virol. 68:346–351. Osborn, J. E., A. A. Blazkovec, and D. N. Walker. 1968. Immunosuppression during acute murine cytomegalovirus infection. J. Immunol. 100:835–844. Rao, L., M. Debbas, P. Sabbatini, D. Hockenbery, S. Korsmeyer, and E. White. 1992. The adenovirus E1A proteins induce apoptosis, which is inhibited by the E1B 19-kDa and Bcl-2 proteins. Proc. Natl. Acad. Sci. USA 89:7742–7746. Richard, C., and J. J. Cohen. 1991. Morphological and biochemical assays of apoptosis, p. 3.17.1–3.17.16. In J. E. Coligan, A. M. Kruisbeek, D. H. Mar-
APOPTOSIS OF T CELLS IN MCMV INFECTION
38.
39.
40.
41.
42.
43.
44.
4775
gulies, E. M. Shevach, and W. Strover (ed.), Current protocols in immunology. Wiley-Interscience, New York. Rinaldo, C. R. J., M. Ho, W. H. Homoude, X. E. Gui, and R. L. DeBiasio. 1983. Lymphocyte subsets and natural killer cell responses during cytomegalovirus mononucleosis. Infect. Immun. 40:472–477. Selgrade, M. K., A. Ahmed, K. W. Sell, M. E. Gershwin, and A. D. Steinberg. 1976. Effect of murine cytomegalovirus on the in vitro responses of T and B cells to mitogens. J. Immunol. 116:1459–1465. Slater, J. S., W. S. Futch, V. J. Cavanaugh, and A. E. Campbell. 1991. Murine cytomegalovirus independently inhibits priming of helper and cytotoxic T lymphocytes. Virology 185:132–139. Smith, C. A., T. Farrah, and R. G. Goodwin. 1994. The TNF receptor superfamily of cullular and viral proteins: activation, costimulation, and death. Cell 76:959–962. Takizawa, T., S. Matsukawa, Y. Higuchi, S. Nakamura, Y. Nakanishi, and R. Fukuda. 1993. Induction of programmed cell death (apoptosis) by influenza virus infection in tissue culture cells. J. Gen. Virol. 74:2347–2355. Ucker, D. S., L. D. Hebshi, J. F. Blomquist, and B. E. Torbett. 1994. Physiological T-cell death: susceptibility is modulated by activation, aging, and transformation, but the mechanism is constant. Immunol. Rev. 142:273–299. Watanabe-Fukunaga, R., C. I. Brannan, N. Itoh, S. Yonehara, N. G. Copeland, N. A. Jenkins, and S. Nagata. 1992. The cDNA structure, expression, and chromosomal assignment of the mouse fas antigen. J. Immunol. 148: 1274–1279.
