ment C3 deficiency (C3D) in a New Zealand male who has a small amount of serum C3 (7 pg/ml), a normal size. 6.2-kilobase C3 mRNA that is present in normal ...
THEJOURNAI OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for’ Biochemistry and Molecular Biology, h e .
Vol. 269,No. 45,Issue of November 11, pp. 2849626499, 1994 Printed in U.S.A.
Inherited Human Complement C3 Deficiency AN AMINO ACID SUBSTITUTION IN THE @-CHAIN(ASP549 TO ASN) IMPAIRS C3 SECRETION* (Received for publication, June 29, 1994, and in revised form, September 9, 1994)
Lori Singer$§, William T.Whitehead$, Hideto AkamaS, Yitzhak Katzn, Zvi Fishelsonil,and Rick A. WetselSll**$$ From the $Edward Mallinckrodt Department of Pediatrics and Il**Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri 63110, the nunit of Allergy and Immunology and Department of Pediatrics, Afiliated to the Sackler Faculty of Medicine, IL.1 Aviv University School of Medicine, Israel, and lllepartment of Cell Biology and Histology, Sackler School of Medicine, Tel Aviv University, Israel
We recently described a case of hereditary complement C3 deficiency (C3D) in a New Zealand male who has a small amount of serum C3 (7 pg/ml), a normal size 6.2-kilobase C3 mRNA that is present in normal quantities, and a normal size M, 180,000 proC3 molecule that is synthesized in normal amounts. Secretion of C3 from this patient’scellswas greatly diminished,however, and an aberrant C3 trypsin cleavage profile indicated an abnormality in the proC3 structure. To determine the primary structure of the C3D proC3 molecule, the corresponding cDNA was cloned and sequenced in the present study, revealing a normal signal peptide, tetraarginine linker, and thiolester domain. One nucleotide substitution in exon13 (G”O6AC to AAC) wasfound, however, that resulted in an amino acid change in a highly conserved region of the C3 Pchain (Aspas to Asn). This substitution has not been described in any individual with either C3 Fast or C3 Slow phenotypes. Immunoprecipitation ofC3 fromL-cells transfected with full-length normal and C3DcDNAs demonstrated that C3 was secreted by the cells transfected with the normal C3 cDNA; however, onlya C3 precursor was detected in the intracellular compartment of the cells transfected with the C3DcDNA and none detected extracellularly.Immunofluorescence studies revealed a perinuclear localization of C3 in the C3D transfectants, suggesting that transportof the mutant precursor C3 is arrested early in the secretory pathway. Allele-specific polymerase chain reaction analysis demonstrated that this New Zealand family is a compound heterozygous C3D kindred, with the Asnm9point mutation being inherited from the mother and a yet undescribed C3 defect being inherited from the father. Taken together, these data indicate that 1) C3 deficiency is caused in a New Zealand kindred by two distinct molecular genetic mutations, one being an amino acid substitution in a highly conserved region of the P-chain that results in impaired C3 secretion, and 2) the molecular basis of this deficiency has not been described in any other C3-
deficient individual, providing additional evidence that multiple defects cause inherited C3 deficiency in humans.
Inherited complete human C3l deficiency, first described in 1972 (l),is characterized by recurrent infections with pyogenic encapsulatedbacteriaandcertain immune-complex related disorders including membranoproliferative glomerulonephritis, systemic lupus erythematosus, and vasculitis(reviewed in Ref. 2). These clinical manifestations reflect the biologic functions mediated by C3 and C3 peptides including immune cytolysis, phagocytosis, and non-cytotoxic enzyme release(reviewed in Refs. 2,3), inhibition of immune-complex lattice formation, (41, and B cell activation and proliferation (5, 6). C3 is a two-chain glycoprotein (7, 8) (a-chain, M , 110,000; P-chain, M , 70,000) that is synthesized as a single chain preproprotein (9) that undergoes co- and post-synthetic modifications involving cleavage of a signal peptide, excision of an interchain linking peptide(9, lo), andglycosylation (11, 12). The C3 protein is translated from a 5.2-kb mature mRNA that is transcribed from a 42-kb gene of 41 separateexons (13, 14) on chromosome 19 (15). C3 is synthesized predominately by hepa(reviewed tocytes (16);it is also expressed at extrahepatic sites in Ref. 17), including skin fibroblasts (18). In humans, two major C3 protein polymorphisms have beenidentified, based on the agarose gel electrophoretic mobility of the allotypes (19). The C3 slow (C3S) and C3 fast (C3F) variants exhibit very similar specific hemolytic activities (20) and have been described in manypopulations; C3S is the more common allotype with a frequency of 0.79, 0.95, 0.97, and 0.99 in Caucasian, African American, South American Indian, and Asianpopulations, respectively. Since 1972, inherited C3deficiency has been described in 16 families representing a variety of ethnic and national origins (1,21-35). Recently, the molecular basis of C3 deficiency has been reported in four of these kindreds:two 5‘-donor splice site mutations (introns10 (36) and 18 (3111, a gene deletion (includ* This work was supported by United States Public Health Service ing exons 22 and 23) (371, and a point mutation (affecting a Grants AI25011,AI24739,andHL17461,and Research Grant 1557 Factor I cleavage site) (35). We recently described the initial from the Chief Scientist, Ministry of Health, Israel. Thecosts of publi- investigation of inherited C3deficiency in a New Zealand male cation of this article were defrayed in part by the payment of page (33, 38). Our studies demonstrated that this individual has a charges. This article must thereforebe hereby marked “advertisement” small amount of serum C3 (7yg/ml), a normal size 5.2-kb C3 in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 5 This investigation was performed in partial fulfillment of the re- mRNA that is present in normal quantities, anda normal size quirements for the degree of Doctor of Philosophy in Molecular Genet- M, 180,000proC3 molecule that is synthesizedinnormal ics, Washington University,St. Louis, MO. $$ Recipient of Research Career Development Award AI00919 from The abbreviations used are: C3, the third complement component; the National Institutes of Health. To whom correspondence should be addressed:Dept. of Pediatrics, Box 8116, Washington University School BSA, bovine serum albumin; C3D, C3 deficiency; IL-lp, interleukin-lp; kb, kilobase pair(s);PBS, phosphate-buffered saline, PCR, polymerase of Medicine, 400 S. KingshighwayBlvd., St. Louis, MO 63110.Tel.: chain reaction; vWD, von Willebrand. 314-454-2285;Fax: 314-454-2476.
28494
Human C3 Deficiency
28495
for the C3 FasffSlowpolymorphism and the C3D mutation at nucleotide positions 364 and 1705, respectively. All reactions were performed by initially denaturing 200 ng of genomic DNAat 95 "C for 5 min with 200 ng of each oligonucleotidein a25-pI solution containing 20 mM Tris, pH 8.5, 16 mM ammonium sulfate, 2.5 m~ MgCI,, and 150 pg/ml BSA, 1.6 mM dNTPs, and 3 units of Klentaq I enzyme (from Dr. Wayne Barnes, Washington University School of Medicine, St. Louis, MO). The following oligonucleotidepairs were used in the allele-specificPCR reactions (see below for sequences):Fast, W766 and W767; Slow, W766and W768; Normal, W775 and W776; C3-deficient, W775and W777. Oligonucleotide/Primer Synthesis-All primers used for(c)DNAamplification and sequencing were synthesized by the automated DNA synthesizer PCR-Mate, model 391 (Applied Bio-systems, Inc., Foster City, CA). The primers used for reverse transcription, amplification of the cDNA, genomic DNA,and allele specific PCR are detailed below. All oligonucleotides are identical t o the cDNA sequence described previously (10)except where indicated by lowercase letters. Restriction enzyme recognition sites are underlined. Reverse transcription: W208, EXPERIMENTAL.PROCEDURES 5'-GCGGTCCA?TCGCAGGAGGAAGTTGACGTl"3'; cDNA amplificaFibroblast Cultures-Fibroblast cell lines were established from the (NotI); C3-deficient New Zealand family members and from normal individuals tion:W519, 5'-CTGTCCCTCTGcggCcGCACTGTCCCAGCA-3' genomic according to published methods (18). Fibroblasts were maintained at W207, 5'-CCCCGGGTCTGAGCTCTGTAGGTAGCACTG-3'; W346, 37 "C in 5%CO, in Dulbecco's modified Eagle's medium (Life Technolo- DNA W495,5'-GCGAGAGCCCGGCCAGGACCTGGTGGTGCT-3'; gies, Inc.) supplemented with 10%fetal calf serum, 2mM glutamine, 100 5'- CTGCTGCCCAGGTACAGGCT-3'; allele-PCR W766,5'-ACCCACATGGGCAACGTCACCTI'CACG3'; W767, 5"GGCCTGCACGGTCACGAunitdml penicillin, and 100 pg/ml streptomycin. Isolation of RNA-Normal and C3-deficientfibroblasts were grownto AC'ITG'ITGCC-3';W768, 5"GGCCTGCACGGTCACGAAC'ITG"G€G W776, 5"CTI'GAconfluence in 162 cm2 flasks and stimulated with 10 ng/ml IL-lp (pro- 3'; W775, 5'-CGCACGAAGAAGCAGGAGCTCTCG3'; vided by Dr.John McKearn, Monsanto, St. Louis, MO) 20 h prior to RNA CGTCCACCCACACGGAGTC-3';W777,5"CTFGACGTCCACCCACACG GAG"-3'. All primers used for DNAsequencing were 20-mers, identical to harvest. Approximately lo8 cells were lysed, and RNA was harvested using the method described by Chirgwin et al. (39). RNA was quanti- the SP6 or T7 promoters orto the C3 cDNA sequence (10). Construction of Full-Length C3-deficient and Normal cDNA Mamtated by absorbance a t 260 nm. Polyadenylated mRNA was separated on an oligo(dT)-cellulosecolumn (Collaborative Research Products, malian Expression Vectors-Full-length C3-deficientand normal cDNA clones were constructed fromoverlapping, cDNA clones using the Bedford, M A ) using previously described methods (40). unique SnaBI and SphI sites in the C3 cDNA (10).The full-length C3 Construction of cDNA Library and Amplification of C3D cDNA-Ten pg of poly(A)+ mRNAwas employed in the construction of the oligo(dT) cDNAs were subcloned into pRcfCMV (Invitrogen) using engineered cDNA library using the cDNA synthesis method of Gubler and Hoffman NotI restriction sites. This vector providesthe human cytomegalo-virus (41) and the reagents supplied in a cDNA synthesis kit (Invitrogen, San promoter and enhancer, bovine growth hormone polyadenylationsignal, and neomycin resistance. Diego,CAI. After addition of EcoRI-Not1 adapters (Invitrogen), the Dansfection and Biosynthetic Labeling and ImmunoprecipitationcDNAwas ligated to A-Zap I1vector arms (Stratagene, La Jolla, CA) and in vitro packaged using the Gigapack Gold packaging extract (Strat- Murine L-cells (American TypeCulture Collection, Rockville,MD) were grown to 40-50% confluence (-5 x lo4 cells/60 mm2 dish) and transagene). Over lo6 recombinants were prepared and plated. C3 cDNAcontaining phage were identified by hybridization with a nick-trans- fected with the cDNA constructs using the CaPO, method (46) using 15 lated human C3 cDNA fragment (BstEII fragment of pC3.59 or BglII pg of plasmid. Precipitates were removed after 5 h, the cells washed fragment of pC3.11, (10)).Phagemids were prepared as described in the twice, and fresh medium was added and incubated 48 h. Cells werethen Stratagene A-Zap I1 protocol (Stratagene), and the C3 inserts were incubated with complete medium containing 400 pg/ml G418 (Geneticharacterized by EcoRI and NotI digestion and 1%agarose gel electro- cin, LifeTechnologies, Inc.). Cells transfected with normal and C3phoresis. The longest C3 cDNAclone (pAGI.11) of 4 kb was isolated and deficient cDNAs were subcloned to select C3-producing cells. Aftersesequenced. 5'-C3 cDNA clones that overlapped pAGI.11 were obtained lection of stable transfectants, biosynthetic labeling experiments were using amplification of single-stranded cDNA. Single-stranded cDNA performed by incubating cells for 6 h in Dulbecco's modified Eagle's was synthesized from 1pg of AGI total RNA using the "cDNA CycleKit" medium containing 10% dialyzed fetal calf serum and [35S]methionine (Invitrogen). The C3-specific primer, W208, usedfor reverse tran- and [35Slcysteine(ICN, Costa Mesa, CAI, 250 pCi/ml (specific activity: scriptase is described below. A 1.3-kb fragment was amplified by the approximately 1000 Ci/mmol). After the pulse period, the medium was polymerase chain reaction (42) using the followingconditions. The removed, and the cells were washed twice with cold Hanks' balanced single-stranded cDNA product was initially denatured at 95 "C for 3 salt solution; the cells were lysed by freeze-thawing in the presence of min with 30 pmol of oligonucleotides W519 and W207 (see below) in a protease inhibitors. The supernatant and cell lysates were prepared 100-pl solution containing 10 m~ Tris-C1, pH 8.3, 50 mM KC1, 1.5 mM for immunoprecipitation, preabsorbed with Staphylococcal protein A MgCI,, 0.1% gelatin, 200 p~ dNTPs, and 3 units of Ilhq DNApolymerase (Bethesda Research Laboratory), then incubated in the presence of the (Perkin Elmer Cetus). Followingthe initialdenaturation, the cDNAwas IgG fraction of monospecific goat anti-human C3 antibody (Atlantic amplified by melting at 95 "C for 1min, annealing at 62 "C for 2 min., Antibody, Scarborough,ME) overnight at 4 "C. StaphylococcusAprotein and polymerizing at 72 "C for 3 min. Thirty-five cycles of amplification was added to capture antigen-antibody complexes. Immunoprecipitates were performed using a Tempcycler(Coy Laboratory Products, Ann were washed, redissolved, and analyzed by 1%SDS, 7.5% polyacrylamArbor,MI) followed bya final elongation at 72 "C for7 min. This product ide gel electrophoresisunder reducing conditions. The gel wasdried and was digested with NotI (engineered site) and SmaI (endogenous site), exposed to Hyperfilm (Amersham Corp.). gel purified, and subcloned into pBluescript I1 (Stratagene). Competent Indirect Immunofluorescence-Indirect immunofluorescence of SURE cells (Stratagene) were transformed with the plasmids. These transfected cells was performed as described (47) with minor modificaclones were subjected to DNA sequence analysis as outlined below. tions. L-cells transfected with normal and AGI C3D cDNAand untransDNA SequenceAnalysis-All cloned DNA sequencing was performed fected cells weretransferred onto glass coverslips. Cells were incubated using double-stranded templates (43). Two pg of template were dena- at 37 "C for 48h, rinsed in cold water for 5 min, and permeabilized with tured in 0.2 M NaOH, 0.2 m~ EDTA, neutralized, annealed with SP6, 0.2% Triton X-100 in PBS (5 mM phosphate, 150mM NaC1, pH 7.4) for20 T7, or C3-specificprimers, and sequenced employingthe dideoxy chain min at room temperature. The cells were incubated overnight at 37 "C termination method (44) and the modified bacteriophage T7 DNA powith goat anti-human C3 antibody (IgG fraction, Atlantic Antibody), or lymerase, Sequenase, (United States BiochemicalCorp., Cleveland, purified goat IgG as a negative control (Pierce) (0.8 pg/ml, each). Cells OH). Direct sequencing ofPCR fragments was performed using the were washed three times with PBS containing 1%Triton X-100, 0.2% protocol and reagents of the Promega fmol sequencing system (Pro- Tween 20, and incubated with biotin-conjugated rabbit anti-goat IgG mega, Madison, WI).All DNA was sequenced on both strands. antibody (Pierce) (diluted 1:5000 in PBS containing 3% BSA) for1 h at Allele-specific PCR Reactions-Genomic DNA isolated as described room temperature. This incubation was followed by an incubation with previously (45) from the New Zealand C3-deficient family members as avidin-fluorescein isothiocyanate (Boehringer Mannheim) (diluted well as 70 unrelated individuals was examined by allele-specific PCR 1:300 in PBS with 3% BSA) for1h at room temperature, then washed
amounts (38). Processing and secretion of C3 in this patient's cells was greatly diminished, however, and an aberrant C3 trypsin cleavage profile indicated an abnormality in the proC3 structure (38). The exact molecular genetic mutation that causes C3deficiency inthis individual was not defined, however. Accordingly, in this report we have characterized the structure of the C3 cDNA using RNA isolated from the skin fibroblasts of the C3-deficient individual. This study, together with transfection and allele-specific PCR experiments, demonstrated that C3 deficiency is caused in this kindred by two distinct molecular genetic defects, one being a maternally inherited point mutation in exon 13 resulting in a single amino acid substitution in the P-chain that impairs C3 secretion.
28496
Human C3 Deficiency
T
C
FIG.1. Nucleotide sequence of the AGI C3DcDNA. Sequence analysis of cDNA clone (sense strand) showing the Gl7OSto A transition a t codon 549 which results in the substitution of asparagine for aspartic acid. Codon positions are taken from the published cDNA sequence of proC3 (10). a s above. The coverslips were immersed in a 0.1% solution of Evans Blue (48)a t room temperature for 20 min as a counterstain. The coverslips were washed gently for 5 min, rinsed in distilled water, dried thoroughly, and mounted on glass slides with 50% glycerol in PBS. 1,4-Diazabicyclo-(2.2.2.)-octane (Sigma) (2.5%)was included as an antifade reagent in the mounting media. RESULTS
Characterization of the AGIC3D cDNA-From our previous studies, we determined that C3 secretion was impaired in the proband’s (AGI) cells because of an apparent structuralabnormality in C3 (38).To determine if the impairment inC3 secretion was caused by a defect in the primary structureof proC3, the sequence of the AGI C3Dmessage was determinedby cDNA cloning strategies. An oligo(dT) cDNA library was constructed employing mRNA isolated from stimulated (IL-lP) AGI fibroblastsas described under“Experimental Procedures.” The longest cDNA clone, 4 kb, representing -80% of the entire C3 coding and 3”untranslated sequence was isolated and fully sequenced. In addition, mRNA-specific reverse transcription and amplification (described under“Experimental Procedures”) wasused to complete the 5’-end of the cDNA sequence. Comparison of the AGI cDNA sequence to the normal cDNA sequence (10) revealed a normal signal peptide, tetra-arginine linker, and thiolester domain in theC3D proC3 structure. Five nucleotide differences were found in the C3D cDNA three of the nucleotide sequence differences did not cause amino acid to C). One nucleotide changes (CI6l5to A, CZRo5 to G, and F956 substitution (C364to G) results in an amino acid change (ArgIo2 to Gly) that has been described previously as a polymorphic variant associated withthe C3 proteinSlow and Fastallotypes, respectively (491, indicating that theAGI C3D cDNA codes for the Fast allotype. The final nucleotide substitution, G”05 to A (Fig. 11, results in an amino acid change, Asp549to Asn, in the P-chain of the proC3 molecule that has not been previously described. The results from the cDNA analysis are presented schematically in Fig. 2. cDNA in Expression of Full-length AGI C3D and Normal C3 Murine L-cells-To determine if the aminoacid change, Asp549 to Asn, causes the impairment in C3 secretion observed in the AGI cells, stable transfection experimentswere performed using two full-length C3 cDNA that differed only a t nucleotide 1705. This nucleotide difference resultsinthe amino acid change at residue 549. Both cDNAs encode the C3 Fast allotype, with Gly at residue 102. The cDNA expression vectors were constructed and transfected into murine L-cells as described under “Experimental
Procedures.” Both normal and AGI stable L-cell clones were selected that contained equal numbers of transfected cDNA, and C3 expression in these cells was analyzed by immunoprecipitation using a monospecific polyclonal goat anti-human C3 antibody (Fig. 3). Immunoprecipitation of C3 from the normal C3 cDNA transfectants is shown in lanes 1 and 2. In lane 1, proC3 is expressed in the intracellular compartment, and the mature C3, seen as a- and P-chains, is detected in the extracellular medium (lane 2). In contrast,proC3 is expressed in the intracellular compartment of the L-cells transfected with the AGI mutant(lane 31, but no secreted C3 is detected in the extracellularmedium (lane 4 ) . In addition, higher quantities of p r o 4 3 a r edetected in theAGI transfectants compared to the normal transfectants, suggesting that pro-C3 accumulates inside the L-cells transfected with the AGI C3 cDNA as has also been observed in the primary fibroblasts from AGI (38). These data indicate that the Asp549to Asn amino acid substitution causes the impairment in C3 secretion in theAGI cells. Intracellular Processing of proC3 Examined by Immunofluorescence-Immunofluorescence studies of the transfected L-cells were performed as outlined under “Experimental Procedures.” Cells expressing the normal C3 showed a diffuse pattern of fluorescence throughout the cell (Fig. 4, a and 6). In contrast, only perinuclear immunofluorescence was observed in cells transfected with the Asd4’ mutant cDNA (Fig. 4,c and d 1. In addition, theoverall fluorescence signal was approximately 10 timesmore intense in the AGI transfectants compared with the normal transfectants (note exposure times in Fig. 4). The negative controls of untransfected L-cells (Fig. 4, e and f and L-cells mock-transfected with vector alone (data not shown) showed only minimal background immunofluorescence, demonstrating theabsence of autofluorescence in theL-cells transfected with the normal and AGI cDNA. The increased fluorescence observed in theAGI transfectansts is inaccord with the immunoprecipitation data, indicating intracellular accumulation of the AS^"^^ proC3. Furthermore, theperinuclear localization of the immunofluorescence in the L-cells transfected with the AGI cDNA suggests that the mutant proC3 protein is arrested early in the secretory pathway. Determination that AGI is a Compound C3D Heterozygoteby Allele-specificP C R T o determine if both C3 null alleles of the C3D New Zealandcontain theto A mutation, allele-specific PCR reactions were performed using genomic DNA isolated from all family members as described under “Experimental Procedures” (Fig. 5). In addition, all family members were examined for the C3S/F polymorphism at nucleotide position 364 by a similar allele-specific PCR strategy (“Experimental Procedures”). The results from this study reveal that: 1)AGI and hishomozygous C3-deficient sister areC3D compound heterozygotes, 2) the G1705to Amutation is maternally inherited, 3) the father harborsa yet undescribed molecular mutation that causes C3 protein deficiency, and 4) both C3 alleles in this C3-deficient kindred contain G364which is associated with the C3 Fast allotype. These results aresummarized in Fig. 6. In addition to the New Zealand C3D kindred, DNA from 70 unrelated Caucasian individuals was examined by allele-specific PCR for the t o A mutationandthe C3S/F polymorphism a t nucleotide position 364. The PCR results demongroup are stratedthat seven (10%) individuals inthis homozygous for the C3F polymorphism, 12 (17%) individuals are C3F/S heterozygotes, and that the remaining51 (73%) individuals are homozygous for the C3S polymorphism; however, the to A mutationwas not presentinany individual examined, including all 27 that contained the C3Fpolymorphism.
28497
Human C3 Deficiency
1
4
s-c p 1 0 2
954,
8-CHAIN
.-CHAIN
IC381
CS64
I’ T
I
I I
I
G1705
1
?
s-c 9102
AGI
9 5 4 9
8-CHAIN
.-CHAIN
IC381
I
I I A
0304
NORMAL C3 cDNA
I
I‘
C3D cDNA
C
FIG.2. Comparison of the normal and AGI C3D cDNAsequences. Schematic diagram of normal C3 cDNAsequence (10)and AGI C3D cDNA sequence (5.2 kb). Nucleotide differencesare shown below the figures (see textfor nucleotide positions).Amino acid differences are shown circled, above the figures. kg’’* to Gly is the previously described polymorphismthat results in the Slow and Fast allotypes, respectively (49); Aspi4’to Asn is the mutationof interest. Also shown above the figure is the relativeposition of the region coding for thiolester in the a-chain.
-C3D
Normal
.%-3
200 -
f
Pro-C3
f
a-chain
10097 -
+ P-chain
68 -
Lane
1
2
3
4
FIG.3. C 3 synthesis in L cells transfected with AGI C3D and normal cDNA. Shown is an autoradiogram of a SDS-polyacrylamide gel (7.5% in reducing conditions)of immunoprecipitated C3 [%]methionine-labeled fibroblasts treated as described under “Experimental Procedures.” Intracellular C3 was immunoprecipitated from cell lysates (lanes 1 and 3)and extracellular C3 was immunoprecipitatedfrom cell supernatants (lanes 2 and 4 ) . Lanes 1 and 2 are from L cells transfected with normal C3 cDNA lanes 3 and 4 are from the L cells transfected with AGI C3D cDNA. I
I
DISCUSSION
FIG.4. Indirect immunofluorescence microscopy of m u r i n e L We previously demonstrated that C3 deficiency in the pro- cells transfected with normal and m u t a n t h u m a n C 3 cDNAs. band (AGI) of a New Zealand familywas the result of impaired Protocol is described under “Experimental Procedures.” The patterns secretion of C3 most likely causedby a structural defect in the shown in the differentpanels wereobserved for L cells transfected with: a and b, normal C3 cDNA;panelsc and d,AGIC3D cDNA;panels precursor proC3 (38). Fibroblasts and monocytes of this indi- panels e and f, untransfected L-cells; Panels a, c, and e, x100 magnification; vidual synthesize a normal amount of precursor C3, however, panels b, d, and f,x1000 magnification. The photomicrographs shown in only a limited amount issecreted at a slower rate thannormal. panels c andd of the AGI transfectants were obtainedfrom a 1-s expoTrypsin cleavage data of the intracellular C3 in the deficient sure. The photomicrographs shown ain, b, e, and fof the untransfected L-cells and AGI cDNA-transfected L-cells were obtained from a 10-s fibroblasts indicated an abnormal precursor C3 structure. In exposure.
this study, to examine the primary structure of the C3D protein, we cloned a C3DcDNA from the deficient fibroblasts, analyzed the nucleotide sequence, and examined the secretion of the C3D molecule using L-cells transfected with the fulllength C3D cDNA. The results from these investigations demonstrate that the impairment in C3 secretion is caused by a single amino acid substitution (Asp549to Asn) in the P-chain of the proC3 molecule. Immunofluorescence studies indicate that the deficient proC3 molecule is retained early in thesecretory pathway. Studies are presently underway in our laboratory to localize the intracellular compartment in which the mutant proC3 accumulates. Secretory defects due tosingle amino acid substitutions have been reported in several protein deficiencies, including Type IIA von Willebrand disease (Type IIA vWD) (501, defective secretion of high molecular weight kininogen (rat) (51), a-l-pro-
teinase inhibitor (Alp,) deficiency (52), impaired secretion of the AI light chain(mouse) (531, and othercomplement deficiencies, including type I1 C2 deficiency (54) and certain Cl-inhibitor deficiencies (55).The structuralmechanism by which these amino acid changes cause the secretory defects has been determined in some of these cases. Group I mutations in Type IIA vWD occur predominately in a domain that is thought to be highly exposed on the surface of vWD, causing delayed transport through thesecretory pathway. Disruption of a salt bridge caused by a single amino acid substitution in Alp, appears to alter a highly conserved sequence of the protein leading to increased intracellular degradation. A mutation within a conserved region of the variable domain of the murine AI light chain blocks secretion of the protein without significantly altering the normal conformation of the protein.
28498
Human C3 Deficiency
B
A
"
5 OFG
-
-
N
5'
c
3
bp
9
KEG AVG
3 4
5
6 7
C
L
870bp-
OFG KEG AVG
A G I Normol
n n n n n
N D N D N D N D N D P C R
1 2
c
-*
A G I Normol
n n n n n
Lane
F
5'
D
c
F S F S F S F S F S
Lane
8 9 1 0
I
2
3
NormaI/Deficient
A
5 6
7
8
910
Fast/Slow
FIG.5.Allele-specific PCR reactions that test for the C3D mutation and C3 FastISlow polymorphism.Genomic DNA from the New Zealand C3-deficient kindred was subjected toallele-specific PCR using pairsof oligonucleotide primers to detect the normal ( N , G"", Asp549)or mutated ( D ,AI7", AS^'^'') C3 sequences (panel A ) a s well as the Fast(F,G""', Gly'"') or Slow (S, C""", Arg'") associated C3 polymorphisms(panel B ) . The strategiesfor the PCR reactions are illustratedat thetop of each panel. TheC3D family members are indicateda s follows: OFG, mother with half-normal levelsof serum C3;KEG, father with half-normal levelsof serum C3; AVG, sister of proband who is deficient in serumC3; AGI, the proband who is deficient in serumC3. The normal sample isfrom an unrelated Caucasian male with normal levelsof serum C3comprised of both C3F and C3S allotypes. For experimental details see "Experimental Procedures."
KEG
TARLE I
OFG
Phylogenetic comparison of region spanning residue549
100/100
EWADSVWVD
100/100
Rat
78/86
EVVADSVWVD
1001100
(61)Guinea pig
78/86
EWADSVWAD
90/100
77/85
EWAPSVWVD
100/100
(64) Cobra
5 1/66
EIVAPSVWVD
90/100
(65) Trout
44/59
DLVADSVWVD
80/100
31/47
ELVADSIIID
60190
32/48
EIVADSVTVE
70190
Human (IO) (60)
Mouse 63)(62,
AVG
AGI
0C3S, Normal C3F, Deficient, mutation unknown C3F, Deficient, Asp549+A~n549 FIG. 6. Diagram of the C3-deficientNew Zealandkindred summarizing the results of the allele-specific PCR study. The open box indicates a normal C3 gene that contains the C3 Slow associated polymorphism. The closed box indicates a C3 null gene containing a n unknownmutationandtheC3Fastassociatedpolymorphism.The hatched box indicates a C3 null gene containing the AS^"^^ point mutation and the C3 Fastassociated polymorphism.
(66) Hagfish (67) Lamprey
Similarity based on charge, polarity, and biochemical properties of amino acids. Sequences compared to the normal human sequence. Residue positions are of the proC3 molecule (10).
In addition to theAsp"'" to Asn mutation that is maternally inherited, allele-specific PCR results demonstrated thatC3 deficiency in this New Zealand family is caused by another distinct molecular genetic defect that is paternally inherited. The paternal molecular genetic defect was not found during the Although the three-dimensional structure of C3 has notbeen cDNA cloning and sequencing studies. Several reverse trandetermined, binding studies and epitope mapping of C3 have scription-PCR cDNA clones were sequenced that encoded the provided insight about the regions of C3 necessary for protein 5'-end of the AGI C3 mRNA, all were normalin sequence. Only interactions andfunction (56-59). The region of the C3 p-chain one clone (pAGI.ll) wassequenced that encoded the remaining affected by the amino acid substitution at residue 549 has not 4.0 kb of C3 mRNA, however. This clone contains the been associated with C3 protein interactions orfunctions. How- maternal mutation. Hence, the paternal mutation is possibly ever, this residue is identical in several vertebratespecies, and containedwithin the corresponding 4.0 kb ofmRNA tranthe surrounding sequence also is highly conserved (Table I), scribed from the father'sC3 gene. Since the father's cells prodsuggesting the importance of this region in thenormal expres- uce half normal levels of C3 protein, but a normal size C3 sion of a functional C3 protein. The substitution of Asn for mRNA in normal quantities (data not shown), the paternal C3 Asp549may result in the disruptionof a salt bridge as in Alpi defect could possibly be a nonsensemutation that abrogates and/or this region may be on the surface of C3 as is theregion protein synthesis without changing the stability of the C3 mutated in Type I1vWD. Either of these possibilities could mRNA. Of course, it isalso possible that the paternaldefect is affect interactions of the mutant C3 protein with resident en- not contained in the C3 gene but in some other gene whose doplasmic reticulum proteins and cause retention in thiscom- product is required for C3 protein synthesis. Future cloning partment. Additionally, the relationship, if any, between the and sequencing studies usingmRNA isolated from the father's amino acidsa t residues 102 (FasVSlow polymorphism) and 549 fibroblast cells shouldhelp determine which hypothesis is remains to be determined. Future studiesof the mechanism of correct. Sixteen families with hereditary C3 deficiency have been this block in secretion and of the interactionsbetween distant amino acids in the primary structure will provide new infor- reported. Five of these families, including the one in the premation regardingthetertiarystructure of C3 as well as sent study, have been examined for molecular genetic defects the processing and secretory pathway of this complement causing C3 protein deficiency. All five families have been found component. to contain distinct molecular genetic mutations. In a Japanese
Human C3 Deficiency
28499
and Stoop, J. W. (1983)Pediatrics 71, 81-87 29. Borzy, M. S., Gewurz, A,, Wolff, L., Houghton, D., and Lovrien, E.(1988)Am. J . Dis. Child. 142, 79-83 30. Grumach, A. S., Vilela, M. M. S., Gonzalez, C. H., Starobinas, N., Pereira,A. B., Dias-da-Silva, W., and Carneiro-Sampaio, M.M. S. (1988)Braz. J . Med. Biol. Res. 21, 247-257 31. Botto, M., Fong, K. Y., So, A. K., Rudge, A., and Walport, M. J . (1990)J . Clin. Znuest. 86, 1158-1163 32. Imai, K., Nakajima, K., Eguchi, K., Miyazaki, M., Endoh, M., Tomino, Y., Nomoto, Y., Sakai, H., and Hyodo, Y. (1991)Nephron 59, 148-152 33. Peleg, D., Harit-Bustan, H., Katz,Y., Peller, S., Schlesinger, M., and Schonfeld, S . (1992)Pediutr. Infect. Dis. J. 11, 401-404 Loos, M., Ersoy, F., Kanra, G., Secmeer, G., and Tezcan, I. (1992)Eur. 34. Sanal, 0.. J . Pedintr. 151,67&679 35. Watanabe, Y., Matsui, N., Yan, K., Nishimukai, H., Tokunage, K., Juji, T., Kobayashi, N., and Kohsaka, T. (1993)Mol. Immunol. 30,62 36. Lin, C.-Y., and Huang, J.-L. (1993)Mol. Zmmunol. 30, 29 37. Botto, M., Fong, K.Y., So, A.K., Barlow, R., Routier, R., Morley, B. J., and Walport, M. J. (1992)Proc. Natl. Acad. Sci. U. S. A . 89,4957-4961 38. Katz, Y., Singer, L., Wetsel, R. A., Schlesinger, M., and Fishelson,2. (1994)Eur. J. Zmunnol. 24,1517-1522 Acknowledgments-We thank the members of Dr. Singer's thesis committee, Drs. Matthew L. Thomas, John P. Atkinson, V. Michael 39. Chirgwin, J. M., Pryzbyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18,5294-5299 Holers, Arnold W.Straws, Susan Church, and R. Paul Levine for their help and insightful comments. We also thank Drs. Harvey R. Colten and 40. Ausubel, F. M., Brent, R., Kingston,R. E., Moore, D. D., Seidman, J. G., Smith, J. A,, and Struhl, K. (1993)Current Protocols in Molecular Biology, pp. Robert C. Strunk for support and critical evaluation of the data, and 4.5.1-4.5.3, Green Publishingkssociates andWiley-Interscience, New York Joie Haviland's excellent technical assistance in the immunoprecipita- 41. Gubler, U., and Hoffman, B. J. (1983)Gene (Amst. 26, 263-269 tion experiments. 42. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988)Science 239, 487-491 REFERENCES U. S . A . 84, 43. Tabor, S., and Richardson, C. C. (1987)Proc.Natl.Acad.Sci. 4767-4771 1. Alper, C. A,, Colten, H.R., Rosen, F. S., Rabson, A. R., Macnab, G . M., and Gear, 44. Sanger, F., Nickles, S., and Coulson,A. R. (1977)Proc. Natl. Acad. Sci.U. S. A . J. S. S. (1972b)Lancet 2, 1179-1181 74,54634467 2. Singer, L., Colten, H. R., and Wetsel, R. A. (1994)Pathobiology 62, 14-28 45. Johnson, C. A., Densen, P., Hurford, R. K., Jr., Colten, H. R., and Wetsel, R. A. 3. Volanakis, J. E. (1989)Current Topics in Microbiology and Immunology: The (1992)J. Biol. Chem. 267,9347-9353 Third Component of Complement (Lambris, J. D., ed) pp. 1-21, Springer46. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,Smith, Verlag, Berlin J. A,, and St&, K (1990)Current Protocols in Molecular Biology, pp. 4. Schifferli, J. A., and Ng, Y. C. (1988)Clin. Immunol. Allergy 2, 319-334 9.1.1-9.1.9,Green Publishing Associates and Wiley-Interscience, New York 5. Fearon, D.T. (1993)Curr. Opin. Zmmunol. 5,341-348 47. Harlow, E., and Lane, D. (1988)Antibodies: a Laboratory Manual, pp. 3596. van Noesel, C.J. M., Lankester, A. C., and van Lier, R. A.W. (1993)Zmmunol. 420,Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Today 14.8-11 7. Bokisch, V. A,, Dierich, M. P., and Muller-Eberhard, H. J. (1975)Proc. Natl. 48. Nichols, R. L., and McComb, D. E. (1962)J . Immunol. 89,545454 Acad. Sci. U. S. A. 72, 1989-1993 49. Botto, M., Lissandrini, D., Sorio, C.. and Walport, M. J. (1992)J. Zmmunol. 8. Tack, B. F., and Prahl, J. W. (1976)Biochemistry 15,4513-4521 149,1348-1355 9. Brade, V., Hall, R. E., and Colten, H. R. (1977)J. Exp. Med. 146, 759-765 50. Lyons, S. E., Bruck, M. E., Bowie, E. J. W., and Ginsberg, D. (1992)J. Biol. 10. deBruijn, M. H. L., and Fey, G. H. (1985)Proc. Natl. Acad. Sci. U. S . A . 82, Chem. 267,4424-4430 708-712 51. Hayashi, I., Hoshiko, S., Makabe, O.,andoh-ishi, S. (1993)J.Biol. Chem.268, 17219-17224 11. Tomana, M., Niemann, M., Garner, C., and Volanakis, J. E. (1985)Mol. Immunol. 22, 107-111 52. Brodbeck, R. M., Samandari, T., and Brown, J. L. (1993)J. Biol. Chem. 268, 12. Hase, S., Kikuchi, N., Ikenaka, T., and Inoue, K. (1985)J. Biochem. (Tokyo)98, 6771-6776 53. Dul, J. L., and Argon, Y. (1990)Proc. Natl. Acad. Sci. U. S. A. 87, 8135-8139 863-874 13. Fong, K. Y., Botto, M., Walport, M. J.,and So,A. K. (1990)Genomics 7,579586 54. Kulics, J., Kiepiela,P., Johnson, C. A,, Densen,P., Singer, L., Colten, H.R., and 14. Vik, D., Amiguet, P., Moffat, G., Fey, M., Amiguet, F., Wetsel, R., and Tack, B. Wetsel, R. A., (1993)Mol. Zmmunol. 30, Suppl. 1, 26 (1991)Biochemistry 30, 1080-1085 55. Verpy, E.,Eldering, E., Biasotto, M., Couture-Tosi, E., Meo, T., and %si, M 15. Whitehead, A. S., Solomon, E., Chambers, S., Bodmer, W. F., Povey, S., and Fey, (1993)Mol. Immunol. 30, Suppl. 1, 59 56. Fishelson, Z. (1991)Mol. Zmmunol. 28, 545-552 G . (1982)Proc. Natl. Acad. Sci. U. S. A. 79, 5021-5025 16. Alper, C. A., Johnson, A. M., Birtch, A. G., and Moore, F. D. (1969)Science 163, 57. Becherer, J. D., Alsenz, J., and Lambris, J. D.(1989)The Third Component 286-288 of Complement:Chemistryand Biology (Lambris, J. D., ed) pp. 45-72, 17. Colten, H. R. (1993)Progressive Immunology (Gergely, J., ed) Vol. VIII, pp. Springer-Verlag, Berlin 483493,Springer-Verlag, Budapest, Hungary 58. Esparza, I., Becherer, J. D., Alsenz, J., De la Hera, A., Lao, Z., Tsoukas, C. D., 18. Katz, Y., and Strunk, R. C. (1989)J. Immunol. 142, 3862-3867 and Lambris, J. D. (1991)Eur. J. Zmmunol. 21,2829-2838 19. Alper, C. A., and Propp, R. P. (1968)J. Clin. Inuest. 47,2181-2191 59. Alsenz, J., A d a , D., Huemer, H. P., Esparza, I., Becherer, J. D., Kinoshita, T., 20. Colten, H. R., and Alper, C. A. (1972)J. Immunol. 108, 1184-1187 Wang, Y., Oppermann, S., and Lambris, J. D. (1992)Deu. Comp. Immunol. 21. Ballow, M., Shira, J. E., Harden, L., Yang, S. Y., and Day, N.K. (1975)J. Clin. 16,63-76 Inmost. 56. 7w-710 60. Misumi, Y., Sohda, M., and Ikehara, Y. (1990)Nucleic Acids Res. 18, 2178 ", 22. Grace, H. J., Brereton-Stiles, G. G., Vos, G. H., and Schonland,M. (1976)S . Afr. 61. Auerbach, H. S., Burger, R., Dodds,A., and Colten, H. R. (199O)J.Clin. Inuest. Med. J . 50. 139-140 86,96106 23. Osofsky, S. G.; Thompson, B. H., Lint, T. F., and Gewurz, H. (1977)J . Pediatr. 62. Wetsel, R. A., Lundwall, A., Davidson, F., Gibson, T., Tack, B. F., and Fey, G . H. 90,180-186 (1984)J. Biol. Chem. 259, 13857-13862 24. Davis, A. E., Davis, J. S., Rabson, A. R., Osofsky, S., G., Colten, H. R., Rosen, 63. Lundwall, A., Wetsel, R. A,, Domdey, H., Tack, B. F., and Fey, G. H. (1984)J. F. S., and Alper, C. A. (1977)Clin. Immunol. Zmmunopathol.8, 543-550 Biol. Chem. 259, 13851-13856 25. Pussell, B. A., Nayef, M., Bourke, E., Morris, S., and Peters, D.K. (1980) 64. Fritzinger, D. C., Petrella, E. C., Connelly, M. B., Bredehorst, R., andVogel, C. Lancet 1, 675-677 W. (1992)J. Zmmunol. 149, 3554-3562 26. Hsieh, K.-H., Lin, C.-Y., and Lee, T.-C. (1981)Clin. Immunol. Zmmunopathol. 65. Lambris, J . D., Lao, Z., Pang, J., and Alsenz, J. (1993)J. Immunol. 151, 20,305-312 6123-6134 27. Sano, Y., Nishimukai, H., Kitamura, H., Nagaki, K, Inai, S., Hamasaki, Y., K., Suzuki, M., Titani, K., Tomonaga, S., and 66. Ishiguro,H.,Kobayashi, Maruyama, I., and Igata, A. (1981)Arthritis Rheum. 24, 1255-1260 Kurosawa, Y.(1992)EMBO J. 11, 829-837 28. Roord, J . J., Daha, M., Kuis, W., Verbrugh, H. A., Verhoef, J., Zegers, B. J . M., 67. Nonaka, M., and Takahashi, M. (1992)J. Zmmunol. 148,32903295
family, the defect is a point mutation that does not prevent C3 secretion, but causes hypercatabolism of serum C3 due to an amino acid substitution at one of the cleavage sites of factor I, a regulator of C3 activation (35). The other remaining mutations include two splice site mutations(31,361 and an 800-base pair partial gene deletion (37). Collectively, all theseinvestigations indicate that inherited human C3 deficiency is caused by an array of molecular genetic mutations and suggests additional causes of C3 deficiency may be found in other C3-deficient individuals. Continued investigation of the molecular basis of C3 deficiency will provide information about the biosynthesis, processing, and structure of the C3 protein as well as insight into the function of C3 and C3 fragments inthe immune response.
~
