1027
INVESTIGATION OF AN OUTBREAK OF VANCOMYCIN AND LINEZOLID- RESISTANT ENTEROCOCCUS FAECIUM (VLRE) IN A UNIVERSITY HOSPITAL
* University General Hospital “ATTIKON” Rimini 1, 124 62 Chaidari, Greece Tel : ++321055831984 Fax : ++32105326446 E mail:
[email protected]
M.Souli, V.Sakka, S.Tsiodras, I.Galani, L.Galani, N.Siafakas, E.Koratzanis, I.Dervenoulas, H. Giamarellou* “Attikon” University General Hospital, Athens, Greece ABSTRACT
Table 1: Oligonucleotide primers used in multiplex PCR (Depardieu et al, 2004, J Clin
Table 3: Variables assessed in univariate analysis as possible risk factors
Microb, 42:5857-60) Background During a prospective point-prevalence survey of fecal carriage and environmental colonization from vancomycin-resistant enterococci in a tertiary-care university hospital in April 2005, we identified 6 VLRE strains. An investigation of molecular epidemiology of the outbreak and a risk factor analysis were undertaken. Methods Identification was performed by standard methodology and susceptibilities were evaluated by E-test. Vancomycin resistance genes were detected by multiplex PCR, molecular typing was performed with PFGE using SmaI and PCR-RFLP analysis of the 643bp amplicon of the domain V region, with NheI to detect the G2576T mutation. A case-control design using three VRE(-) controls, randomly selected for each positive VLRE case and univariate and multivariate analysis was performed. Results 5 clinical and 1 environmental isolate from a light switch (all in the hematological ward) were identified as VLRE vanA-positive E.faecium exhibiting a linezolid MIC of 12μg/ml. The environmental and 4 of the clinical isolates were genetically identical. PCR-RFLP analysis revealed the existence of at least one mutated copy of 23S rRNA gene in all VLRE. None of the colonized patients were previously exposed to linezolid. Compared to the VRE (-) controls VLRE subjects appeared more likely to have hematological malignancy, immunodeficiency or to have received an aminoglycoside or a carbapenem (all p 0.05). In multivariate analysis, only immunodeficiency approached statistical significance (p = 0.13) Conclusions We described the first outbreak of VLRE in Greece in immunodeficient subjects of one hematological ward. Acquisition was probably due to nosocomial transmission and inanimate environment played an important role. Nosocomial transmission of LVRE is an ominous sign and underscores the importance of meticulous infection-control measures.
Gene or gene region
Oligonucleotide sequence (5'3')
Product size (bp)
vanA
GGGAAAACGACAATTGC
732
VARIABLES Age (mean + SD) Gender (female) Hospital last 6 months
vanB
ACGGAATGGGAAGCCGA
647
TGCACCCGATTTCGTTC vanC1/2
ATGGATTGGTAYTKGTAT *
815/827
TAGCGGGAGTGMCYMGTAA* vanD
TGTGGGATGCGATATTCAA
500
vanE
TGTGGTATCGGAGCTGCAG
430
A risk factor analysis was undertaken. Upon confirmation of VRE isolation from screening or clinical specimens, strict infection control measures (cohorting, if possible, gowns, gloves, re-enforcement of hand hygiene measures) were established resulting in the containment of the outbreak.
METHODS •Identification was performed by standard methodology and by PhoenixTM Automated Microbiology System (BD Diagnostic Systems). •Susceptibilities were determined by BD PhoenixTM ID/AST and by E-test (AB Biodisk) according to manufacturer’s instructions. •Vancomycin resistance genotype was identified with a multiplex PCR using primers shown in Table1 and crude cell extract as target DNA. E.faecalis ATCC 51299 (vanB) and E.faecalis (vanA) were included as control strains. •Clonal relationship between linezolid-resistant isolates and between those and linezolid-susceptible isolates collected during the VRE-outbreak was assessed with PFGE of SmaI-digested fragments of genomic DNA using standard methods.
vanG
CGGCATCCGCTGTTTTTGA
Comorbidities, n(%) Any Malignancy Hematological malignancy Immunodeficiency Diabetes Chronic renal failure/HD
3 (60) 3 (60) 4 (80) 3 (60) 0 (0)
5 (33.3) 1 (6.7) 3 (20) 3 (20) 2(13.3)
0.3 0.03 0.03 0.13 1
3 (0.4-24.2) 21 (1.4-314) 16 (1.3-200.9) 6 (0.7-53.7)
Use of invasive devices
2 (40)
3 (20)
0.6
2.7 (0.3-23.9)
Antimicrobial (Abx) use Recent use of Abx Current use of Abx Days of Abx before VLRE Piperacillin/tazobactam Cephalosporins (2nd gen) Cephalosporins (3rd gen) Carbapenems Quinolones Aminoglycosides All antianaerobic agents
3 (60) 3 (60) 8.6 8.8 2 (40) 0 (0) 0 (0) 2 (40) 2 (40) 2 (40) 2 (40)
6 (40) 5 (33.3) 1.7 3.1 2 (13.3) 2 (13.3) 0 (0) 0 (0) 1 (6.7) 0 (0) 2 (13.3)
0.6 0.3 0.17 0.2 1
2.3 (0.3-17.8) 3 (0.4-24.2)
In-hospital mortality,n(%)
1 (20)
2 (13.3)
0.7
3.5 (0.3-39.2)
941
GAACGATAGACCAATGCCTT ddl (E. faecalis)
CACCTGAAGAAACAGGC
475
ATGGCTACTTCAATTTCACG ddl (E. faecium)
GAGTAAATCACTGAACGA
1,091
A total of 6 isolates identified as E.faecium were confirmed to be linezolid-resistant. They derived from rectal swabs (5) performed for VRE fecal carriage screening and from an environmental culture (1) from a light switch. All 5 strains were isolated during the first month of the outbreak. Upon implementation of strict infection control measures, no linezolid-resistant isolates were identified. According to the hospital’s database, patients 2 and 3 were simultaneously hospitalized and shared the same room (A). Then they both moved to another room (B) of the same ward. Patient 1 shared the room (B) with patient 3. Patients 4 and 5 shared the same room (A) after patients 1, 2 and 3 were discharged. The light switch that was colonized with a linezolid-resistant isolate was located in room (B). All of the above patients suffered from haematologic malignancies, all had a history of multiple hospitalizations but none had been treated with linezolid during the most recent hospitalization. All 5 isolates had the same susceptibility profile: MICs are shown in Table 2. Multiplex PCR detected vanA resistant determinant in all 5 isolates, as was shown for all the VRE isolates collected during the outbreak. According to PFGE analysis, 5 of the 6 isolates were identical (patients 1, 4, 5 and the environmental strain) or closely related (patient 3) between them but unrelated to the 2 major clones of the outbreak. One isolate (patient 2) was closely related to one of the major clones of the VRE epidemic (Figure 1). RFLP revealed that all 5 isolates had at least one mutated copy of 23S rRNA gene (Figure2). Compared to the VRE (-) controls VLRE subjects were more likely to have hematological malignancy, immunodeficiency or to have received an aminoglycoside or a carbapenem (all p ≤ 0.05) (Table 3). In multivariate logistic regression analysis adjusting for age, comorbidities and antibiotic use, only immunodeficiency approached statistical significance (p = 0.13).
Figure 1: Pulsed-field gel electrophoresis
Figure 2: PCR-RFLP analysis of rDNA
patterns of VRE isolates after digestion of genomic DNA with SmaI 1
2
3 4 5 6
amplicons withNheI.
7 8 9 10 11
•Macrorestriction fragments were visually compared for similarities and clonal groups were determined according to criteria introduced by Tenover et al. (J Clin Microbiol 1995; 33:2233-9).
1
2
3
4
5
0.05 0.1 0.05 0.2
4.3 (0.4-44.4)
9.3 (0.6-139.6) 4.3 (0.4-44.4) 1.6 (0.12-22.9)
Table 2: Susceptibility profiles of VLRE isolates Antibiotic Ampicillin Penicillin Pip/Tazo Ciproflaxacin Gentamicin Imipenem Levofloxacin Linezolid Minocycline
MIC >8 >8 >16 >2 4-8 >16 >32 12 0.25
Quin/Dalfo Teicoplanin Vancomycin Tigecycline
0.5-0.75 32-64 >256 0.03-0.06
6
634bp 591bp
CONCLUSIONS
•To elucidate the mechanism of linezolid resistance, we amplified domain V of the 23S RNA gene using the following primers: 5-TGGGCACTGTCTCAACGA-3 (corresponding to Escherichia coli 23S RNA bases 1984–2001) and 5-GGATAGGGACCGAACTGTCTC-3 (E coli 23S RNA bases 2597–2617).
This is the first report of an outbreak due to linezolid-resistant Efaecium in a tertiary care hospital. Lanes 1: linezolid sensitive isolate (clone A), Lanes 2-6: linezolid resistant isolates (clone L)
•PCR-RFLP analysis of the 634 bp amplicons of V domain, with NheI was performed to detect the G2576T mutation, which is mainly associated with the expression of linezolid resistance in clinical isolates. •A case-control study was performed to evaluate risk factors for VLRE. Three VRE (-) controls identified through the hospital-wide surveillance survey were randomly selected for each positive VLRE case. •Univariate and multivariate analysis was performed to evaluate risk factors for isolating VLRE. SPSS version 10.0 for Windows software (SPSS, Inc., Chicago, IL) was used for data analysis.
OR, 95 % CI
ATAGTTTAGCTGGTAAC
RESULTS
During a VRE outbreak that was detected from April to end of May 2005 in University General Hospital “Attikon”, Athens, Greece, we identified 6 isolates that were linezolid-resistant according to Kirby-Bauer disk diffusion method. These isolates were studied for genetic relatedness and for the presence of mutations in 23S rRNA V domain region that could be responsible for linezolid resistance.
p 0.2 0.5 0.6
TGCAGCCAAGTATCCGGTAA
INTRODUCTION
There are several reports of linezolid-resistant enterococci in the literature but cases of documented nosocomial transmission remain rare so far.
VRE (-), n=15 65.4 3.1 11 (73.3) 8(53.3)
GTACAATGCGGCCGTTA
CGCTGATGGTATCGATTCAT
Linezolid is an important therapeutic option for multiresistant Gram (+) pathogens. Linezolid disrupts protein synthesis by binding to the domain V region of 23S rRNA. Mutations in that region have been associated with linezolid resistance. The rRNA operon is present in multiple copies in nearly all bacteria and the level of linezolid MIC correlates with the number of mutated copies.
VLRE (+), n=5 69.4 20.7 5 (100) 4(80)
Lane 6: VLRE from a light switch of a patient ward room B
The study is limited by the small number of cases and to the particular setting of the study (a large tertiary care center).
Lanes 7,8: Linezolid sensitive isolates of the VRE fecal carriage screening (clone A)
Strict infection control measures resulted in the containment of the outbreak.
Lanes 1-5: VLRE from patients 1-5. Patient 2 has the clone A clone
LA L L L L AA B B B
In the case-control study, VLRE appeared more often in patients that were heavily immunocompromised and had received extended spectrum antibiotics such as carbapenems.
Lanes 9-11: Linezolid sensitive isolates of the VRE fecal carriage screening (clone B)
Linezolid should be used with caution and adherence to infection control measures is warranted in order to avoid in-hospital spread of resistant pathogens.
