Cell Transplantation, Vol. 21, pp. 2009–2019, 2012 Printed in the USA. All rights reserved. Copyright 2012 Cognizant Comm. Corp.
0963-6897/12 $90.00 + .00 DOI: http://dx.doi.org/10.3727/096368912X640448 E-ISSN 1555-3892 www.cognizantcommunication.com
Intraparenchymal Injection of Bone Marrow Mesenchymal Stem Cells Reduces Kidney Fibrosis After Ischemia-Reperfusion in Cyclosporine-Immunosuppressed Rats C. Alfarano,* C. Roubeix,* R. Chaaya,*†‡ C. Ceccaldi,*§ D. Calise,* C. Mias,*† D. Cussac,*† J. L. Bascands,* and A. Parini*† *Inserm, UMR 1048, Institute of Metabolic and Cardiovascular Diseases (I2MC), Toulouse, France †Université Toulouse III Paul Sabatier, Toulouse, France ‡Université Saint Joseph, Beirut, Lebanon §CIRIMAT-UMR 5085 UPS-INPT-CNRS, Toulouse, France
Ischemia-reperfusion and immunosuppressive therapy are a major cause of progressive renal failure after kidney transplantation. Recent studies have shown that administration of bone marrow mesenchymal stem cells (MSCs) improves kidney functional recovery in the acute phase of post ischemia-reperfusion injury. In the present study, we used an original model of renal ischemia-reperfusion in immunosuppressed rats (NIRC) to investigate the effects of bone marrow MSCs on progression of chronic renal failure and the mechanisms potentially involved. Left renal ischemia-reperfusion (IR) was induced in unilateral nephrectomized Lewis rats. After IR, rats were treated daily with cyclosporine (10 mg/kg SC) for 28 days. MSCs were injected into the kidney at day 7 after IR. At day 28 after IR, kidneys were removed for histomorphological, biochemical, and gene expression analysis. The effect of conditioned media from MSCs on epithelial–mesenchymal transition was studied in vitro on HK2 cells. Our results show that, as compared to untreated NIRC rats, rats treated by intrarenal injection of MSCs 7 days after IR displayed improvement in renal function, reduction of interstitial fibrosis, and decrease in chronic tubule injury. These effects were associated with a decrease in interstitial a-SMA accumulation and MMP2 activity, markers of fibroblast/fibroblast-like cell activation, and renal remodeling, respectively. Finally, experiments in vitro showed that MSC-conditioned medium prevented epithelial–mesenchymal transition induced by TGF-b in HK2 cells. In conclusion, our results show that, in immunosuppressed animals, a single intrarenal administration of MSCs reduced renal fibrosis and promoted the recovery of renal function. Key words: Mesenchymal stem cells; Kidney; Ischemia-reperfusion; Cyclosporine
atrophy (IFTA) (37). In the case of kidney transplantation, IFTA can be due to various immunological and nonimmunological insults (13). The immunological factors have been and continue to be under intensive investigation (14). Among the nonimmunological causes, renal toxicity induced by chronic administration of calcineurin inhibitors such as cyclosporine (CsA) seems to play an important role in progression of kidney damage (19,28). At present, strategies to prevent and/or reverse chronic renal dysfunction after ischemia-reperfusion are one of the major challenges in the field of nephrology. During the last years, cell therapy has shown promising therapeutical properties in the field of renal diseases (1,4,7,12,23). In the case of post ischemia-reperfusion acute renal failure, others and we have shown that administration of MSCs in rodent improves the recovery of
INTRODUCTION Renal ischemia-reperfusion occurs in different clinical situations including kidney transplantation, cardiopulmonary bypass, aortic bypass surgery, accidental trauma, sepsis, and hydronephrosis (15). Within the first hours after ischemia-reperfusion, acute renal failure represents the major clinical event associated with significant morbidity and mortality (11,20). Despite the progress in the field of intensive care medicine over the past years, approximately 12.5% of acute renal failure survivors are dialysis dependent (rates range widely from 1–64%, depending on the patient population), and 19–31% of them have chronic kidney disease (18). Chronic renal dysfunction after ischemia-reperfusion is usually associated to tissue damage characterized by interstitial fibrosis and tubular
Received Febuary 15, 2011; Final acceptance September 25, 2011. Online prepub date: April 17, 2012. Address correspondence to Angelo Parini, UMR 1048, Institute of Metabolic and Cardiovascular diseases (I2MC), CHU Rangueil, 1 avenue Jean Poulhès, BP 84225, 31432 Toulouse Cedex 4, France. Tel: +33 561325601; Fax: +33 562172554; E-mail:
[email protected]
2009
2010
renal function and stimulates angiogenesis and tubular regeneration (24,27,40). Post ischemia-reperfusion chronic kidney disease (CKD) is characterized by the accumulation of extracellular matrix and usually results in a loss of function when normal parenchyma is replaced by fibrotic tissue. We have recently demonstrated that bone marrow MSCs strongly prevent and reverse fibrosis in a rodent model of post ischemic heart failure (26). Indeed we showed that intracardiac administration of bone marrow MCSs in the chronic phase of ventricular remodeling decreases the extracellular matrix accumulation and improves cardiac function (26). In addition, we demonstrated that this effect was related to the inhibition of fibroblast activation by paracrine factors secreted by bone marrow MSCs (26). Based on these results, we aimed to investigate the effects of bone marrow MSCs on progression of post ischemia-reperfusion renal remodeling and dysfunction and the mechanisms potentially involved. With this scope, we used an original rodent model that we have recently designed (6), mimicking the development of chronic renal disease occurring in clinic after ischemiareperfusion and immunosuppressive therapy. Using this model, we investigated (i) whether cellbased therapy using bone marrow MSCs directly injected in the kidney prevents or reduces the development of fibrosis and (ii) the impact of paracrine factors secreted by bone marrow MSCs on epithelio-mesenchymal transition (EMT) of kidney proximal tubular cells in vitro. MATERIALS AND METHODS Animals Female Lewis rats weighing 180–200 g (Harlan, Gannat, France, http://www.harlan.com) were housed in an air-conditioned room with 12-h light and dark cycles in an environment controlled at a temperature of 22 ± 2°C and a relative humidity of 45%. Animals occupied standard cages with free access to food and water ad libitum. All experiments reported were conducted in accordance with the European Communities Council Directive (86/609/EEC) for experimental animal care and were approved by a local animal care and use committee. Surgery Protocols Unilateral Nephrectomy. Under anesthesia with isoflurane/oxygen inhalation (3%:97%), rats were subjected to right nephrectomy. The kidney was isolated (the adrenal gland remained intact), legated with 4–0 silk suture, and excised. Renal Ischemia-Reperfusion and Cyclosporine Treat ment. Seven days after uninephrectomy, rats were anesthetized with isoflurane/oxygen inhalation (3%:97%), and ischemia was induced by clamping the left renal vessels for 45 min using atraumatic vascular microclamps (Arex,
ALFARANO ET AL.
France). After clamp removal, the left kidney was inspected for restoration of blood flow. During surgery, the animals were kept at a temperature of 37 ± 1°C on a thermostatically controlled table with a rectal temperature probe (Harvard Instruments) under anesthesia. Twenty-four hours after ischemia-reperfusion (IR), all rats were treated daily with cyclosporine A (Sandimmune, 10 mg/kg SC) for 28 days. The animals subjected to nephrectomy, ischemia-reperfusion, and cyclosporine treatment are designed as NIRC group (Nephrectomy + Ischemia-Reperfusion + Cyclosporine). Control-operated animals were subjected to the same surgical procedure without clamping the renal pedicle. At the end of the treatment, rats were euthanized, and blood samples were collected from aortic abdominal artery and centrifuged (10 min, 8,000 rpm). Plasma was stored at -80°C until following analysis. The left kidney was isolated and fixed in 4% paraformaldehyde solution (24–48 h) for following histological analysis or snap frozen in liquid nitrogen and stored at -80°C for RNA and protein extraction. Mesenchymal Stem Cell Injection Seven or fourteen days after renal ischemia-reperfusion injury, two different groups of animals (n = 8 for each group) were anesthetized by isoflurane/oxygen inhalation (3%:97%) and subjected to MSCs intraparenchymal injection (NIRC + MSCs group; 3 ´ 106 cells) or not (NIRC group; culture medium alone). The injection has been performed in three different areas in the medial longitudinal axis of ischemic kidney (3 ´ 106 cells per kidney). According with our previous results (27), MSCs were pretreated with melatonin (24 h, 5 mM), in order to preserve them from early death after graft. Then cells were extensively washed with phosphate buffer solution, trypsinized, and labeled with Quantum Dot Fluorescent Nanocrystals (Qtracker 655 labeling kit, Invitrogen) according to manufacturing instructions. An appropriate number of cells were resuspended into 30 ml of a-MEM for each injection. MSCs were visualized by fluorescent microscopy on tissue paraffin section (4 mm) of kidney collected at the moment of sacrifice. Rat Bone Marrow Mesenchymal Stem Cell Isolation and Culture MSCs were obtained from bone marrow of male Lewis rats (Harlan, France) weighing 180–200 g. Bone marrow from femur cavities was flushed with a-minimal essential medium (a-MEM; ABCYs, Paris) containing 10% fetal calf serum (FCS) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA), and the cell suspension was centrifuged (1,200 rpm, 5 min). Then cells were plated in T175 culture flasks (200,000 cells/cm2). Nonadherent cells were removed after 72 h, and MSCs were recovered by their capacity to adhere highly to plastic culture dishes. As previously described (27), the cells were also phenotyped by positive expression of MSCs markers (CD90,
Mesenchymal Stem Cells on Kidney Fibrosis
CD29, and CD106) and negative for hematopoietic cells (CD34), vascular cells (CD31), or B-cell markers (CD45). MSCs were then routinely cultured and were used from the passage 3 to the passage 6 for the experiments. Renal Function Plasma creatinine (µmol/L) and urea (mmol/L), which reflects renal function, were measured with a Luminex 100 IS system (Luminex Corporation, USA). Quantification of Renal Fibrosis and Tubular Dilatation For light microscopic investigations, renal tissue specimens were fixed in 4% paraformadehyde solution and embedded in paraffin. Paraffin sections (4 mm) were stained with hematoxylin/eosin (H&E) and Sirius Red (Sigma Aldrich, France). Three different histological preparations obtained from each animal (n = 8 animals per group) were semiquantified microscopically using MorphoExpert software. Tubular dilatation was measured on H&E-stained tissue slides, and the percentage of fibrosis was estimated by Sirius Red-stained surface compared to total kidney tissue area. Immunofluorescence Immunodetection of a-smooth muscle actin (a-SMA) was performed in kidney paraffin-embedded sections. Slides were deparaffinized, rehydrated, and submitted to Tris–EDTA antigen retrieval solution (pH 9; 30 min, 95°C). The endogenous peroxidase activity was blocked with 3% hydrogen peroxide and nonspecific antigen sites were saturated with TBS containing 1% of nonfat dry milk. Then slides were incubated with mouse monoclonal antia-SMA (1:1,000, 2 h at room temperature; clone 1A4, Sigma-Aldrich, France), washed with TBS containing 0.1% of Tween 20 and finally incubated with Alexa Fluor 568 (A11019, Invitrogen, France) for 45 min. Pictures were captured by fluorescence microscopy (magnification: 200´). Determination of mRNA Gene Expression Total RNA was isolated from frozen rat tissue using RNeasy kit (Qiagen, France) according to manufacturer’s protocol. RNA content was measured by a NanoDrop detector (ND-1000 spectrophometer). RNA quality was evaluated by ExperionTM RNA HighSens Analysis Kit (Bio-Rad, USA). cDNA was synthesized from equal amounts of RNA (1 mg) using the SuperScriptTM II Reverse Transcriptase (Invitrogen, CA). Real-time PCR (ABI Prism 7000 HT Sequence Detection System) for type I, type III, and type IV collagen was performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, USA), with the following primer pairs: type I collagen forward GCTTGATCTGTATCTGCCAC/ reverse CACTCGCCCTCCCGTTT; type III collagen forward ACAGCAGTCCAATGTAGATGAATT/reverse
2011
CCCGAGTCGCAGACACATATT; type IV collagen for ward ATTCCTTTGTGATGCACACCAG/reverse AAG CTGTAAGCATTCGCGTAGTA. The reaction mixture was preheated at 95°C for 10 min, followed by 40 cycles (95°C/15 s and 60°C/1 min). Each assay, carried out in triplicate, was normalized by amplifying the housekeeping cDNA glyceraldehyde-3phosphate dehydrogenase (GAPDH; forward primer: TGTTCTAGAGACAGCCGCATCTT/reverse primer: CACAGCCTTGGCAGCACC) and ß-actin (forward primer: CTAAGGCCAACCGTGAAAAGAT/reverse primer: A GGGACAACACAGCCTGGAT) from the same cDNA sample, and the relative gene expression was calculated by the comparative Ct method (2-DDCt). Western Blot Analysis Kidney tissue samples and cell monolayer were homogenized in lysis buffer (10 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.1% SDS) with a protease inhibitor cocktail (Sigma). Homogenates were centrifuged (10,000 rpm, 10 min, 4°C) to eliminate tissue and cells debris, and resulted supernatants were used to electrophoresis. The protein concentration was measured using BioRad Protein Assay (Bio-Rad Laboratories, Ivry-sur-Seine, France). Equal amounts of protein for each sample (10 and 30 µg for a-SMA and matrix metalloprotease 2 (MMP2)/ E-cadherin expression, respectively) were denaturated for 10 min at 95°C with Laemmli buffer and were separated by sodium dodecyl sulfate polyacrylamide gel electrophore sis (SDS-PAGE; 10% acrylamide) using Kalleidoscope Precision Plus ProteinTM as molecular weight standards (Bio-Rad). Gels were transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with TBS-0.2% Tween + 2% bovine serum albumin (BSA; Sigma) at room temperature for 2 h and probed with polyclonal mouse anti-a-SMA (1:7,000, Sigma), monoclonal mouse anti-MMP2 (1:500; TebuBio) or monoclonal mouse anti-E-cadherin (E-cadh; 1:500; BD Biosciences) overnight at 4°C. The membranes were washed three times with TBS0.2% Tween and incubated for 30 min with the appropriate secondary antibody (1:10,000) conjugated with peroxidase (ECLTM anti-rabbit, ECLTM anti-mouse, or ECLTM anti-goat, GE Healthcare, Little Chalfont, GB). Detection was performed by ECL reaction (Invitrogen). Membranes were reblotted with polyclonal goat anti-GAPDH (1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA). Protein bands were quantified by densitometry using ImageJ software, and results were expressed as protein of interest/GAPDH ratio. Gelatine Zymography Analysis Pro and active forms of MMP2 (gelatinase A) were analysed by gelatin zymography. Protein concentrations of different samples were measured using the Bio-Rad Protein Assay (Bio-Rad Laboratories, Ivry-sur-Seine,
2012
France). The samples containing an equal amount of total proteins (30 µg) were mixed with loading buffer [75 mM Tris–HCl (pH 6.8), SDS 1.5%, glycerol 1.65% (v/v), bromophenol blue 0.025%] and loaded onto 8% SDS-PAGE containing 0.8% bovine gelatine A. After electrophoresis, gels were incubated with 2.5% TritonX-100 for 2 h followed by incubation in an activation buffer [50 mM Tris–HCl (pH 7.5), 150 mM NaCl, and 1 mM CaCl2] overnight at 37°C until enzymatic degradation of the substrate took place. Gels were stained with an aqueous solution [Coomassie blue (0.25%; R-250 Brilliant Blue, Sigma, St. Louis, MO), ethanol (50%), and acetic acid (10%)] and then destained with an aqueous solution [acetic acid (10%) and ethanol (50%)]. Gelatinolytic bands were observed as clear zones against the blue background. MMPs are dissociated from their inhibitors during the electrophoresis, and their refolding after removal of SDS allows the measurement of the activity not only of their active forms but also of their artificially activated latent forms (pro-MMP). The intensity of the bands was quantified by gel densitometry using the “Image J” software (version 1.42q; National Institutes of Health, USA). Human MSCs Isolation and Conditioned Medium Collection Mesenchymal stem cells were obtained from bone marrow aspirate from the iliac crest of five patients (four male, ages, 35, 38, 39 and 55 years; one female, age, 51 years) after informed consent according to institutional guidelines; human MSCs have been prepared by the “Etablissement Français du Sang” according to the Good Manufacturing Practice rules. The procedures for MSC preparation have been validated by the French Health Products Safety Agency. For the primo-culture (P0), total bone marrow cells were cultured (5 ´ 104 cells/cm2) in complete medium: a-MEM + 10% fetal calf serum + 10 µg/ml of ciprofloxacin. After 3 days in culture, nonadherent cells were harvested and medium was replaced by fresh complete medium. Then the culture is feed 2 times a week until confluence or after a maximum of 21 days. Then the cells (mainly MSCs) are detached by trypsin + EDTA and counted using trypan blue exclusion. They are cultured once in the same medium at 1 ´ 103 cells/cm2 until confluence or for a maximum of 21 days (first passage, P1). They are then detached and counted. The MSCs at P0 or P1 are cryopreserved until their use. For conditioned medium, collection human MSCs raising 80% of confluence were washed and then replaced in the complete medium under normal conditions for 124 h. Supernatants of MSCs were collected, centrifuged at 1,200 rpm for 2 min to eliminate cell residues, and finally preserved at -80°C until its following utilization for experiments on human kidney tubular epithelial cell line (HK2).
ALFARANO ET AL.
HK2 Culture and Treatment Human kidney tubular epithelial cell line (HK2) was obtained from the American Type Culture Collection (Rockville, MD, USA). Cells were maintained at 37°C in an atmosphere of 95% air and 5% CO2 in DMEM containing 10% fetal bovine serum (PAA, Linz, Austria) and 1% penicillin/streptomycin (Gibson BRL, USA). After digestion with 0.25% trypsin (Invitrogen, Carlsbad, CA) and 0.02% EDTA, 1.0 x 105 cells were grown in six-well plates; then cells were stimulated for 72 h with recombinant human transforming growth factor-b1 (TGF-b1; 10 ng/ml; eBioscience, San Diego, USA) dissolved in normal culture medium or in MSC-conditioned medium. For experiments, cells were divided into four groups based on different experimental conditions as follows: control in normal culture medium, TGF-b1 (10 ng/ml)treated cells in normal culture medium, control cells in MSC-conditioned medium, TGF-b1 (10 ng/ml)-treated cells in MSC-conditioned medium. Images (200´ magnification by phase contrast microscopy) of cells were collected at 72 h to evaluate morphological changes, and cell monolayers were washed with ice-cold phosphate buffer and preserved at -80°C before protein extraction as previously described. Statistical Analysis All data were expressed as means ± SEMs. Groups of data were compared with an analysis of variance (ANOVA) followed by post hoc tests (Bonferroni’s posttest). Values of p < 0.05 were considered as significant. RESULTS Effects of MSCs on Kidney Function As already described (6), our animal model consisted of a right nephrectomy, ischemia-reperfusion injury on the left kidney, and cyclosporine treatment for 28 days (NIRC group). MSCs, obtained from bone marrow of male Lewis rats, were directly injected into renal parenchyma at 7 or 14 days after ischemia-reperfusion injury. In order to evaluate the effect of MSC injection on kidney function, we measured the creatinine and urea plasma levels on blood samples collected 7, 14, and 28 days after ischemia-reperfusion injury, and we compared the results obtained in untreated animals (NIRC group) with those of the animals subjected to MSC injection (NIRC + MSCs). At these experimental conditions, NIRC rats presented a significantly increase in plasma creatinine (Fig. 1A) and urea (Fig. 1B) compared to control group, reaching the maximum value 7 days after IR. The injection of MSCs 7 days after IR ameliorated kidney function as shown by the significant decrease in plasma creatinine (Fig. 1C) and urea (Fig. 1D) as compared to NIRC rats at 28 days after IR.
Mesenchymal Stem Cells on Kidney Fibrosis
2013
Figure 1. Effect of MSC injection on kidney function. (Top) Plasma creatinine (A) and urea (B) in NIRC animals at 7, 14, and 28 days after IR. (Middle) plasma creatinine (C) and urea (D) levels determined 28 days after IR injury from animals subjected to MSC injection (NIRC + MSCs) 7 days after IR. (Bottom) Plasma creatinine (E) and urea (F) levels determined 28 days after IR injury from animals subjected to MSC injection (NIRC + MSCs) 14 days after IR compared to untreated animals (NIRC). *p
