Inhibition of cyclin D1 gene transcription by Brg-1

[Cell Cycle 7:5, 647-655; 1 March 2008]; ©2008 Landes Bioscience

Report

Inhibition of cyclin D1 gene transcription by Brg-1 Mahadev Rao,1,2,† Mathew C. Casimiro,1,† Michael P. Lisanti,1 Mark D’Amico,2,† Chenguang Wang,1 L. Andrew Shirley,1 Jennifer E. Leader,1,2 Manran Liu,1 Michael Stallcup,3 Daniel A. Engel,4 Daniel J. Murphy4 and Richard G. Pestell* 1Kimmel

Cancer Center; Departments of Cancer Biology; Medical Oncology and Department of Surgery; Thomas Jefferson University; Philadelphia, Pennsylvania USA; 2Lombardi Cancer Center; Georgetown University; Washington DC, USA; 3Department of Pathology; University of Southern California School of Medicine; Los Angeles, California USA; 4Department of Microbiology and Cancer Center; University of Virginia School of Medicine; Charlottesville, Virginia USA authors contributed equally to this work.

UT E

.

†These

The evolutionarily conserved SWI-SNF chromatin remodeling complex regulates cellular proliferation. A catalytic subunit, BRG1, is frequently down regulated, silenced or mutated in malignant cells, however, the mechanism by which BRG-1 may function as a tumor suppressor or block breast cancer cellular proliferation is not understood. The cyclin D1 gene is a collaborative oncogene overexpressed in greater than 50% of human breast cancers. Herein, BRG-1 inhibited DNA synthesis and cyclin D1 expression in human MCF-7 breast cancer epithelial cells. The cyclin D1 promoter AP-1 and CRE sites were required for repression by BRG-1 in promoter assays. BRG-1 deficient cells abolished and siRNA to BRG-1 reduced, formation of the BRG-1 chromatin complex. The endogenous cyclin D1 promoter AP-1 site bound BRG-1. Estradiol treatment of MCF-7 cells induced recruitment of BRG-1 to the endogenous hpS2 gene promoter. Estradiol, which induced cyclin D1 abundance, was associated with a reduction in recruitment of the co-repressors HP1α/HDAC1 to the endogenous cyclin D1 promoter AP-1/BRG-1 binding sites. These studies suggest the endogenous cyclin D1 promoter BRG-1 binding site functions as a molecular scaffold in the context of local chromatin upon which coactivators and corepressors are recruited to regulate cyclin D1.

BRG-1/hSNF2, INI1/SNF5 and several other proteins including the protein arginine methyltransferases, PRMT5 and CARM1.3 The composition of the BRG-1-associated proteins varies between cell types and the occupancy of BRM-1 and BRG-1 within the complex is frequently mutually exclusive.4 The human SWI-SNF complex regulates activity of a subset of transcription factors and BRG-1 has been shown to convey either transcriptional activation or repression.5 BRG-1 regulates expression of transfected reporter genes in a DNA and ATPase-dependent manner. BRG-1 is frequently silenced, deleted or mutated in tumor cell lines5 implicating BRG-1 in tumor suppressor function. Mice heterozygous for BRG-1 are susceptible to tumorigenesis, suggesting BRG-1 contributes in a critical manner to the in vivo control of cellular proliferation.6 Loss of BRG-1 has been correlated with a poor prognosis in human lung cancer.7 The INI1/ SNF5 component of the SWI-SNF complex conveys anti-proliferative effects and is mutated in human rhabdoid tumors.8 The mechanism by which BRG-1 regulates cellular proliferation in fibroblasts has been correlated with the known functional interaction of BRG-1 with the pRB protein. BRG-1 binds pRB to induce G1 arrest.9,10 The BRG-1/pRB complex represses E2F target genes including cyclin E, cyclin A and cdc2.10,11 In addition, several genes that may contribute to BRG-1 mediated inhibition of cellular proliferation are regulated by BRG-1 independently of E2F. BRG-1 regulates expression of CD44, a cell-matrix adhesion molecule implicated in tumor growth and metastasis and transcriptional repression of the AP-1 binding protein, c-Fos, occurs in an E2F independent manner.12 The frequency with which BRG-1 is inactivated in tumor cell lines including breast cancer, led to studies examining the mechanisms by which BRG-1 inhibits breast cancer epithelial cell proliferation.5 BRG-1, with prohibitin, blocked MCF-7 cell colony formation and E2F activity13 providing further evidence that BRG-1 may function as a mammary epithelial cell tumor suppressor. The cyclin D1 gene, which is overexpressed in greater than 50% of human breast cancers, is sufficient for the induction of mammary tumor formation in transgenic mice.14 Conversely, cyclin D1 deficiency conveys resistance to gastrointestinal tumorigenesis15 and mammary tumorigenesis-induced by the Ras or ErbB2 oncogenes.16 The cyclin D1 gene encodes the catalytic subunit of the serine/

LA

Introduction

ND

ES

BIO

SC

IEN

CE

.D

ON

OT D

IST

Key words: Brg-1, cyclin D1, chromatin, cancer, estrogen, PRMT5

RIB

Abbreviations: E2, estradiol; siRNA, small interfering RNA; MSCV, mouse stem cell virus; DMEM, dulbecco’s modified eagle’s medium; ChIP, chromatin immunoprecipitation; HDAC, histone deacetylase; HAT, histone acetyltransferase

©

20

08

The evolutionary conserved SWI-SNF chromatin remodeling complex functions in both transcriptional repression and activation.1,2 The mammalian complex is a 1.5 to 2.0 MDa complex that alters the arrangement of nucleosomes. In higher eukaryotic cells, the SWI-SNF complex includes proteins encoded by the mammalian genes hBRM-1/hSNF2 (Brahma related gene), *Correspondence to: Richard G. Pestell; Kimmel Cancer Center; Departments of Cancer Biology and Medical Oncology; Thomas Jefferson University; 233 South 10th Street; Philadelphia, Pennsylvania 19107 USA; Tel.: 215.503.5649; Fax: 215.503.9334; Email: [email protected] Submitted: 12/10/07; Accepted: 12/12/07 Previously published online as a Cell Cycle E-publication: http://www.landesbioscience.com/journals/cc/article/5446 www.landesbioscience.com

Cell Cycle

647

BRG-1 represses cyclin D1

OT D

IST

RIB

UT E

.

BRG-1 defective in ATP-helicase activity, were used to transduce MCF-7 cells (Fig. 1A). The effect of BRG-1 on tritiated thymidine uptake and serum-induced DNA synthesis was assessed (Fig. 1B). BRG-1 expression inhibited tritiated thymidine uptake in MCF-7 cells by 60% (Fig. 1B) and reduced the induction of DNA synthesis by serum (Fig. 1C). Point mutation of the ATP-dependent helicase function of BRG-1, reduced, but did not abolish the inhibition of DNA synthesis (Fig. 1B and C), suggesting both ATP-dependent and ATP-independent mechanisms regulate BRG-1-dependent repression of DNA synthesis in breast cancer cells. To determine the component of the cell cycle affected by BRG-1 expression, MCF-7 cells were transduced with an expression vector encoding BRG-1 linked to GFP or a control GFP vector and subjected to GFP FACS sorting with subsequent cell cycle analysis. BRG-1 reduced a portion of cells in the DNA synthetic (S) phase (Fig. 1D) and increased the proportion of cells in the G1 phase, consistent with a G1 inhibitory affect of BRG-1 in the G1 phase of the cell cycle (data not shown). To investigate the impact of BRG-1 knock down on cyclin D1 levels we starved and then stimulated MCF-7 cells with serum in the presence of control or BRG-1 siRNA. The level of BRG-1 was reduced by 43% leading to a two-fold increase in cyclin D1 abundance (Fig. 2A). This data was recapitulated using estradiol to stimulate MCF-7 cells starved in 5% charcoal stripped media (Fig. 2B). Knock down of BRG-1 lead to increased E2-induced cyclin D1 abundance. In contrast with cyclin D1, BRG-1 siRNA treatment caused a modest reduction in basal and E2-induced cyclin E abundance. To investigate the effect of BRG-1 knock down on cell cycle we correlated the cell cycle analysis with the abundance of cyclin D1 in response to proliferative signals. siRNA mediated knockdown of BRG-1 led to a 3-fold greater abundance of cyclin D1 compared to the control group upon stimulation with estradiol (Fig. 2C). Contemporaneous with the induction of cyclin D1 abundance, estradiol increased the proportion of cells in S-phase. The reduction in BRG-1 by siRNA increased the basal level of cyclin D1 even under serum starvation conditions. Thus endogenous BRG-1 inhibits basal, serum- and estradiol-induced cyclin D1 expression and S-phase entry. Recent studies demonstrated BRG-1 abundance reduced cyclin D1 protein abundance and pRB phosphorylation.31 To determine whether the cyclin D1 gene serves as a direct transcriptional target of BRG-1, a full-length (-3.3 kb) cyclin D1 promoter fragment was cloned and linked to a luciferase reporter and the construct examined in MCF-7 cells. The 3.3 kb cyclin D1 promoter construct was repressed by BRG-1 (Fig. 3A). Deletion to -1745 resulted in a promoter fragment similarly repressed by BRG-1 expression, in a dose-dependent manner (Fig. 3A). In contrast, BRG-1 activated cyclin E (4-fold) in a dose-dependent manner (data not shown). BRG-1 expression did not affect activity of the pA3luc reporter vector itself, suggesting that the cyclin D1 promoter represents a DNA sequence specific target of transcriptional repression by BRG-1. To determine the DNA sequences required for repression by BRG-1, cyclin D1 promoter point mutants were compared in MCF-7 cells. BRG-1 repressed the cyclin D1 promoter by ~90%. Point mutation of the CRE site of the cyclin D1 promoter reduced transcriptional repression by BRG-1 (Fig. 3B). In subsequent studies mutation of the AP-1 site of the cyclin D1 promoter in the context of the -963 promoter fragment also reduced repression by BRG-1 (Fig 3C). Together, these studies demonstrate an important role for

©

20

08

LA

ND

ES

BIO

SC

IEN

CE

.D

ON

threonine kinase that phosphorylates and inactivates the pRB tumor suppressor.14 Immunoneutralizing and anti-sense experiments have demonstrated cyclin D1 is required to promote G1 phase progression-induced by serum addition and mitogens, including estrogen.17 Cyclin E, which is induced later in G1 phase, is also capable of promoting G1 phase progression. Cyclin E is often considered a parallel pathway to cyclin D1 as induction of G1 progression by cyclin E can occur independently of pRB. Cyclin D1 function and expression is induced by oncogenes (Ras, ErbB2, Src, STAT3, SV40t), and repressed by several tumor suppressors (p16INK4a, p19ARF).18,19 Distinct DNA sequences, including the E2F site, CRE and AP-1 site are involved in transcriptional regulation of the cyclin D1 promoter. Oncogenic and tumor suppressor activities converge on the cyclin D1 promoter through distinct DNA sequences that serve to integrate multiple signaling pathways. For example, the first studies identifying the cyclin D1 CREB-binding site did so during analysis of the mechanisms by which the SV40t antigen promoted cyclin D1 expression.20 BRG-1 and BRM-1 encode the regulatory subunit of the SWISNF complex and bind similar parts of a protein complex, which includes pRB. There are, however, distinct binding partners that contribute to the distinct signaling pathways regulated by the BRG-1 vs. the BRM-1 components of the SWI-SNF complex. BRG-1, unlike BRM-1, binds HP1α (heterochromatin protein 1α), a member of a family of non-histone chromosomal proteins that function in gene silencing.21,22 HP1α functions in hetero-chromatin-mediated silencing associated with pericentric heterochromatin. HP1α silences transcription when bound to DNA in a histone deacetylase activity (HDAC)-dependent manner.21 HP1α, like histone methylases (CARM1, SUV39h1, PRMT5, G9a), functions as a transcriptional regulator of BRG-1.22 BRG-1 but not BRM-1, interacts with a class of zinc finger proteins that regulate cellular differentiation and metabolism. In contrast, BRM-1 selectively interacts with a group of ankyrin repeat proteins required for Notch signal transduction.23 The mechanism by which the distinct binding partners for BRG-1 vs. BRM-1 contribute to selective pathways regulating cell cycle control has yet to be determined. The current studies were conducted to determine the molecular mechanism by which BRG-1 regulates cellular proliferation in breast cancer epithelial cells. BRG-1 is shown to inhibit MCF-7 cell DNA synthesis and siRNA analysis demonstrates BRG1 abundance represses endogenous cyclin D1. Transcriptional repression of the cyclin D1 gene occurred through the cyclin D1 promoter AP-1 and CRE sites. BRG-1 occupied the endogenous cyclin D1 AP-1 site. In ChIP assays, endogenous occupancy at the BRG1 site demonstrated recruitment of the coactivator PRMT5 and reduced recruitment of the corepressors HDAC and HP1α. Expression of PRMT5 induced, and expression of HDAC1, HP1α, G9a and SUV39h1 repressed the cyclin D1 promoter. Physiological stimuli regulate recruitment of BRG-1-associated histone deacetylases, arginine methyltransferases and heterochromatin silencing proteins, augmenting the recruitment of coactivators, and reducing the recruitment of corepressors to the endogenous cyclin D1 gene promoter.

Results To examine the role of BRG-1 in cell cycle control, adenoviral expression vectors encoding either GFP, BRG-1 or a mutant of 648

Cell Cycle

2008; Vol. 7 Issue 5


©

20

08

LA

ND

ES

BIO

SC

IEN

CE

.D

ON

OT D

IST

RIB

UT E

.

D1 promoter. Comparison was made between BRG1 and empty vector control. BRG-1 deficient cells showed high basal activity of the cyclin D1 promoter with ~50% repression upon expression of BRG-1 (data not shown). These studies suggest BRG-1 functions as a significant transcriptional repressor of basal cyclin D1 promoter activity. The cyclin D1 promoter AP-1 and CRE sites were required for full repression by BRG-1. In order to examine the transcription factor complexes bound to the endogenous cyclin D1 gene promoter at these sites, in the context of its local chromatin structure, chromatin immunoprecipitation assays (ChIP) were conducted in MCF-7 cells. Antibody specific to BRG-1 was used and oligonucleotides directed to the cyclin D1 gene promoter AP-1 site amplified endogenous cyclin D1 promoter sequences in chromatin immunoprecipitation assays. BRG-1 was identified at the cyclin D1 AP-1 site and siRNA to BRG-1 reduced binding of BRG-1 to this site (Fig. 4A). The endogenous hpS2 gene promoter was amplified by oligonucleotides directed to the hpS2 gene ERE in the presence of BRG1 specific antibody or equal amounts of IgG. The hpS2 gene promoter ERE bound BRG-1. BRG-1 recruitment to the hpS2 ERE was enhanced by estradiol (Fig. 4B). The BRG-1 deficient cell line, SW13, was used to conduct ChIP analysis on the endogenous hpS2 and cyclin D1 promoters. ChIP analysis of SW13 cells did not demonstrate BRG-1 recruitment to the promoter sequences from either the human cyclin D1 promoter or the hpS2 promoter ERE (Fig. 4C), demonstrating the selectivity of the BRG-1 chromatin immunoprecipitation assay. To determine the DNA sequence selectivity of BRG-1 interactions within the cyclin D1 promoter, MCF-7 cells were transduced with either the human cyclin D1 promoter containing the AP-1 and CRE sites or, as a control, the estrogen responsive hpS2 promoter which contains an estrogen response element (ERE).32 Comparisons were made between the human cyclin D1 promoter containing the AP-1 and CRE sites, with a cyclin D1 promoter construct encoding point mutations of the AP-1 and CRE sites.33 BRG-1 was recruited to the cyclin D1 promoter encoding wildtype AP-1 and CRE sites, but was not recruited to the cyclin D1 promoter encoding point mutations of the AP-1 Figure 1. BRG-1 inhibits DNA synthesis in MCF-7 cells. (A) Schematic representation of and CRE sites (Figure 4D). These studies suggest the BRG-1 wildtype and ATP binding domain mutant (K798R). (B) Schematic representation of binding of BRG-1 complexes to the AP-1 and CRE protocol for determining DNA synthesis. MCF-7 cells were transduced with BRG-1-expressing-virus and DNA synthesis was assessed after 24 hrs, or (C) 16 hrs after serum addition. sites of the cyclin D1 promoter in MCF-7 cells may be Tritiated thymidine uptake was assessed after 16 hrs. (D) DNA synthesis assessed by FACS required for full transcriptional repression by BRG-1. of BRG-1 transduced MCF-7 cells, compared with vector (*p < 0.05). As BRG-1 inhibited cyclin D1 abundance and promoter activity in the presence of serum and the AP-1 and CRE sites of the cyclin D1 promoter in transcriptional estrogen (Figs. 2 and 3), we investigated the occupancy of the cyclin repression by BRG-1 (Fig. 3B and C). To examine further the mech- D1 promoter upon serum and estradiol depletion. We hypothesized anism by which the cyclin D1 promoter was regulated by BRG-1, depletion of estradiol may reduce BRG-1 occupancy at the endogthe BRG-1-deficient cell line, SW13, was transfected with the cyclin enous cyclin D1 binding site. Alternatively the BRG-1 associated www.landesbioscience.com

Cell Cycle

649

UT E RIB IST OT D ON .D CE IEN

©

20

08

LA

ND

ES

BIO

SC

complexes may be altered by estradiol to reduce recruitment of corepressors. In order to characterize the components of the BRG-1 complex at the endogenous cyclin D1 gene promoter in the context of local chromatin, further chromatin immunoprecipitation (ChIP) assays were conducted. The estrogenresponsive target endogenous hpS2 gene promoter has been well characterized in MCF-7 cells, and was therefore used as a form of positive control.32 BRG-1 forms part of a multi-protein complex that may include protein arginine methyltransferases. The possibility that these enzymes may regulate the abundance of the rate limiting regulatory subunit of the serine threonine kinase that phosphorylates the pRB protein had not previously been considered. In view of the findings that BRG-1 repressed the cyclin D1 promoter, further analysis was made of the transcriptional complexes bound to the cyclin D1 AP-1 site in MCF-7 cells. PRMT5 and HP1α are part of the SWI-SNF complex.21,34 PRMT5 is a type II protein arginine methyltransferase identified through its association with Janus kinase (Jak2). PRMTs convey a component of the transcriptional repression of the c-Myc target gene.35 CARM1 (PRMT4) is a type 1 PRMT that targets arginine residues in the N- and C-terminal regions of histone H3.36 In the absence of ligand, HDAC1, HP1α, PRMT5 and BRM-1 occupied the estrogen-responsive region of the endogenous hpS2 gene promoter (Fig. 5A). Estradiol (E2–10 nM) treatment induced the recruitment of BRG-1, together with PRMT5 to the endogenous hpS2 gene promoter in MCF-7 cells (Fig. 5A). We next tested the E2 responsiveness of the -3.3 kb promoter fragment, physiological concentrations of E2 induced cyclin D1 promoter activity (Fig. 5B) as we had previously shown for the -1745 bp promoter fragment.37 As the cyclin D1 AP-1 and CRE sites were required for repression by BRG-1, we conducted ChIP analysis to determine whether BRG-1 occupied these regions of the endogenous cyclin D1 promoter in serum-starved, E2depleted media. The endogenous cyclin D1 gene promoter CRE and AP-1 sites

.


650

Figure 2. BRG-1 induces cyclin D1 and increases DNA synthesis. (A) BRG-1 reduction by siRNA (43%) in starvation conditions (0.1% FBS) and stimulation with 10% serum for 24 hours leads to a 2-fold increase in cyclin D1 abundance (p < 0.05). (B) Under serum starved conditions (5% charcoal stripped medium) BRG-1 reduction by siRNA increases cyclin D1 abundance by 2.5 fold (p < 0.05), stimulation with estradiol for 24 hrs leads to a 1.8 fold increased abundance of cyclin D1 compared to control siRNA (p = 0.07). Conversely cyclin E is reduced by BRG-1 siRNA treatment. (C) Estradiol stimulation of starved MCF-7 cells in the presence of siRNA against BRG-1 leads to a 2-fold increase in S-phase cells (N = 3) (*p < 0.05).

Cell Cycle


ND

ES

BIO

SC

IEN

CE

.D

ON

OT D

IST

RIB

UT E

.


20

08

LA

Figure 3. BRG-1 repression of the cyclin D1 promoter involves the AP-1 and CRE sites. (A) Cyclin D1 promoter (4.8 μg) activity was assessed in MCF-7 cells transduced with either BRG-1, (300, 450 ng) or equal amounts of control empty, expression vector (data are mean relative luciferase activity ± SEM for N > 5 throughout). (B) Cyclin D1 promoter reporter constructs, wildtype cyclin D1 or a point mutant of the CRE site, were assessed for relative activity in the presence of BRG-1 expression vector (450 ng). (C) -963 or -963 AP-1 mutant cyclin D1 promoter luciferase reporter (4.8 μg) and BRG-1 expression vector (450 ng) were assessed in MCF-7 cells (* p < 0.05).

©

contained endogenous BRG-1 (Fig. 5C). Estradiol treatment was associated with the recruitment of BRG-1, and PRMT5 and a reduction in HDAC1 at the AP-1 site and BRM-1 at both sites (Fig. 5C). A direct association between Prmt5 and BRG-1 has been previously demonstrated in NIH 3T3 cells by co-immunoprecipitation.38 As the HMTs were identified with BRG-1 at the cyclin D1 promoter, we investigated the ability of these HMTs and histone modifying proteins to regulate activity of the cyclin D1 promoter. PRMT5 and HP1α associate with BRG-1.21,35 Estradiol induced www.landesbioscience.com

recruitment of PRMT5 to the cyclin D1 BRG-1 binding site (Fig. 5C), with peak recruitment occurring after 45 minutes (data not shown). Transient transfection of the PRMT5 expression vector induced the cyclin D1 promoter (Table 1). E2 reduced recruitment of HDAC1 and HP1α. Transient transfection of HP1β repressed cyclin D1 promoter activity. Suv39h1 binds HP1α and expression of G9a and Suv39h1 repressed activity of the -3.3 kb and -1745 cyclin D1 promoters (Table 1). Collectively, these studies demonstrate expression of either BRG-1 or several BRG-1-associated proteins inhibit

Cell Cycle

651


RIB

UT E

.

Figure 4. BRG-1 binds the endogeneous cyclin D1 gene promoter in chromatin immunoprecipitation (ChIP) assays. (A) ChIP assay analysis of the endogenous cyclin D1 promoter in MCF-7 cells transduced with BRG-1 siRNA. Cells were treated either with estradiol or vehicle control for 1 hour. Antibodies used in ChIP assays are as described in Materials and Methods. BRG-1 siRNA reduces BRG-1 recruitment to the endogenous cyclin D1 promoter. (B) The endogenous hpS2 gene promoter was assessed for BRG-1 recruitment in the presence of estradiol. The hpS2 gene ERE demonstrates recruitment of BRG-1 in the presence of estradiol. BRG-1 siRNA reduces BRG-1 recruitment. (C) BRG-1-deficient SW13 cells demonstrate no recruitment of BRG-1 to either hpS2 or cyclin D1 gene endogenous promoters. (D) Human cyclin D1 promoter wildtype or AP-1 CRE mutant luciferase reporter gene expression vectors were analyzed with ChIP assays for BRG-1 recruitment. BRG-1 is recruited to the AP-1 and CRE sites of transfected reporter gene promoter plasmid DNA. Point mutation of either the AP-1 or CRE site abrogates recruitment of BRG-1. Cells were stimulated with estradiol or vehicle treated for 1 hour prior to collection (N = 3).

20

08

LA

ND

ES

BIO

SC

IEN

CE

.D

ON

OT D

IST

phase transition in MCF-7 cells, the cyclin D1 gene was repressed by BRG-1 expression. siRNA to BRG-1 reduced BRG-1 and enhanced serum- and E2-induced cyclin D1 abundance. This finding indicates a physiological role for endogenous BRG-1 in regulating the abundance of cyclin D1 through recruitment of coactivators and corepressors to the cyclin D1 promoter (Fig. 5D). Expression of cyclin D1 increased MCF-7 cell DNA synthesis assessed by tritiated thymidine uptake, increasing the proportion of cells in the DNA synthetic phase. siRNA to BRG-1 enhanced DNA synthesis, consistent with a role for endogenous BRG-1 as an inhibitor of S phase progression. These findings are consistent with prior observations that a reduction in cyclin D1 abundance by either immunoneutralizing antibodies or antisense gene expression reduced the rate of mid-G1 phase transition, with a consequent reduction in cells in the DNA synthetic phase in MCF-7 cells.17 BRG-1 is frequently deleted or mutated in a variety of tumor cells. Cyclin D1 is known to function as a collaborative oncogene, being required for the growth or induction of mammary tumorigenesis in mice.16 Furthermore, cyclin D1 overexpression in the mammary gland is sufficient for mammary tumorigenesis.39 The current studies are consistent with a model in which BRG-1 inhibition of cyclin D1 expression and DNA synthesis may contribute to BRG-1 tumor suppressor function. Herein, BRG-1 repression of the cyclin D1 promoter involved the cyclin D1 AP-1 and CRE sites. The mechanism by which BRG-1 repressed cyclin D1 was distinct from the previously described mechanism by which BRG-1 repressed cyclin E and cyclin A which involves E2F.11 The AP-1 site of the cyclin D1 promoter is a target of multiple oncogenic signal pathways.24 Activating mutants of Ras, v-Src, SV40t antigen and TPA induce cyclin D1 expression through the AP-1/CRE binding sites.14 Ras promotes cellular proliferation and early G1 phase progression40 and increases cyclin D1 protein abundance and promoter activity through the AP-1 site.24 BRG1 inhibition of cellular proliferation coincided with inhibition of cyclin D1 abundance. In other cell types cyclin E and cyclin A were repressed by BRG-1 in an E2F-dependent manner.10,11 Thus, although the cyclin D1 promoter contains E2F sites and BRG-1 was capable of inhibiting E2F transactivation (data not shown), these DNA sequences were not involved in transcriptional repression by BRG-1 in breast epithelial cells. BRG-1 thus functions to repress cyclin D1 through the same sites used by diverse oncogenic signals to activate cyclin D1.

©

cyclin D1 expression, consistent with a model in which BRG-1 functions at the cyclin D1 promoter to recruit corepressor function for BRG-1.

Discussion The current studies demonstrate that the BRG-1 component of the SW1/SNF complex inhibits proliferation of breast cancer epithelial cells and blocks G1/S phase transition. Consistent with the known role of the cyclin D1 gene in encoding a rate-limiting component of the holoenzyme that promotes serum-induced G1/S 652

Cell Cycle


SC

IEN

CE

.D

ON

OT D

IST

RIB

UT E

.


ND

ES

BIO

Figure 5. ChIP analysis of complexes recruited to BRG-1 at the endogenous human cyclin D1 promoter. (A) MCF-7 cells were used in ChIP assays with the antibodies as indicated for analysis of the human hpS2 and cyclin D1 genes. The endogenous hpS2 gene promoter ERE shows estradiol-dependent recruitment of BRG-1 with PRMT5 (N = 3). (B) The cyclin D1 promoter luciferase reporter was transfected into MCF7 cells and analyzed for E2-responsiveness. The luciferase reporter data is shown as mean ± SEM for N > 5 separate transfections. The alteration in luciferase activity is shown as RLU for N ≥ 6 (p < 0.05). (C) BRG-1 recruitment to the endogenous human cyclin D1 gene promoter is associated with a reduction in HDAC1, HP1α and BRM1 and increased abundance of PRMT5 (N = 3). Cells were stimulated with estradiol or vehicle treated for 1hour prior to collection. (D) Schematic representation of BRG-1 in regulating cyclin D1 expression; either repression, in association with HDAC1/Suv39h1/G9a/HP1α or activation, with PRMT5.

©

20

08

LA

Although much is known of the transcription factors14 little is known of the associated co-regulators that bind to the endogenous cyclin D1 gene in the context of its local chromatin. In the current studies, BRG-1 was recruited to the AP-1 and CRE sites of the cyclin D1 promoter in chromatin immunoprecipitation assays. Mutation of either site abrogated recruitment of BRG-1. ChIP assays demonstrated the concordant transient recruitment of BRG1 with the HMT PRMT5. Our findings are consistent with prior studies showing BRG-1, but not BRM-1 binds to HMT(s). In the current studies, the recruitment of BRG-1 to the cyclin D1 promoter AP-1 and CRE sites was associated with reduced occupancy of these sites by BRM-1. Herein, cyclin D1 was induced by expression of the HMT PRMT5. Our studies are consistent with recent findings demonstrating that overexpression of PRMT5 stimulates anchorage-dependent and independent growth.34 Corecruitment www.landesbioscience.com

of PRMT5 with BRG-1 was also previously observed at the CAD promoter.35 Cyclin D1 is known to be required for E2-mediated proliferation in MCF-7 cells. Herein cyclin D1 is shown to promote the induction of DNA synthesis in MCF-7 cells. The current studies characterize important similarities and differences between the canonical ERE of the hpS2 gene and the estrogen response region of the cyclin D1 promoter (AP-1/CRE sites). ERα was not detectable at the endogenous pS2 gene promoter, with rapid induction at 60 minutes. In contrast ERα was constitutively bound at the cyclin D1 AP-1 and CRE sites, with significant increase upon E2 treatment. E2 treatment induced cyclin D1 and induced the recruitment of coactivator proteins (PRMT5) and reduced the recruitment of corepresssor proteins (HDAC1, HP1, Suv39h1, G9a) to the cyclin D1 promoter BRG-1 binding sites. Thus, BRG-1-associated proteins were dynamically

Cell Cycle

653


Table 1 R egulation of cyclin D1 promoter activity in MCF7 cells Histone Modifier

-3295 CD1 luc

-1745 CD1 luc

HP-1β

↓1.5X

↓1.9X

PRMT5

↑1.4X

↑3.5X

G9A

↓5X

↓5X

SUV39H1

↓2X

↓3X

UT E

.

The -3.3 kb and -1.7 kb cyclin D1 promoter luciferase reporter was assessed for regulation by co-transfected expression plasmids encoding PRMT5, G9a, Suv39h1, HP1β and BRG-1. The data are mean relative luciferase activity for N ≥ 5 separate transfections with comparison made between expression vector and equal amount of empty expression vector (p < 0.05).

OT D

IST

RIB

phosphate precipitation, the media was changed after 6 hours and luciferase activity determined after a further 24 hours. At least 2 different plasmid preparations of each construct were used. In cotransfection experiments, a dose response was determined in each experiment using 300 and 600 ng of expression vector with the cyclin D1 promoter reporter plasmid (4.8 μg). DNA content analyses and Western blots. Cellular DNA content was analyzed by tritiated thymidine incorporation and determined by scintillation counting of trichloroacetic acid-precipitable materials, and DNA synthesis activity was presented as counts per minute (CPM). Cell cycle status of cells was determined using a fluorescence-activated cell sorter (FACStar plus; Beckton Dickonson). The cells were collected by trypsinization, fixed in 10% methanol, resuspended in PBS containing 20 mg/ml propidium iodide (PI) and 5U RNase A. When a GFP marker was used, GFP-positive cells were selected as previously described.19 Protein abundance was determined by Western blot analysis using, a cyclin D1 antibody (Ab-3, Lab Vision Corp) or Brg1 antibody (sc8749, Santa Cruz Biotechnology) as previously described.24 Guanine nucleotide dissociation inhibitor (GDI) (4809, RTG solutions), vinculin (v-9131, Sigma-Aldrich), or β-tubulin (H-235, Santa Cruz Biotechnology) was used as an internal control for protein loading. Densitometry values obtained from AlphaEase FC software (Alpha Innotech Corp) were normalized to loading control. siRNA transfection. The siRNA to BRG-1 (Santa Cruz, Biotechnology) and control siRNA (Qiagen) were transfected using oligofectamine (Invitrogen) according to the manufacturer’s instructions. Briefly, cells were seeded at 60% density in 6 well plates. Cells were washed once in PBS followed by transfection with either control siRNA or Brg1 siRNA to a final concentration of 80 nM in phenol red free, serum free and antibiotic free DMEM. In stimulation experiments, cells were arrested by starvation in 0.1% FBS or 5% charcoal stripped medium for 72 hrs. Cells were stimulated with either 10% serum or Estradiol at physiological concentrations for 24 hrs and collected for western blotting and/or DNA content analysis by flow cytometry. ChIP (chromatin immunoprecipitation) assay. ChIP assays were performed as previously described to either the endogenous cyclin D1 or hpS2 gene, or to transfected wildtype or mutant reporter genes.30 Antibodies used in ChIP are as follows; Brg1 (07478), HDAC1 (05-614), HP1α (05-689), PRMT5 (07-405) from Upstate and BRM1 (sc-28710) from Santa Cruz Biotechnology. The endogenous human cyclin D1 gene promoter-specific primers used were: (AP-1 site: 5'-CTGCCTTCCTACCTTGACCA-3'

ON

recruited to a common site at the cyclin D1 promoter in the context of local chromatin. It is known that HDAC activity is indirectly recruited to an HP1-rich domain via SUV39.41,42 The presence of multiple distinct estrogen-responsive elements with distinct kinetics of recruitment of ER-regulatory complexes likely contributes to the fine-tuning required to coordinate the induction of DNA synthesis by estradiol and the integration of this information with additional proliferative or anti-proliferative cues, including growth factors and oncogenes. The current studies are consistent with our prior analysis of the cyclin D1 gene during cellular differentiation. In our previous studies of the INI1 component of the SW1/SNF complex, induction of the flat cell morphology coincided with repression of cyclin D1. In these studies, conducted during cellular differentiation, INI1 regulated cyclin D1 through a Rb/E2F site.43 E2F sites of cell cycle control proteins demonstrate distinct roles and occupancy during cellular proliferation and differentiation.44 INI1 occupancy of the cyclin D1 promoter E2F site during differentiation is consistent with the emerging view that E2F target sites of several cell cycle control genes become deacetylated and recruit histone methyltransferases, mediating gene silencing during cell cycle exit.44 In contrast, the E2F site does not demonstrate occupancy of transcriptional response complexes containing methyltransferases in cycling cells.44 The current studies suggest the AP-1 site of the cyclin D1 gene functions as a target of the HMTs recruited to the BRG-1 binding site by physiological stimuli in proliferating cells.

.D

Materials and Methods

©

20

08

LA

ND

ES

BIO

SC

IEN

CE

Expression vectors and reporter plasmids. A series of 5' promoter deletions and heterologous reporter constructions derived from the human cyclin D1 genomic clone were linked to the luciferase reporter gene.20,24 The sequence from -1746 to -3.3 kb of the human cyclin D1 promoter (Genebank: Z29078) was isolated from MCF-7 cells genomic DNA by PCR adding KpnI sites at both 3'- and 5'-ends. The PCR purified product was ligated at -1745 of the human cyclin D1 promoter after linearizing with KpnI. The expression vectors encoding wildtype BRG-1, pBJS hBRG1 and mutant BRG-1 (hBRG-1ΔE7, and hBRG-1-ATP(K798R))9 were kind gifts from Dr. S. Goff and Dr. G. Crabtree. The adenoviral vectors for Brg1 and Brg1 ΔATP were kindly provided by Dr. D. J. Murphy.12 The expression vectors for CARM125 and G926 were gifts from Dr. M. Stallcup. PRMT527 and HP1α (unpublished) were gifts from Dr. C. Sardet and Dr. R.J. Lechleider, respectively. The plasmid encoding green fluorescent protein, pEGFP-N1 was from Clontech. The cyclin D1 cDNA was cloned into the MSCV virus and linked via an IRES to GFP to form MSCV-cyclin D1-IRES-GFP.28 The MSCV-IRES-GFP retrovirus vector and the ecotropic, packaging vector pSV-Ψ-E-MLV which provides ecotropic packaging helper function and infection methods were as described previously.28 The adenovirus encoding BRG-1 or the ATPase-defective BRG-1 mutant were prepared as described.12 Cell culture, DNA transfection and luciferase assays. Cell culture, DNA transfection and luciferase assays were performed as previously described.29 The human breast carcinoma cell line MCF7, the adrenocortical tumor derived cell line SW13 and 293T cells were maintained in DMEM with 10% Fetal Bovine Serum (FBS) and 1% penicillin/streptomycin. Cells were transfected by calcium 654

Cell Cycle



20. Watanabe G, et al. Induction of cyclin D1 by simian virus 40 small tumor antigen. Proc Natl Acad Sci USA 1996; 93:12861-6. 21. Nielsen AL, et al. Selective interaction between the chromatin-remodeling factor BRG1 and the heterochromatin-associated protein HP1alpha. Embo J 2002; 21:5797-806. 22. Bannister AJ and Kouzarides T. Reversing histone methylation. Nature 2005; 436:1103-6. 23. Kadam S and Emerson BM. Transcriptional specificity of human SWI/SNF BRG1 and BRM chromatin remodeling complexes. Mol Cell 2003; 11:377-89. 24. Albanese C, et al. Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions. J Biol Chem 1995; 270:23589-97. 25. Teyssier C, Chen D and Stallcup MR. Requirement for multiple domains of the protein arginine methyltransferase CARM1 in its transcriptional coactivator function. J Biol Chem 2002; 277:46066-72. 26. Lee DY, Northrop JP, Kuo MH and Stallcup MR. Histone H3 lysine 9 methyltransferase G9a is a transcritional coactivator for nuclear receptors. J Biol Chem 2006; 281:8476-85. 27. Fabbrizio E, et al. Negative regulation of transcription by the type II arginine methyltransferase PRMT5. EMBO Rep 2002; 3:641-5. 28. Neumeister P, et al. Cyclin D1 governs adhesion and motility of macrophages. Mol Biol Cell 2003; 14:2005-15. 29. Pestell RG, Albanese C, Hollenberg A and Jameson JL. Transcription of the human chorionic gonadotropin a and b genes is negatively regulated by c-jun. J Biol Chem 1994; 269:31090-6. 30. Fu M, et al. The androgen receptor acetylation site regulates cAMP and AKT but not ERKinduced activity. J Biol Chem 2004; 279:29436-49. 31. Wang S, Zhang B and Faller DV. Prohibitin requires Brg-1 and Brm for the repression of E2F and cell growth. EMBO J 2002; 21:3019-28. 32. Métivier R, et al. Estrogen receptor-α directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 2003; 115:751-63. 33. Albanese C, et al. IKKalpha Regulates Mitogenic Signaling through Transcriptional Induction of Cyclin D1 via Tcf. Mol Biol Cell 2003; 14:585-99. 34. Pal S, Vishwanath SN, Erdjument Bromage H, Tempst P and Sif S. Human SWI/SNFassociated PRMT5 methylates histone H3 arginine 8 and negatively regulates expression of ST7 and NM23 tumor suppressor genes. Mol Cell Biol 2004; 24:9630-45. 35. Pal S, et al. mSin3A/histone deacetylase 2- and PRMT5-containing Brg1 complex is involved in transcriptional repression of the Myc target gene cad. Mol Cell Biol 2003; 23:7475-87. 36. Fu M, et al. Acetylation in hormone signaling and the cell cycle. Cytokine Growth Factor Rev 2002; 13:259-76. 37. Liu MM, et al. Opposing action of estrogen receptors alpha and beta on cyclin D1 gene expression. J Biol Chem 2002; 277:24353-60. 38. Dacwag CS, Ohkawa Y, Pal S, Sif S and Imbalzano AN. The protein arginine methyltransferase Prmt5 is required for myogenesis because it facilitates ATP-dependent chromatin remodeling. Mol Cell Biol 2007; 27:384-94. 39. Wang TC, et al. Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature 1994; 369:669-71. 40. Dobrowolski S, Harter M and Stacey DW. Cellular ras activity is required for passage through multiple points of the G0/G1 phase in BALB/c 3T3 cells. Mol Cell Biol 1994; 14:5441-9. 41. Czermin B, et al. Physical and functional association of SU(VAR)3-9 and HDAC1 in Drosophila. EMBO Rep 2001; 2:915-9. 42. Vaute O, Nicolas E, Vandel L and Trouche D. Functional and physical interaction between the histone methyl transferase Suv39H1 and histone deacetylases. Nucleic Acids Res 2002; 30:475-81. 43. Zhang ZK, et al. Cell Cycle Arrest and Repression of Cyclin D1 Transcription by INI1/ hSNF5. Mol Cell Biol 2002; 22:5975-88. 44. Ait-Si-Ali S, et al. A Suv39h-dependent mechanism for silencing S-phage genes in differentiating but not in cycling cells. EMBO Journal 2004; 23:605-15.

RIB

ON

References

IST

This work was supported in part by awards from the NIH R01CA70896, R01CA75503, R01CA107382. This project is funded, in part, under a grant with the Pennsylvania Department of Health and Dr. Ralph and Marian C. Falk Medical Research Trust (R.G.P.). The Department specifically disclaims responsibility for any analyses, interpretations or conclusions and the Susan Komen Breast Cancer Foundation, BCTR0504227 (C.Wang). We thank Almeta Mathis for assistance in preparing the manuscript. Work conducted at the Kimmel Cancer Center was supported by the NIH Cancer Center Core Grant P30CA56036 (R.G.P.).

OT D

Acknowledgements

UT E

.

and 5'-TGAAGGGACGTCTACACCCC-3') (CRE site: 5'GCCCCCCTCCCGCTCCCATT-3' and 5'-TGGGGCTCTTCC TGGGCAGC-3') (E2F site: 5'- TATGAAAACCGGACTACAGGG3' and the endogenous human pS2 gene promoter 5'-ACTCTGCTGCTCGCTGCTACT-3') (ERE site: 5'-GGCCAT CTCTCACTATGAATCACTTCTGA-3' and 5'GGCAGGCTCT GTTTGCTTAAAGAGCG-3'). For analysis of BRG-1 chromatin binding to either cyclin D1 wild type or mutant promoter sequences, cells were transiently co-transfected with the cyclin D1 promoter constructions, -1745 or -1745-AP-1/CRE mutant reporter, then cultured for 36 h. The cells were crosslinked with formaldehyde buffer for 10 minutes at 37°C.30

©

20

08

LA

ND

ES

BIO

SC

IEN

CE

.D

1. Lusser A and Kadonaga JT. Chromatin remodeling by ATP-dependent molecular machines. Bioessays 2003; 25:1192-200. 2. Sif S, Saurin AJ, Imbalzano AN and Kingston RE. Purification and characterization of mSin3A-containing Brg1 and hBrm chromatin remodeling complexes. Genes Dev 2001; 15:603-18. 3. Xu W, et al. A methylation-mediator complex in hormone signaling. Genes Dev 2004; 18:144-56. 4. Khavari P, Peterson C, Tamkun J, Mendel D and Crabtree G. BRG1 contains a conserved domain of the SWI2/SNF2 family necessary for normal mitotic growth and transcription. Nature 1993; 366:170-4. 5. Hendricks KB, Shanahan F and Lees E. Role for BRG1 in cell cycle control and tumor suppression. Mol Cell Biol 2004; 24:362-76. 6. Bultman S, et al. A Brg1 null mutation in the mouse reveals functional differences among mammalian SWI/SNF complexes. Mol Cell 6, 1287-95 (2000). 7. Reisman DN, Sciarrotta J, Wang W, Funkhouser WK and Weissman BE. Loss of BRG1/ BRM in human lung cancer cell lines and primary lung cancers: correlation with poor prognosis. Cancer Res 2003; 63:560-6. 8. Klochendler Yeivin A, et al. The murine SNF5/INI1 chromatin remodeling factor is essential for embryonic development and tumor suppression. EMBO Rep 2000; 1:500-6. 9. Dunaief JL, et al. The retinoblastoma protein and BRG1 form a complex and cooperate to induce cell cycle arrest. Cell 1994; 79:119-30. 10. Strobeck MW, et al. BRG-1 is required for RB-mediated cell cycle arrest. Proc Natl Acad Sci USA 2000; 97:7748-53. 11. Zhang HS, et al. Exit from G1 and S phase of the cell cycle is regulated by repressor complexes containing HDAC-Rb-hSWI/SNF and Rb-hSWI/SNF. Cell 2000; 101:79-89. 12. Murphy DJ, Hardy S and Engel DA. Human SWI-SNF component BRG1 represses transcription of the c-fos gene. Mol Cell Biol 1999; 19:2724-33. 13. Wang S, Zhang B and Faller DV. BRG1/BRM and prohibitin are required for growth suppression by estrogen antagonists. Embo J 2004; 23:2293-303. 14. Fu M, Wang C, Li Z, Sakamaki T and Pestell RG. Minireview: Cyclin D1: Normal and Abnormal Functions. Endocrinology 2004; 145:5439-47. 15. Hulit J, et al. Cyclin D1 genetic heterozygosity regulates colonic epithelial cell differentiation and tumor number in ApcMin mice. Mol Cell Biol 2004; 24:7598-611. 16. Lee RJ, et al. Cyclin D1 is required for transformation by activated Neu and is induced through an E2F-dependent signaling pathway. Mol Cell Biol 2000; 20:672-83. 17. Zwijsen RML, et al. Cyclin D1 triggers autonomous growth of breast cancer cells by governing cell cycle exit. Mol Cell Biol 1996; 16:2554-60. 18. Lee RJ, et al. pp60(v-src) induction of cyclin D1 requires collaborative interactions between the extracellular signal-regulated kinase, p38, and Jun kinase pathways. A role for cAMP response element-binding protein and activating transcription factor-2 in pp60(v-src) signaling in breast cancer cells. J Biol Chem 1999; 274:7341-50. 19. D’Amico M, et al. The role of Ink4a/Arf in ErbB2 mammary gland tumorigenesis. Cancer Res 2003; 63:3395-402.

www.landesbioscience.com

Cell Cycle

655