Mar 5, 2016 - Piero Cervella, Lorenzo Silengo, Cristina Pastore, and Fiorella Altrudat. From the Dipartimento di ...... Schultz R.. Mark. D.. and Werb. 2. (19881.
THEJOURNAL OF
BIOLOGICAL CHEMISTRY
Vol. 268, No. 7, Issue of March 5, pp. 5148-5155,1993 Printed in U.S.A.
Q 1993 by The American Society for Biochemistry and Molecular Biology. Inc.
Human &-Integrin Gene Expression Is Regulated by Two Promoter Regions* (Received for publication, September 9, 1992)
Piero Cervella, Lorenzo Silengo, Cristina Pastore, and Fiorella Altrudat From the Dipartimento di Genetica, Biologia e Chimica Medica, Uniuersita’di Torino, Via Santena 5 bis-10126, Torino, Italy
We report the cloning of two full-length cDNAscoding for the human B1-integrinwhich diverge from each other for their 5”untranslated sequences. Characterization of a genomic clone containing these two sequences showed that they are contiguous, spaced by 261 nucleotides, and both followed by donor splice sites. Analysis by primer extension and transient transfection in a human osteogenic sarcoma cell line (MG-63) demonstrated the existence of two independent promoters for transcription initiation. The two promoter regions are veryG + C-rich, and lack both a TATA box and a CAAT box. Northern blot analysis showed that transcripts starting from the distal promoter (with respect to the first coding exon) are at least 20-foldmore abundantthan transcripts originating from the proximal one. The levels of both transcripts increase after transforming growth factor-B1 induction, however, mRNAs originating from the proximal promoter increase at an higher extent. Reverse transcriptaseJpolymerasechain reaction analysis performed on different human tissues and cell lines revealed that, while the distal promoter is ubiquitously active, the proximal promoter is not. These findings suggest a possible complex pattern for regulation of the human B1-integringene expression.
differentiation and development. &-Class integrins are not only involved in cell adhesion and migration but also seem to be responsible for signal transduction (11-14). In many cell types the PI gene is constitutively expressed, reflecting the multiple functions mediated by the a/& receptors. Expression of individual receptors appears to be regulated during development (15-17). It has been demonstrated that several stimuli can readily alter theexpression of &-integrin (18,19).Growth signals as TGF-&’ modulate the expression of p1 in WI-38 human fibroblasts and in the osteosarcoma cell line MG-63. An increase in P1-subunit expression by TGF-8, has been demonstrated at the mRNA level in WI-38 (20) cells and at the protein level in MG-63 cells (21). To elucidate the molecular mechanisms controlling integrin expression several efforts have beenaddressed to study the regulation of transcription of integrin-encoding genes. To date the promoter regions of a5 (22), a4 (23), CDllb (24), and GPIIb (25, 26) integrins have been characterized. Except for as, which has a widespread distribution, the other integrins are expressed in a tissue-specific manner. Here, we report the firstcharacterization of the 5”flanking region of a P1-integrin-encodinggene. The regulatory region of the human P1-integrin gene consists of two promoters tandemly located. The two promoters drive the expression of the unique &-gene resulting in the synthesis of at least two mRNAs that diverge only in the complete 5’untranslated regions but share the same coding sequence as it is indicated by the isolation of two cDNAs with this strucThe P1-subgroup of the integrin family comprises at least 6 ture. Promoter activities detected by transfection assays are different receptors that mediate attachment of cells to the consistent with the different levels of mRNA observed in extracellular matrix as well as cell-cell interactions (1-4). physiological conditions. Results show that &-subunit expresFunctional receptors of this subfamily are dimers sharing a sion is regulated at themRNA level by TGF-8,. common &-subunit but distinct a-subunits. The binding specMATERIALS ANDMETHODS ificities and affinities for fibronectin, laminin, type I collagen, and other as yet unknown cell adhesion protein are given by Cloning and Nucleotide SequenceDetermination of B1-Zntegrin Gene the a-subunits (1-8). Further diversities in ligand binding 5“Flanking Region-Plaque hybridization and phage DNA preparaspecificity are attained by the same receptor when expressed tion were essentially performed as previously described (27). A human by different cell types (6, 9, 10). A wide number of investiga- placenta cDNA library constructed into the phage vector X-gtll (a tions indicates that the &-subgroup is directly involved in generous gift of J. Millan, La Jolla Cancer Research Foundation, La Jolla, CA) was screened by plaque hybridization using a synthetic processes such as gastrulation, neural crest cells migration, 100-nt long oligonucleotide, which recognizesthe sequence coding for organogenesis, wound healing, and tumor metastasis through the first 33 amino acids of the PI cytoplasmic domain (28). Positive the interaction of a5/p1receptor and fibronectin. Integrins clones were subcloned into the EcoRI site of the plasmid pBlueare involved in cell proliferation and morphogenesis during Script11 (Stratagene) and characterized by restriction and sequence * This research was supported inpart by Consiglio Nazionale delle
analysis. Sequences were performed according to the dideoxynucleotide chain terminationmethod using a T7 DNA polymerase sequencing kit (Pharmacia LKB Biotechnology Inc.). A 240-bp EcoRI-AccI restriction fragment (Fig. 1) was used to screen a human genomic library constructed into the phage vector X-EMBL3. Positive clones were further characterized by using two probes generated by splitting the 240-bp EcoRI-AccI fragment in a 90-bp EcoRI-BglI probe specific
Richerche, Progetto Finalizzato Ingegneria Genetica, and by the Italian Minister0 Pubblica Istruzione. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. The nucleotide sequence(s)reported in thispaper has been submitted The abbreviations used are: TGF, transforming growth factor; to the GenBankTM/EMBL Data Bank withaccession numbeds) PCR, polymerase chain reaction; PIPES, 1,4-piperazinediethanesulX68969. 4 To whom correspondence should be addressed Dipartimento di fonic acid; bp, base pair; kbp, kilobase pair; nt, nucleotide; NF-1, Genetica, Biologia e Chimica Medica, Via Santena 5 bis-10126, TO- nuclear factor-1; GP, glycoprotein; CAT, chloramphenicol acetyltransferase. rino, Italy. Tel.: 39-11-6963106;Fax: 39-11-634788.
5148
5149
Promoter Regions of bl-lntegrin Gene
A
cDNA21 ATG
cDNA8 B a l I
ATG
M
I
I
B cDNA21 +I
-53
GGAACAGCA~GCCCGAGCCCACCGCGCCGGGCCCCGGACGCCGCGCGGAAAAGAT6AATTTACAACCAATTTTCTGGATT Dpcr 5”CAGCAGGCCCGAGCCCACCG->
GGACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCMACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGG
AccI AGAATGTATACAAGCAGGGCCMATTGTGGGTGGTGCACAMTTCMCATTTTTACAGGAAGGAATGC < - C G G T T T A A C A C C C A C C A C G C C ~ C ~ ~ ~ Apr C~~~-~’
+I
CGCCCCCTGACACCTGCGGACACCCGCCGGGCTGGGCAAGCGCAGA~ATTTACMCCAATTTTCTGGATTGGACTGAT AccI CAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAAT~
TACAAGCAGGGCCAAATTGTGGCTGGTGCAC~TTCAACATTTTTACAGGAAGGAATGC..........
