Introduction The prevalence of Bartonella, hemoplasma, and ...

Article

The prevalence of Bartonella, hemoplasma, and Rickettsia felis infections in domestic cats and in cat fleas in Ontario Ali Kamrani, Valeria R. Parreira, Janice Greenwood, John F. Prescott

Abstract The prevalence of persistent bacteremic Bartonella spp. and hemoplasma infections was determined in healthy pet cats in Ontario. Blood samples from healthy cats sent to a diagnostic laboratory for routine health assessment over the course of 1 y were tested for Bartonella spp. using both polymerase chain reaction (PCR) and blood culture, and for the presence of hemoplasma by PCR. The overall prevalence of Bartonella spp. by PCR and by culture combined was 4.3% (28/646) [3.7% (24/646) Bartonella henselae, 0.6% (4/646) Bartonella clarridgeiae]. The novel B. henselae PCR developed for this study demonstrated nearly twice the sensitivity of bacterial isolation. The overall prevalence of hemoplasma was 4% (30/742) [3.3% (25/742) Candidatus Mycoplasma haemominutum, 0.7% (5/742) Mycoplasma haemofelis]. There was no significant difference between the prevalence of infection by season or by age (# 2 y, . 2 y). Candidatus Mycoplasma turicensis was identified, for the first time in Canada, in 1 cat. The prevalence of Bartonella (58%) and hemoplasma (47% M. haemofelis, 13% M. haemominutum) in blood from a small sampling (n = 45) of stray cats was considerably higher than that found in healthy pet cats. The prevalence of Rickettsia felis in cat fleas was also assessed. A pool of fleas from each of 50 flea-infested cats was analyzed for the presence of R. felis by PCR. Rickettsia felis was confirmed, for the first time in Canada, in 9 of the 50 samples. Therefore, the prevalence of Bartonella and hemoplasma infection in healthy pet cats is relatively low. Further, the control of cat fleas is important because of the public health significance of Bartonella and R. felis infection.

Résumé La prévalence d’une bactériémie persistante à Bartonella spp. et d’une infection à hémoplasma a été déterminée dans une population de chats en santé provenant de l’Ontario. Des échantillons sanguins de chat en santé envoyés à un laboratoire de diagnostic pour un bilan de santé de routine durant une période d’une année ont été éprouvés pour Bartonella spp. par réaction d’amplification en chaîne par la polymérase (PCR) et par hémoculture, et pour la présence d’hémoplasma par PCR. La prévalence globale de Bartonella spp. par PCR et culture combinés était de 4,3 % (28/646) [3,7 % (24/646 Bartonella henselae, 0,6 % (4/646) B. clarridgeiae]. L’épreuve PCR développée pour la présente étude avait une sensibilité presque le double de l’isolement bactérien. La prévalence globale d’hémoplasma était de 4 % (30/742) [3,3 % (25/742) Candidatus Mycoplasma haemominutum, 0,7 % (5/742) M. haemofelis]. Il n’y avait pas de différence significative entre les prévalences d’infection selon la saison ou le groupe d’âge (# 2 ans, . 2 ans). Candidatus Mycoplasma turicensis a été identifié chez un chat pour la première fois au Canada. La prévalence de Bartonella (58 %) et d’hémoplasma (47 % M. haemofelis, 13 % M. haemominutum) dans le sang d’un échantillonnage restreint (n = 45) de chats errants était considérablement plus élevée que chez des chats en santé. La prévalence de Rickettsia felis chez des puces de chats a également été évaluée. Un pool de puces provenant de chacun de 50 chats infestés par des puces a été analysé par PCR pour la présence de R. felis. La présence de R. felis a été confirmée pour la première fois au Canada dans 9 des 50 échantillons. Ainsi, la prévalence d’infection par Bartonella et hémoplasma chez des chats en santé est relativement faible. De plus, la maîtrise des puces de chat est importante compte tenu de l’impact sérieux en santé publique des infections par Bartonella et R. felis. (Traduit par Docteur Serge Messier)

Introduction Healthy cats may be subclinical carriers of blood-borne bacterial infections that are potentially serious zoonotic pathogens and which may cause severe diseases in other cats. The genus Bartonella is comprised of fastidious hemotropic bacteria that have been increasingly identified in a wide range of domestic and wild animals (1). Domestic cats are the primary reservoir of 3 species of Bartonella,

B. henselae, B. clarridgeiae, and B. kohlerae (2–4), all of which may cause various clinical manifestations in humans (4,5). Bartonella henselae is the major causative agent of cat scratch disease (CSD) in immunocompetent people and of bacillary angiomatosis and hepatic peliosis in patients with a defective immune system, especially those infected with human immunodeficiency virus (HIV) (5,6). As a result of the development of sensitive molecular techniques for the diagnosis of Bartonella organisms in human patient tissue samples, and because

Department of Pathobiology, and Centre for Public Health and Zoonoses, University of Guelph, Guelph, Ontario N1G 2W1 (Kamrani, Parreira, Prescott); Vita-Tech Laboratories, 1345 Denison Street, Markham, Ontario L3R 5V2 (Greenwood). Address all correspondence to Dr. J.F. Prescott; telephone: (519) 824-4120, ext 54453; fax: (519) 824-5930; e-mail: [email protected] Received September 6, 2007. Accepted January 8, 2008. 2008;72:411–419

The Canadian Journal of Veterinary Research

411

of the increasing numbers of patients with defective immune systems through HIV infection or the use of immunosuppressive drugs, Bartonella spp. have emerged as agents of zoonotic infections (7). This study is the first to use both blood culture and polymerase chain reaction (PCR) to investigate the prevalence of Bartonella bacteremia in both pet and stray domestic cats in Ontario. Feline hemobartonellosis is a bacteremic infection in cats that may be associated with severe hemolytic anemia. The etiologic agents of this infection, Mycoplasma haemofelis and Mycoplasma haemominutum, may cause severe hemolytic anemia, and subtle anemia or subclinical infection, respectively, in cats (8). Candidatus Mycoplasma turicensis is a recently recognized hemotropic mycoplasma, first identified in 2005 in Switzerland in a cat with hemolytic anemia (9). This study is the first to investigate the prevalence of the hemoplasmas, including Candidatus Mycoplasma turicensis, in pet and stray cats in Ontario. Rickettsia felis is a recently recognized agent of flea-borne spotted fever in humans (10–12). The cat flea is the major vector of this organism. In endemic areas of the United States, peri-urban opossums are the major reservoir host of R. felis. The reservoir potential of cats has yet to be determined, although experimental infection of cats with R. felis has been demonstrated (13,14). One objective of this study was to determine if R. felis is present in cat fleas in Canada.

Materials and methods Blood samples Blood from healthy domestic cats in southern Ontario was collected in tubes containing ehtylenediamine tetra-acetic acid (EDTA) anticoagulant, and submitted to a laboratory (Vita-Tech Laboratories, Markham, Ontario) as part of a routine “wellness” program for cats. Care was taken to exclude samples from animals that were either suspect or clinically ill. A convenience sampling method was used, whereby approximately 45 cats . 2 years old, and 14–45 cats, # 2 years old, were collected each month. A total of 742 samples were collected over a period of 12 mo (April 2006 to March 2007). Blood samples were also collected from 45 stray cats, found within Wellington County, Ontario. Blood was stored at 270°C prior to testing.

Cat fleas Fleas were collected in the summer of 2006 from cats submitted for care to 3 local Humane Societies located in Guelph (n = 4), Kitchener-Waterloo (n = 7), and Cambridge (n = 3). In addition, fleas were collected from cats within the Wellington County area (n = 36), and submitted to the Ontario Veterinary College for teaching and research purposes. One flea sample consisted of 1–5 fleas pooled from each flea-infested cat. Fleas were identified as Ctenocephalides felis based on current taxonomic keys (http://www.icb.usp.br/~marcelcp/Ctenocephalidesfelis.htm) and stored in 70% ethanol prior to testing.

DNA extraction and PCR amplification The DNA for PCR amplification was extracted from a 200 mL aliquot of each EDTA-treated blood sample using a commercial

412


kit (QIAamp DNA Blood Mini Kit; Qiagen, Mississauga, Ontario). Purified DNA was eluted in 150 mL elution buffer and stored at 220°C. Pooled flea samples were prepared for DNA extraction by first rinsing in sterile distilled water for 5 min at room temperature. Each sample was macerated completely in a 1.5 mL microcentrifuge tube using a sterile pipette tip. The DNA was extracted, according to the manufacturer’s instructions, using the QIAamp DNA Blood Mini Kit (Qiagen), eluted in 100 mL elution buffer and stored at 220°C. To monitor the extraction process for any foreign DNA contamination, a negative “DNA extraction” control, consisting of 200 mL sterile phosphate buffered saline (pH 7.2, PBS), was included in each batch of samples processed. Various primer combinations, each targeting the 16S–23S rRNA intergenic region of the genus Bartonella, were assessed for their amplification efficiency of plasmid DNA containing the target gene of B. henselae (ATCC 4988). Oligonucleotide sequences of each primer are listed in Table I. The following primer combinations were examined: primer pair JF 311/JR 473, as described by Jensen et al (15); primer pair MF 321/MR 983, as described by Maggi and Breitschwerdt (16); and, a novel combination of the primers MF 321/JR 473. The PCR amplifications were performed in a 25 mL reaction mix containing a ready-to-use PCR buffer that included a proof-reading hot start DNA polymerase (Platinum PCR SuperMix High Fidelity; Invitrogen, Burlington, Ontario), 0.3 pmol/mL of each primer, and 2 mL DNA template (0.02 ng, plasmid DNA containing B. henselae target gene). Use of proof-reading DNA polymerase on Bartonella DNA when samples were extracted from blood, removed some nonspecific amplification observed with Taq polymerase (data not shown). Amplification conditions used in this assay consisted of denaturation at 94°C for 2 min, 45 cycles of 30 s of denaturation at 94°C, 30 s of annealing at 58°C, 30 s of extension at 68°C, followed by an additional cycle of 7 min extension at 68°C. The predicted size of the amplicons resulting from this PCR reaction were calculated to be 152 bp, 136 bp, 233 bp, 242 bp, and 187 bp for B. henselae, B. clarridgeiae, B. elizabethae, B. vinsonii subsp. berkhoffii, and B. bovis, respectively. The PCR amplification products were visualized by ethidium bromide fluorescence after electrophoresis in a 3% agarose gel. The primer pair MF 321/JR 473 was used in subsequent PCR amplification of DNA isolated from feline blood and pooled flea samples. A single-step PCR assay first described by Jensen et al (17) was used for the detection of the hemoplasmas. Oligonucleotide primer sequences are listed in Table I. Since Candidatus M. turicensis has the same amplicon size as M. haemofelis using this amplification protocol, Candidatus M. turicensis-specific primers (Table I) were used in a second PCR protocol on all M. haemofelis PCR-positive cases identified. This second PCR amplifies a 1317 bp region of the 16S rRNA gene of Candidatus M. turicensis. For both PCR reactions for hemoplasma detection, 2 mL of DNA template was added to make a total 25 mL reaction mixture containing 0.8 pmol/mL of each primer and a ready-to-use PCR mixture containing a proof-reading hot-start DNA polymerase (Platinum PCR SuperMix High Fidelity, Invitrogen). A touch-down PCR program was used: 95°C for 5 min, 35 cycles of 95°C for 30 s, 60°C to 50°C for 30 s/cycle (the annealing temperature is decreased by 1°C every cycle until 50°C, after which each cycle was for 30 s), 68°C for 2 min, and finally, 68°C for 10 min.

2000;64:0–00

Table I. Sequence of oligonucleotide primers used for PCR assays Primer (target gene) JF 311 (16S–23S rRNA)

Nucleotide sequence 59-39 CCTTCGTTTCTCTTTCTTC

Organism detected Bartonella spp.

JR 473 (16S–23S rRNA)

AACCAACTGAGCTACAAGCC

Bartonella spp.

(15)

MF 321 (16S–23S rRNA)

AGATGATGATCCCAAGCCTTCTGG

Bartonella spp.

(16)

MR 983 (16S–23S rRNA)

TGTTCTAACAACAATGATGATG

Bartonella spp.

(16)

HF (16S rRNA)

ACGAAAGTCTGATGGAGCAATA

Feline hemoplasma organisms

(17)

HR (16S rRNA)

ACGCCCAATAAATCCGRATAAT

Feline hemoplasma organisms

(17)

MTF (16S rRNA)

GAACTGTCCAAAAGGCAGTTAGC

M. turicensis

(9)

MTR (16S rRNA)

AGAAGTTTCATTCTTGACACAATTGAA

M. turicensis

(9)

CSF (gltA)

GGGGGCCTGCTCACGGCGG

Rickettsia spp.

(19)

CSR (gltA)

ATTGCAAAAAGTACAGTGAACA

Rickettsia spp.

(19)

OMF (rOmpB)

CCGCAGGGT TTGTAACTGC

Rickettsia spp.

(19)

OMR (rOmpB)

CCTTTTAGATTACCGCCTAA

Rickettsia spp.

(19)

The PCR amplification products were visualized by ethidium bromide fluorescence following electrophoresis in a 2% agarose gel. The DNA extracts from pooled fleas and blood from stray cats were amplified targeting 2 different genes of R. felis in 2 separate reactions. The first pair of primers amplified a 381 bp sequence of the citrate synthase (gltA) gene of the genus Rickettsia (Table I). The second pair of primers amplified a 840 bp sequence of an outer membrane protein B gene (rOmpB) of R. felis (Table I). For both reaction mixes, 5 mL of DNA template was added to make a total 25 mL volume of PCR reaction mix containing 13 PCR buffer (New England Biolabs, Pickering, Ontario), 0.2 mM dNTPs (Roche Diagnostics GmbH, Mannheim, Germany) 2.5 mM Mg21, 1 pmol/mL of each primer and 1 U of Taq polymerase (New England Biolabs). The PCR was carried out with an initial denaturation at 94°C for 3 min followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and elongation at 72°C for 30 s. The amplification was completed with an additional elongation at 72°C for 7 min. The PCR products were electrophoresed through 2% agarose gel and visualized, after ethidium bromide labelling, under UV light. All PCR assays were carried out in a Model T Gradient thermocycler (Biometra, Göttingen, Germany). To avoid PCR amplification product carryover, DNA extraction, PCR reaction set-up, and gel electrophoresis were each carried out in a different room. Appropriate negative reagent controls and positive DNA plasmid controls, containing the target gene of each relevant organism, were included in each PCR assay.

DNA sequencing To confirm the identity of PCR-amplified products, selected amplicons were sequenced (Guelph Molecular Supercentre, Laboratory

2000;64:0–00

Reference (15)

Services Division, University of Guelph, Guelph, Ontario) using an ABI Prism 3100 Genetic Analyzer, and the Big Dye Terminator Reaction Kit (Version 3) (Applied Biosystems) with either universal or specific primers. Sequencing was performed directly on amplicons resulting from PCR amplification using primers specific for B. clarridgeiae, R. felis, or Candidatus M. turicensis. The PCR products resulting from DNA amplification specific for B. henselae were cloned into pGEM-T Easy vector (Promega; Fisher Scientific, Nepean, Ontario) and sequenced. The obtained sequences were compared to known sequences held in the GenBank database using the nucleotide-nucleotide BLAST function.

Blood culture for Bartonella spp. Initially, 2 culture methods were used for isolation of Bartonella. The first was direct culture of 200 mL of each blood sample on Brain Heart Infusion Agar (BHIA) (Difco, Detroit, Michigan, USA) with 5% chocolatized sheep blood (“chocolate agar”). Agar plates were incubated at 35°C in a 5% CO2 water-saturated atmosphere for 6 wk. The DNA was extracted from suspect colonies (small, slow growing) and sequences specific to Bartonella spp. were targeted as described previously. The other method used was a novel liquid medium, Bartonella-Alphaproteobacteria growth medium (BAPGM) (18). A 200 mL aliquot of blood was inoculated into a tube containing BAPGM. Each tube was cotton plugged and incubated for 12 d at 35°C in a 5% CO2, water-saturated, atmosphere. After incubation, 200 mL of the blood-inoculated medium was used for DNA extraction and amplification. In addition, 200 mL of the blood-inoculated liquid medium that had been incubated for 12 d was plated on BHIA with 5% chocolatized sheep blood. The plates were then incubated for another 12 d at 35°C, as described. The DNA was isolated from


413

for 12 d at 35°C. The DNA was extracted from the BAPGM and tested using the Bartonella spp. specific PCR. Aliquots of the inoculated BAPGM media were subcultured onto chocolate agar for a further 12 d; this study was done in triplicate.

Statistical analysis The association of categorical variables of age categories and seasons of the year with each infection were tested by a chi-squared or Fisher’s exact test. The level of significance was considered at P , 0.05. All of the statistical analyses were carried out using statistical software (MINITAB, version 15.1; Minitab, State College, Pennsylvania, USA).

Results PCR assay for Bartonella detection Various primer combinations, each targeting the 16S–23S rRNA intergenic region of the genus Bartonella, were assessed for their efficiency of amplification of plasmid DNA containing the target gene of B. henselae. Based on band intensity, the novel combination of the forward primer MF 321 and the reverse primer JR 473 (Table I) (9,15–17,19) gave better amplification than the original combination of MF 321 and MR 983 or JF 302 and JR 473 suggested by Maggi and Breitschwerdt (16) and by Jensen et al (15), respectively (Figure 1), and was therefore used throughout the study. The PCR was optimized for DNA template concentration and annealing temperature (data not shown).

Results of PCR on blood from healthy cats

Figure 1. Comparison of the efficiency of the combination of primers JF-JR and MF-JR. Lane A — amplification of a 170 bp PCR product of 16S–23S rRNA intergenic spacer region of B. henselae by primers JF-JR. Lane B — amplification of a 152 bp PCR product of 16S–23S rRNA intergenic space of B. henselae by primers MF-JR. The same concentration of the cloned plasmid has been used as a DNA template for both reactions. L: 50 bp. Agarose gel 3%.

suspect colonies (small, slow growing) and tested in the PCR assay for confirmation as Bartonella spp.

Comparison of the sensitivity of blood culture and PCR for Bartonella detection The sensitivity of PCR and of blood culture on solid or in liquid media for detection of Bartonella spp. in blood was compared in the following way. Colonies of an isolate of B. henselae made from one of the cats in the study were suspended in 700 mL sterile PBS. After homogenization of the suspension, 10-fold serial dilutions were made in PBS until 1029; 200 mL of each dilution was used for DNA extraction and PCR amplification using primers specific for Bartonella spp. In addition, 200 mL of each dilution was plated on chocolate agar. The number of colony-forming units for each dilution was determined following 12 d incubation at 35°C. Furthermore, 200 mL of each dilution was inoculated directly into BAPGM and incubated

414


A total of 646 and 742 blood samples, from July 2006 to March 2007, were tested by PCR for the presence of Bartonella and hemoplasma, respectively. The overall results of specific PCR on blood samples are shown in Table II, while the monthly results for PCR are given in Table III. The prevalence of infection with Bartonella and hemoplasma in different seasons is illustrated in Figure 2. There was no association between the presence of Bartonella spp. and of hemoplasma in healthy cats (Fisher exact probability test: P = 0.42). No association was found between age category, # 2 and . 2 years old, for either infection (P = 0.064 for Fisher’s exact test for Bartonella infection and P-value = 0.457 for Fisher’s exact test for hemoplasma infection). No association was found between each infection and the season of sampling (P = 0.36 for chi-squared test for Bartonella infection and P = 0.33 for chi-squared test for hemoplasma infection). After applying Candidatus M. turicensis-specific PCR to all M. haemofelis PCR-positive samples, 1 cat from the domestic pet cat population yielded a PCR product consistent with the expected Candidatus M. turicensis amplicon of approximately 1300 bp. The sequenced PCR product was 99% identical to, and had the highest homology with, the 16S rRNA gene sequence of Candidatus M. turicensis in GenBank (Accession number DQ464422.1).

Comparison of the sensitivity of culture and PCR Comparison of the sensitivity of detection of Bartonella, which had been serially diluted in saline, showed that PCR was up to 10 times more sensitive than culture on chocolate agar, and that PCR

2000;64:0–00

Table II. Results of specific PCR on DNA extracted from the blood of pet and stray domestic cats, as well as fleas isolated from stray cats Organism amplified B. henselae B. clarridgeiae M. haemofelis M. haemominutum R. felis

Pet cat 3.2% (21/646) 0.6% (4/646) 0.6% (5/742) 3.3% (25/742) N/A

Sample source Stray cat 57.7% (26/45) 0 46.6% (21/45) 13% (6/45) 0

Fleas 90% (45/50) 12% (6/50) 10% (5/50) 56% (28/50) 18% (9/50)

Table III. Results of specific PCR and direct culture of blood in chocolate agar for the detection of Bartonella spp. in pet cats in Ontario (April 2006 to March 2007) Method, age category Culture B. henselae # 2 years old

Apr 0/16

May 0/11

Jun 0/20

Jul 0/41

Number of positive samples identified per month Aug Sep Oct Nov Dec Jan 1/37 2/45 1/44 0/42 1/27 0/45

Feb 2/45

Mar 0/25

Total positive 7/398 (1.8%)

PCR B. henselae # 2 years old

N/A

N/A

N/A

2/43

2/37

5/45

N/A

2/43

1/28

0/45

2/45

1/25

15/311 (4.8%)

PCR B. clarridgieae # 2 years old

N/A

N/A

N/A

0/43

0/37

0/45

N/A

1/43

0/28

0/45

0/45

1/25

2/311 (0.6%)

Culture B. henselae . 2 years old

1/45

0/45

2/30

0/41

0/45

0/45

1/40

3/45

0/42

0/43

0/45

0/32

7/498 (1.4%)

PCR B. henselae . 2 years old

N/A

N/A

N/A

0/45

1/45

1/38

N/A

0/45

0/42

2/43

0/45

2/32

6/335 (1.8%)

PCR B. clarridgieae . 2 years old

N/A

N/A

N/A

0/45

1/45

1/38

N/A

0/45

0/42

0/43

0/45

0/32

2/335 (0.6%)

detected between 1 and 10 colony-forming units. The broth culture medium BAPGM, which was subcultured on chocolate agar, was found to be between 100 and 1000 times less sensitive than direct culture on chocolate agar. Culture in BAPGM broth, followed by DNA extraction and PCR analysis was found to be about 100 times less sensitive than direct culture on chocolate agar. Because of the toxicity of the BAGPM medium identified in the controlled sensitivity experiments, its use was discontinued after the first 200 blood samples were cultured.

culture for B. henselae (Table III). Bartonella clarridgeiae was not isolated from any of the samples tested.

Results of blood culture on chocolate agar

Results of PCR on fleas

Initially 938 blood samples were cultured for Bartonella detection from April 2006 to March 2007. Of these samples, 42 blood samples were discarded because of contamination. There was no significant association between Bartonella isolation and season (chi-squared test 1.15, P = 0.76), nor between Bartonella isolation and age (Fisher’s exact probability test, P = 0.78). With the exception of 3 samples, all blood samples positive by culture were also PCR positive. Direct PCR on blood was found to be 1.7 times more sensitive than blood

Results of specific PCR on pooled flea samples are shown in Table II. Using primers targeting the gltA gene of R. felis, 5 of 50 samples were identified as positive and confirmed to be positive by sequencing of the resulting amplicons In contrast, 9 of 50 samples were identified as being positive using primers targeting the rOmpB of R. felis. Sequencing of the amplicons showed 99% homology to the rOmpB sequence of R. felis in GenBank (Accession Number CP000053.1). Three samples that yielded PCR products

2000;64:0–00

Results of PCR on blood from stray cats The results of PCR for Bartonella spp., hemoplasma, and R. felis shown in Table II indicate the high prevalence of B. henselae (58%) and the absence of B. clarridgeiae in these cats. The high prevalence of M. haemofelis (47%) and its greater prevalence than M. haemoninutum (13%) is also shown (Table II).


415

Prevalence (%)

5 4 3 2 1 0 Summer

Fall

Winter Seasons

B. haenselae

B. clarridgeiae

M. haemofelis

M. haemominutum

Figure 2. The prevalence of blood-borne infection in domestic cats in Ontario from summer 2006 to winter 2007 detected by PCR. Summer was defined as July to September, Fall as October to December, and Winter as January to March.

of the size expected for B. henselae were cloned into pGEM-T Easy vector, and sequenced. Resulting sequences shared 99% homology to a 16S–23S rRNA ITS sequence of B. henselae Houston-1 strain in GenBank (Accession Number BX897699.1). To confirm the identity of PCR products identified as B. clarridgeiae, 2 samples were found to be 98% identical to the 16S–23S rRNA ITS sequence of B. clarridgeiae Houston-2 strain in GenBank (Accession Number AF312497).

Discussion This is the first systematic study of the prevalence of Bartonella spp. and hemoplasma infection in healthy cats in Ontario, and the first to report the presence of R. felis in cat fleas in Canada. The study also documents the uncommon presence of Candidatus M. turicensis. There was a marked contrast between the relatively low prevalence of these bacteremic infections in healthy pet cats versus their high prevalence in stray cats, and a strikingly higher frequency of M. haemofelis in stray cats than in pet cats. In contrast to the blood from stray cats, the dominant hemoplasma species in fleas was M. haemominutum, as it was in pet cats, but the prevalence of B. henselae in fleas was similarly very high. The PCR assay suggested by Jensen et al (15) for diagnosis of bartonellosis has been widely used in various epidemiological studies (20–23). The primers used may nonspecifically amplify the ubiquitous organisms of Mesorhizobium spp., so that Maggi and Breitschwerdt suggested that other primers be used (16). However these primers amplify a region of B. henselae in which there are variable repeats, resulting in amplicons of unpredictable sizes (24). The use of a novel combination of these primers (MF321/JR473) was chosen for study in this investigation. These primers amplify the most common veterinary-relevant Bartonella spp. but do not target the variable repeat region of B. henselae, thus yielding PCR products of predictable and consistent size. In addition, PCR using this novel primer pair may be more sensitive for the detection of Bartonella spp. in blood than other PCR assays reported. For clinical samples, PCR detection of Bartonella spp. was almost twice as sensitive as culture of blood samples on chocolate agar, which was less than the sensitivity assessed using serially diluted cultures. Since 3 culture-positive samples were missed by PCR, the new PCR approach used here is not perfect, so that the best method for diagnosis of Bartonella bacteremia may be a combination of PCR

416


and culture (25). In some other studies, blood culture has been shown to be more sensitive than PCR (25). Culture of blood would intuitively be an optimal approach to diagnosis, because of the relatively large volumes of blood that can be assessed compared with PCR. We observed that PCR was, surprisingly, more sensitive than blood culture. The novel liquid culture medium (BAGPM) described by Maggi et al (18) was, however, far less sensitive than culture of blood in chocolate agar or direct PCR. Recently described changes in BAPGM may have improved the sensitivity of this medium (25). We isolated no B. clarridgeiae which underlines its difficulty of isolation (26). The prevalence of bacteremia in healthy cats obtained in the present study was 3.8% and 1.6%, based on the PCR and culture methods, respectively, for a combined prevalence of 4.3%. It appears that Bartonella bacteremia is uncommon in healthy pet cats in Ontario, which may reflect the type of cats sampled as well as the geographic location. Since these were animals in which blood profiles were being analyzed for evidence of “wellness,” it is likely that these cats were well cared for and would be unlikely to have fleas. It was, however, impossible to obtain such details. In the United States, Guptill et al (26) found 6%, 12%, 28%, and 33% prevalence rates for Bartonella bacteremia in pet cats in Chicago, Washington DC, California, and Florida, respectively. Since Ontario is most similar climatically to Chicago, our findings are consistent with those of Guptill et al (26). As in the present study, Guptill et al (26) observed no association between Bartonella bacteremia and season of sampling. The prevalence of Bartonella bacteremia is significantly higher in regions with higher average temperatures and humidity, favoring flea infestation, than in regions with temperate climatic conditions (26). Flea infestation, age , 13 mo, and adoption from a shelter or as a stray cat all appear to be significant risk factors for Bartonella bacteremia (27,28). In the current study, although the prevalence of Bartonella bacteremia was higher in the age group of # 2 years old, the difference was not significant. Lappin et al (23) conducted a PCR-based study of Bartonella species in 92 flea-infested cats in Alabama, Maryland, and Texas, and found B. henselae in 32 (34.7%), B. clarridgeiae in 9 (20.6%), and both species in 7 (7.6%) cats, suggesting an association between fleas and bacteremia. Many studies have determined the prevalence of Bartonella bacteremia in different countries. In the Netherlands, 22% of 113 cats were positive by blood culture (27). In France, 16.5% of domestic cats in Paris were found to be bacteremic (28). In the United Kingdom, 34 (9.4%) out of 360 cats sampled were bacteremic (29). It is difficult to make direct comparisons with other studies since variables such as climate, flea infestation, age, and source all appear to influence the prevalence of bartonellosis. The prevalence of Bartonella bacteremia in stray cats in Ontario was remarkably high compared with pet cats. This finding is generally supported by the results of other studies (26) that suggest that being a stray cat is a risk factor for bartonellosis (27,28,30). Although a higher prevalence of Bartonella bacteremia has been reported from tropical countries (31,32), the high prevalence of Bartonella infection in the current study is striking, considering the differences in climatic conditions in Ontario compared to tropical countries or the southern United States. The prevalence of Bartonella infection in stray cats probably reflects higher exposure to cat fleas, which are considered the major route of Bartonella transmission between cats (26,28), and

2000;64:0–00

is supported by the very high prevalence of Bartonella spp. in cat fleas in Ontario (Table II). Numerous studies have determined the prevalence of hemoplasma infection in healthy and diseased cats in different countries. In a PCR-based study, Jensen et al (17) found an overall prevalence of 19.5% hemoplasma in a population of healthy and anemic cats in the United States. Although similar numbers of anemic and nonanemic cats were infected with M. haemominutum, significantly higher numbers of anemic cats were infected with M. haemofelis. In a PCRbased study of healthy and diseased cats from Saskatchewan and Alberta (33), most cats with regenerative anemia were infected with M. haemofelis rather than M. haemominutum. In the United Kingdom, Tasker et al (34) found the overall prevalence of hemoplasma infection in healthy and sick cats to be 18.5% but, in contrast with the results of Jensen et al (17), most sick-anemic cats were infected with M. haemominutum rather than M. haemofelis. In a study of 92 healthy cats in the United States (23), 7.6% and 21.7% were infected with M. haemofelis and M. haemominutum, respectively. The prevalence of hemoplasma infection in healthy cats in the current study was low, consistent with our earlier speculation that these cats would be unlikely to be exposed to risk factors for hemoplasma infection, and M. haemoninutum was more common in healthy cats than M. haemofelis, a finding consistent with that of most previous studies. By contrast, the prevalence of hemoplasma infection in the stray cats was considerably higher. This may reflect the likelihood that being a stray implies a greater probability of flea-infestation and of fighting, but no details were available to support this speculation. Besides the high prevalence, a second striking feature in stray cats was the relatively high prevalence of M. haemofelis compared to M. haemominutum. One explanation might be the ability of M. haemofelis to produce prolonged bacteremia than M. haemominutum and Candidatus M. turicensis (35). Candidatus Mycoplasma turicensis was recently discovered in a Swiss cat with severe hemolytic anemia (9). In the current study, one presumptively M. haemofelis PCR-positive samples was found to be Candidatus M. turicensis, the first time this has been reported in North America. In a study of 713 healthy and ill cats of Switzerland, Willi et al (35) later reported a 1.1% infection rate for Candidatus M. turicensis, all from ill cats. An infection rate for Candidatus M. turicensis of 2.3%, 10% and 26% was observed in a sample of healthy and ill cats in the United Kingdom, Australia, and ill cats of South Africa (36). The current study suggests that the infection is uncommon in cats in Ontario. Rickettsia felis was identified here in cat fleas for the first time in Canada. Others have found somewhat similar or higher infection rates elsewhere (10,37,38). The PCR based on the rOmpB gene was twice as sensitive as that based on the gltA gene. Despite the high prevalence of Bartonella and hemoplasma infection, no stray cat blood was PCR positive for R. felis. Natural infection of cats with this organism has not been reported. Besides opossums, which are the reservoir of this organism in North America, it is believed that fleas are the main reservoir for R. felis, since vertical transmission of this organism has been reported (14). Experimental infection studies suggest that cats may naturally be infected by R. felis, but that the period of bacteremia is short (13). The current study supports the conclusion that R. felis bacteremia in cats is rare. In people, although

2000;64:0–00

this organism usually causes subclinical or mild “flu-like” symptoms, serious or even fatal infections especially in elderly and young people have been reported (11,12). The presence of this organism in cat fleas in Ontario underlines the need for flea control in domestic cats and for physicians to consider this infection in people presented with febrile illness and flea bites. Bartonella DNA was amplified from 49 of the 50 flea pools, including 43 infected with B. henselae, 4 with B. clarridgeiae, and 2 that were dually infected. This is higher than observed elsewhere (23,37,39). The relatively high prevalence of infection of cat fleas in the current study might relate to differences in sensitivity of the PCR assays used in these studies. The infection rates for hemoplasma in pooled fleas (33 of 50, 10% and 56% for M. haemofelis and M. haemominutum) are higher than the rates obtained in similar studies by Shaw et al (37) (49%, all M. haemominutum) and Lappin et al (23) (M. haemofelis 3.3%, and M. haemominutum 23.9%), but the higher prevalence of M. haemominutum is similar. Since fleas are hematophagous, the detection of pathogen DNA in fleas may reflect the existence of these infections in their hosts as well, but the prevalence of infection in the source cats was not determined. However the conclusion is that cats infested with C. felis must be exposed to a combination of flea-associated bacterial organisms, and that these may be present at high prevalence in fleas.

Acknowledgments The authors thank the Ontario Veterinary College’s Pet Trust for financial support. We are also grateful to Drs. A. Abrams-Ogg, H. Cai, and C. Ribble for discussions during the course of this work, and to Drs. K.R. Macaluso and B. Willi for provision of control DNA from R. felis and M. turicensis. Dr. H. Cai kindly provided control DNA from M. haemofelis and M. haemominutum. Dr. D. Bienzle provided blood from the stray cats. The authors also thank the Humane Societies of Cambridge, Kitchener, and Guelph for assistance with obtaining cat fleas.

References 1. Breitschwerdt EB, Kordick DL. Bartonella infection in animals: Carriership, reservoir potential, pathogenicity, and zoonotic potential for human infection. Clin Microbiol Rev 2000;13: 428–438. 2. Koehler JE, Glaser CA, Tappero JW. Rochalimaea henselae infection. A new zoonosis with the domestic cat as reservoir. J Am Med Assoc 1994;27:531–535. 3. Kordick DL, Hilyard CEJ, Hadfield TL, et al. Bartonella clarridgeiae, a newly recognized zoonotic pathogen causing inoculation papules, fever, and lymphadenopathy (cat scratch fever). J Clin Microbiol 1997;35:1813–1818. 4. Avidor B, Graidy M, Efrat G, et al. Bartonella koehlerae, a new cat-associated agent of culture-negative human endocarditis. J Clin Microbiol 2004;42:3462–3468. 5. Anderson BE, Neuman MA. Bartonella spp. as emerging human pathogens. Clin Microbiol Rev 1997;10:203–219. 6. Arvand M, Wendt C, Regnath T, Ullrich R, Hahn H. Characteriza tion of Bartonella henselae isolated from bacillary angiomatosis


417

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

lesions in a human immunodeficiency virus-infected patient in Germany. Clin Infect Dis 1998;26:1296–1299. Boulouis HJ, Chang CC, Henn H, Kasten RW, Chomel BB. Factors associated with the rapid emergence of zoonotic Bartonella infections. Vet Res 2005;36:383–410. Sykes JE. Feline hemotropic mycoplasmosis (feline hemobartonellosis). Veterinary Clinics of North America, Small Animal Practice 2003;33:773–789. Willi B, Boretti FS, Cattori V, et al. Identification, molecular characterization, and experimental transmission of a new hemoplasma isolate from a cat with hemolytic anemia in Switzerland. J Clin Microbiol. 2005;43:2581–2585. Marquez FJ, Muniain MA, Rodriguez-Liebana JJ, Del Toro MD, Bernabeu-Wittel M, Pachon AJ. Incidence and distribution pattern of Rickettsia felis in peridomestic fleas from Andalusia, southeast Spain. Ann N Y Acad Sci 2006;1078:344–346. Oliveira RP, Galvão MAM, Mafra CL, et al. Rickettsia felis in Ctenocephalides spp. fleas, Brazil. Emerg Infect Dis 2002;8: 317–319. Richter J, Fournier PE, Petridou J, Häussinger D, Raoult D. Rickettsia felis infection acquired in Europe and documented by polymerase chain reaction. Emerg Infect Dis. 2002;8:207–208. Wedincamp J, Jr, Foil LD. Infection and seroconversion of cats exposed to cat fleas (Ctenocephalides felis bouché) infected with Rickettsia felis. J Vector Ecol 2000;25:123–126. Boostrom A, Beier MS, Macaluso JA, et al. Geographic association of Rickettsia felis-infected opossums with human murine typhus, Texas. Emerg Infect Dis 2002;8:549–554. Jensen WA, Fall MZ, Rooney J, Kordick DL, Breitschwerdt EB. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J Clin Microbiol 2000;38: 1717–1722. Maggi RG, Breitschwerdt EB. Potential limitations of the 16S-23S rRNA intergenic region for molecular detection of Bartonella species. J Clin Microbiol 2005;43:1171–1176. Jensen WA, Lappin MR, Kamkar S, Reagan WJ. Use of a polymerase chain reaction assay to detect and differentiate two strains of Haemobartonella felis in naturally infected cats. Am J Vet Res 2001;62:604–608. Maggi RG, Duncan AW, Breitschwerdt EB. Novel chemically modified liquid medium that will support the growth of seven Bartonella species. J Clin Microbiol 2005;43:2651–2655. Rolain JM, Franc M, Davoust B, Raoult D. Molecular detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia felis, and Wolbachia pipientis in cat fleas, France. Emerg Infect Dis 2003;9:338–342. Pons I, Sanfeliu I, Quesada M, et al. Prevalence of Bartonella henselae in cats in Catalonia, Spain. Am J Trop Med Hyg 2005;72: 453–457. Hackett TB, Jensen WA, Lehman TL, et al. Prevalence of DNA of Mycoplasma haemofelis, ‘Candidatus Mycoplasma haemominutum’, Anaplasma phagocytophilum, and species of Bartonella, Neorickettsia, and Ehrlichia in cats used as blood donors in the United States. J Am Vet Med Assoc 2006;229:700–705. Ishak AM, Radecki S, Lappin MR. Prevalence of Mycoplasma haemofelis, ‘Candidatus Mycoplasma haemominutum,’ Bartonella

418


23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

species, Ehrlichia species, and Anaplasma phagocytophilum DNA in the blood of cats with anemia. J Feline Med Surg 2007; 9:1–9. Lappin MR, Griffin B, Brunt J, et al. Prevalence of Bartonella species, haemoplasma species, Ehrlichia species, Anaplasma phagocytophilum, and Neorickettsia risticii DNA in the blood of cats and their fleas in the United States. J Feline Med Surg 2006; 8:85–90. Dillon B, Iredell J, Breitschwerdt EB, Maggi RG. Potential limitations of the 16S-23S rRNA intergenic region for molecular detection of Bartonella species. J Clin Microbiol 2005;43:4921–4922. Duncan AW, Maggi RG, Breitschwerdt EB. A combined approach for the enhanced detection and isolation of Bartonella species in dog blood samples: Pre-enrichment liquid culture followed by PCR and subculture onto agar plates. J Microbiol Methods 2007;69:273–281. Guptill L, Wu CC, HogenEsch H, et al. Prevalence, risk factors, and genetic diversity of Bartonella henselae infections in pet cats in four regions of the United States. J Clin Microbiol 2004;42:652–659. Bergmans AM, de Jong CM, van Amerongen G, Schot CS, Schouls LM. Prevalence of Bartonella species in domestic cats in The Netherlands. J Clin Microbiol 1997;35:2256–2261. Gurfield AN, Boulouis HJ, Chomel BB, et al. Epidemiology of Bartonella infection in domestic cats in France. Vet Microbiol 2001;80:185–198. Birtles RJ, Laycock G, Kenny MJ, Shaw SE, Day MJ. Prevalence of Bartonella species causing bacteraemia in domesticated and companion animals in the United Kingdom. Vet Rec 2002; 151:225–229. Fabbi M, De Giuli L, Tranquillo M, Bragoni R, Casiraghi M, Genchi C. Prevalence of Bartonella henselae in Italian stray cats: Evaluation of serology to assess the risk of transmission of Bartonella to humans. J Clin Microbiol 2004;42:264–268. Chomel BB, Carlos ET, Kasten RW, et al. Bartonella henselae and Bartonella clarridgeiae infection in domestic cats from the Philippines. Am J Trop Med Hyg 1999;60:593–597. Marston EL, Finkel B, Regnery RL, et al. Prevalence of Bartonella henselae and Bartonella clarridgeiae in an urban Indonesian cat population. Clin Diagn Lab Immunol 1999;6:41–44. Kewish KE, Appeleyard GD, Myers L, Kidney BA, Jackson ML. Mycoplasma haemofelis and Mycoplasma haemominutum detection by polymerase chain reaction in cats from Saskatchewan and Alberta. Can Vet J 2004;45:749–752. Tasker S, Binns SH, Day MJ, et al. Use of a PCR assay to assess the prevalence and risk factors for Mycoplasma haemofelis and ‘Candidatus Mycoplasma haemominutum’ in cats in the United Kingdom. Vet Rec 2003;152:193–198. Willi B, Boretti FS, Baumgartner C, et al. Prevalence, risk factor analysis, and follow-up of infections caused by three feline hemoplasma species in cats in Switzerland. J Clin Microbiol 2006; 44:961–969. Willi B, Tasker S, Boretti FS, et al. Phylogenetic analysis of “Candidatus Mycoplasma turicensis” isolates from pet cats in the United Kingdom, Australia, and South Africa, with analysis of risk factors for infection. J Clin Microbiol 2006;44:4430–4435.

2000;64:0–00

37. Shaw SE, Kenny MJ, Tasker S, Birtles RJ. Pathogen carriage by the cat flea Ctenocephalides felis (Bouche) in the United Kingdom. Vet Microbiol 2004;102:183–188. 38. Schloderer D, Owen H, Clark P, Stenos J, Fenwick SG. Rickettsia felis in fleas, Western Australia. Emerg Infect Dis 2006;12:841–843.

2000;64:0–00

39. Kelly PJ, Meads N, Theobald A, Fournier PE, Raoult D. Rickettsia felis, Bartonella henselae, and B. clarridgeiae, New Zealand. Emerg Infect Dis 2004;10:967–968.


419