Ion Channels in Mesenchymal Stem Cells from ... - Wiley Online Library

TISSUE-SPECIFIC STEM CELLS Ion Channels in Mesenchymal Stem Cells from Rat Bone Marrow GUI-RONG LI,a,b,c XIU-LING DENG,a HAIYING SUN,a STEPHEN S.M. CHUNG,b,c HUNG-FAT TSE,a,b CHU-PAK LAUa,b a

Department of Medicine, bResearch Centre of Heart, Brain, Hormone and Health Aging, cDepartment of Physiology, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Pokfulam, Hong Kong SAR, China Key Words. Transient outward K⫹ current • Tetrodotoxin-sensitive Na⫹ current • Ca2⫹-activated K⫹ current Voltage-gated K⫹ current • Rat mesenchymal stem cells

ABSTRACT Mesenchymal stem cells (MSCs) from bone marrow are believed to be an ideal cell source for cardiomyoplasty; however, cellular electrophysiology is not understood. The present study was designed to investigate ion channels in undifferentiated rat MSCs. It was found that three types of outward currents were present in rat MSCs, including a small portion of Ca2ⴙ-activated Kⴙ channel (IKCa) sensitive to inhibition by iberiotoxin and/or clotromazole, a delayed rectifier Kⴙ current (IKDR), and a transient outward Kⴙ current (Ito). In addition, tetrodotoxin (TTX)-sensitive sodium current (INa.TTX) and nifedipine-sensitive L-type Ca2ⴙ

current (ICa.L) were found in a small population of rat MSCs. Moreover, reverse transcription-polymerase chain reaction revealed the molecular evidence of mRNA for the functional ionic currents, including Slo and KCNN4 for IKCa; Kv1.4 for Ito; Kv1.2 and Kv2.1 for IKDR; SCN2a1 for INa.TTX; and CCHL2a for ICa.L. These results demonstrate for the first time that multiple functional ion channel currents (i.e., IKCa, Ito, IKDR, INa.TTX, and ICa.L) are present in rat MSCs from bone marrow; however, physiological roles of these ion channels remain to be studied. STEM CELLS 2006;24:1519 –1528

INTRODUCTION

in MSCs. The present study was therefore designed to investigate properties of ionic channel currents in undifferentiated rat MSCs from bone marrow.

Ion channels are extensively expressed in different types of cells and play important roles in maintaining physiological homeostasis. In proliferative cells, ion channels participate in cell proliferation [1, 2]. It has been demonstrated that ion channels modulate the progression through the cell cycle [1] and that K⫹ channel expression changes with cell cycle progression [3]. The highly proliferative mesenchymal stem cells (MSCs) from bone marrow have been studied recently in different species. MSCs cultured and expanded in vitro with bone marrow from different species (e.g., mice, rats, and humans) showed multilineage potential [4 –7] to incorporate into a variety of tissues, including bone, cartilage, muscle, lung, and spleen, after systemic injection [5, 6, 8], and they were also found to form other kinds of cells in vitro, for example, hepatocytes, cardiomyocytes, and neuronal cells [4, 5, 9]. In particular, MSCs have been used for cardiomyoplasty, and experimental studies have demonstrated that transplantation of MSCs to infarcted myocardium significantly improves heart function [10 –12]. Therefore, it is believed that MSCs are an ideal cell source for myocardial regeneration [13, 14]. However, cellular electrophysiology is not understood

MATERIALS

AND

METHODS

MSC Culture Rat MSCs were isolated with a modified procedure as described previously [5, 15]. Briefly, Sprague-Dawley rats (150 –210 g) were sacrificed by neck dislocation according to the guideline of Animal Care and Use Committee for Teaching and Research of University of Hong Kong. Bone marrow was collected from the femurae and tibiae of the animal with a 18-gauge needle under sterile conditions, suspended in a 15-ml test tube containing Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Hong Kong SAR, China, http://www.invitrogen.com), and centrifuged at 2,000 rpm for 5 minutes. The marrow pellet was washed in Hanks’ balanced salt solution, centrifuged at 1,000 rpm for 10 minutes, and then resuspended in DMEM. Nucleated cells were isolated with a density gradient Percoll by centrifuging at 14,000 rpm for 12 minutes at 8°C and collecting top 60%

Correspondence: Gui-Rong Li, Ph.D., L8-01, Laboratory Block, Faculty of Medicine Building, The University of Hong Kong, 21 Sassoon Road, Pokfulam, Hong Kong SAR, China. Telephone: 852-2819-2830; Fax: 852-2855-9730; e-mail: [email protected] Received on July 9, 2005; accepted for publication on February 8, 2006; first published online in STEM CELLS EXPRESS February 16, 2006. ©AlphaMed Press 1066-5099/2006/$20.00/0 doi: 10.1634/stemcells.2005-0307

STEM CELLS 2006;24:1519 –1528 www.StemCells.com

Ionic Currents in Rat MSCs

1520

of the gradient, and they were washed with the complete culture medium containing 10% fetal bovine serum (FBS; Invitrogen), penicillin (100 U/ml), streptomycin (100 ␮g/ml), and amphotericin B (0.25 ␮g/ml). The cells were then seeded to a 25-cm2 tissue culture flask and incubated with the medium as described above with 10 ng/ml leukemia inhibition factor (Invitrogen) at 37°C in a humidified atmosphere of 5% CO2 and 95% air. Nonadherent cells were removed by changing the medium after 24 hours. The culture medium was changed twice a week thereafter. For subculture, cells were detached with 0.25% trypsin and 1 mM ethylene glycol-bis(2-aminoethylether)N,N,N⬘,N⬘-tetraacetic acid (EGTA) and passaged at ratio of 1:3 plates when cells grew to 80%–90% confluence. For recording ion channel currents, the detached cells were suspended in the culture medium, transferred to a cell chamber for 15–20 minutes, allowed to attach to the bottom of the cell chamber, and subsequently superfused with normal Tyrode’s solution (⬃1.5 ml/minute).

Osteogenic Differentiation and Alkaline Phosphatase Staining Osteogenic differentiation was performed with the cells from the first passage. Briefly, rat MSCs were cultured in six-well plates (for cytochemistry stain) at a density of 4 ⫻ 104 cells per well or 96-well plates (for alkaline phosphatase assay) at a density of 104 cells per well for 24 hours. The cells were then exposed to the medium containing osteogenic supplements: 10 nM dexamethasone, 0.05 mM L-ascorbic acid 2-phosphate, and 10 mM sodium ␤-glycerophosphate, whereas leukemia inhibition factor was omitted. The cells for the negative control were cultured with normal medium. Cytochemistry stain of alkaline phosphatase was performed in rat MSCs grown in six-well plates for 12 days. The cells were rinsed three times with phosphate-buffered saline (PBS) and then fixed in 4% paraformaldehyde for 20 minutes at room temperature. The fixed cells were rinsed with 3⫻ PBS and then with 1⫻ PBS. Alkaline-dye mixture was added to the dish and incubated at room temperature for 30 minutes. After cells were rinsed thoroughly in deionized water, the cells were treated with Mayer’s hematoxylin solution for 10 minutes, rinsed with deionized water, and then air-dried before the examination and/or image was taken under an inverted phase-contrast microscope (IX50; Olympus, Tokyo, http://www.olympus-global.com). Alkaline phosphatase activity was determined in rat MSCs cultured (for 12 days) with or without osteogenic supplements. The cells in 96-well plates were rinsed twice with 0.2 ml of PBS, and then 0.1 ml of alkaline phosphatase substrate solution (containing 5 mM p-nitrophenyl phosphate, 50 mM glycine, and 1 mM MgCl2, pH 10.5) was added to each well. After a 10-minute incubation, the reaction was terminated with an equal volume of 1 M NaOH. Alkaline phosphatase activity was measured by the reaction product p-nitrophenol using a microplate reader (STL RainBow; Tecan Systems Inc., San Jose, CA). The concentration of enzyme was determined against a standard curve made from p-nitrophenol.

Adipogenic Differentiation and Oil Red O Staining Adipogenic differentiation was conducted in rat MSCs (from passage 3) seeded into six-well plates at a density of 2 ⫻ 105 cells per well. The cells were cultured until confluence, and the

culture medium was changed to the adipogenic induction supplement medium (high glucose DMEM containing 10% FBS, 10 ␮g/ml insulin; Invitrogen), 0.5 mM isobutylmethylxanthine, 1 ␮M dexamethasone (Decadron; Merck & Co., Whitehouse Station, NY, http://www.merck.com), and 100 ␮M indomethacin (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) for 3 days and subsequently to the adipogenic maintenance medium (high-glucose DMEM containing 10% FBS, 10 ␮g/ml insulin) for 1 day. This procedure was repeated three times, and then the cells were incubated in the maintenance medium for 7 days. The treated rat MSCs were then fixed with 4% paraformaldehyde after rinsing with PBS, stained with oil red O solution (SigmaAldrich) for 20 minutes at room temperature, and washed again with PBS for a microscopic view of the lipid accumulation.

Solutions Tyrode’s solution contained 136 mM NaCl, 5.4 mM KCl, 1.0 mM MgCl2, 1.8 mM CaCl2, 0.33 mM NaH2PO4, 10 mM glucose, and 10 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES); pH adjusted to 7.4 with NaOH. The pipette solution contained 20 mM KCl, 110 mM K-aspartate, 1.0 mM MgCl2, 10 mM HEPES, 0.05 mM EGTA (or 5 mM where specified), 0.1 mM GTP, 5.0 mM Na2-phosphocreatine, 5.0 mM Mg2-ATP; pH adjusted to 7.2 with KOH. K⫹ in superfusion and pipette solutions was replaced by equimolar Cs⫹ when K⫹-free conditions were applied for recording sodium current (INa) or L-type Ca2⫹ current (ICa.L). The experiments were conducted at room temperature (21–22°C).

Electrophysiology The whole-cell patch-clamp technique was used. Borosilicate glass electrodes (1.2 mm o.d.) were pulled with a BrownFlaming puller (model P-97; Sutter Instrument Co., Novato, CA) and had tip resistances of 2–3 M⍀ when filled with pipette solution. The tip potentials were compensated for before the pipette touched the cell. After a gigaohm-seal was obtained by negative suction, the cell membrane was ruptured by gentle suction to establish the whole-cell configuration. Data were acquired with an EPC9 amplifier (Heka, Lambrecht, Germany). Membrane currents were low-pass filtered at 2 kHz and stored on the hard disk of an IBM-compatible computer.

Reverse Transcription-Polymerase Chain Reaction Total RNA of rat MSCs (from passages 2–3) was isolated using TRIzol method (Invitrogen) and further treated with DNase I (Invitrogen). Reverse transcription (RT) was performed with the RT system (Promega, Madison, WI, http://www.promega.com) protocol in a 20-␮l reaction mixture. RNA (1 ␮g) was used in the reaction, and a combination of oligo(dT) and random hexamer primers was used for the initiation of cDNA synthesis. After this RT procedure, the reaction mixture (cDNA) was used for polymerase chain reaction (PCR). The forward and reverse PCR oligonucleotide primers chosen to amplify the cDNA are listed in Table 1. PCR was performed by a Promega PCR system with Taq polymerase and accompanying buffers. The cDNA in 2-␮l aliquots was amplified by a DNA thermal cycler (Mycycler; Bio-Rad, Hercules, CA, http://www.bio-rad.com) in a 25-␮l reaction mixture containing 1.0⫻ thermophilic DNA polymerase reaction buffer, 1.25 mM MgCl2, 0.2 mM each deoxynucleotide triphosphate

Li, Deng, Sun et al.

1521

Table 1. Oligonucleotide sequences of primers used for RT-PCR Gene Kv1.1 Kv1.2a Kv1.3a Kv1.4a Kv1.5a Kv1.6 Kv2.1a Kv2.2 Kv3.1 Kv3.2 Kv4.2 Kv4.3 Kir1.1 Kir2.1a Kir2.2 CCHL2a CACNA1 REAG1 REAG2 rSCN1a rScn2a1 Slo KCNN4 KCNN3 GAPDH

Accession No.

Forward primer (5ⴕ-3ⴕ)

Reverse primer (5ⴕ-3ⴕ)

Position

NM_173095 NM_012970 NM_019270 NM_012971 NM_012972 RNO276137 NM_013186 NM_054000 NM_012856 NM_139216 NM_031730 NM_031739 NM_017023 NM_017296 NM_053981 M86621 AF086827 NM_031742 AF185637 NM_030875 NM_012647 AF135265 NM_023021 NM_019315 NM_017008

CTTCACGGGCACCATTCA GAGATGTTTCGGGAGGATGA ATTGTAGCCATCATCCCTTAT AGTCAGTTGCCCATACCT TCGCAGAGGCAGACAATC ACGAGGAGGAAGATGAAGAC GCTGCAGAGCCTAGACGAGT TCGTCCTTTCCACCATTGC CTGCTTCCTCTTATCAACCG TGCCTGTGCCCGTCATTG CATGGCCCTGGTGTTCTACT GCGTCCTGGTCATTGCTC CAGACAACGTCGAACAAG AGTCCATACCCGACAACA CCATTGAGACGCAGACCA CTCTGAGATGTTAGAAACCCTT CTGGTCGGTCTACCTCTTCTC ACAGCCTCTGCTTCGTG AGCTCCGACCACAGACGT AAACAGTGGTGGAACCTTCG GCCCAAATACGAAGACAA TGTGGGCTCCATCGAGTA CACGCTGAGATGTTGTGGTT CCAACGCTACCCACAACC GTGCTGAGTATGTCGTGGAG

TCCGCAAAGTACACTGCACTAG CTCTGTCCCCAGGGTGATAA AGCCTTCAGTGTCTGTCCC TCCTCGGGACCACCTTTA TCCAGACAGAGGGCATACA ATGATATTGCGAAAGAAAGC TGCTTTTGAACTTGGTGTCG TTCCCATGGCCAGAAACAG AAGGGCGAATCCTCTACG GCCTCGGCTTGCGTGTAA GCAAGAAGCCCAGTTCTGAC GTCTTGCCCATGTGCTCC AACCTGAATCCGTAACCT GGCAGAAGATTACCAGCA TGACGGCTAATGCCAAAC CTTCTCCTCCATCCGTGA TACGCCTGCTCACCAAAG GGTTGGCTGAGGTATGGT TCCAAGGACCCTGACACC TAACAGGGCATTCACAACCA AAATAATAATGGCGGAGG GCTTAGCGAGTTCCGTGA CGATGCTGCGGTAAGACG CGTGCCGTCCAGAAGAAC GTCTTCTGAGTGGCAGTGAT

838–1290 932–1381 847–1029 1832–2326 1328–1784 157–379 648–1099 14–496 2796–3133 1479–1905 1099–1535 1230–1461 108–592 108–268 473–920 979–1250 3583–3846 1975–2466 1539–2012 3855–4274 4530–4979 2824–3209 269–683 1010–1466 1115–1403

Length Cycle (bp) no. 453 450 183 495 457 223 452 429 338 427 437 232 485 161 448 272 264 492 474 420 450 386 415 457 301

30 30 32 30 32 30 30 30 32 30 30 32 32 32 30 30 30 30 32 32 30 30 30 30 30

a

PCR products are in single exon (other PCR products span exon-exon junctions). Abbreviations: CACNA1, T-type calcium channel ␣-1 subunit; CCHL2a, L-type calcium channel ␣-2 subunit; GAPDH, glyceraldehyde3-phosphate dehydrogenase; KCNN3, calcium-activated potassium channel SK3; KCNN4, intermediate conductance calcium-activated channel; Kir, inward rectifier potassium channel; Kv, voltage-gated potassium channel; PCR, polymerase chain reaction; rEAG, rat ether-a-go-go potassium channel; rSCN1a, rat Na(v)1.1; rScn2a1, rat Na(v)1.2; RT, reverse transcription; Slo, big-conductance calciumactivated potassium channel.

(dNTP), 0.6 ␮M each forward and reverse primer, and 1.0 U of Taq polymerase under the following conditions: the mixture was annealed at 50 – 60°C (1 minute), extended at 72°C (2 minutes), and denatured at 95°C (45 s) for 30 to 32 cycles. This was followed by a final extension at 72°C (10 minutes) to ensure complete product extension. The PCR products were electrophoresed through a 1% agarose gel, and the amplified cDNA bands were visualized by ethidium bromide staining. The bands imaged by Chemi-Genius Bio Imaging System (Syngene, Cambridge, U.K.) were analyzed via GeneTools software (Syngene). Nonlinear curve-fitting programs (Pulsefit or SigmaPlot; SPSS, Chicago, IL) were used to perform curve-fitting procedures. Results are presented as means ⫾ SEM. Paired and unpaired Student’s t tests were used as appropriate to evaluate the statistical significance of differences between two group means, and analysis of variance was used for multiple groups. Values of p ⬍ .05 were considered to indicate statistical significance.

RESULTS Osteogenesis and Adipogenisis of rat MSCs and Families of Ion Channel Currents Figure 1A shows MSC images from primary culture (for 8 days) of the first seeding of bone marrow cells, showing mostly spindle-like or triangle-shaped cells (left panel). The cells from the first passage reached confluence on day 10 (right panel). www.StemCells.com

After 12 days of culture with the medium containing osteogenic supplements, the cells formed significant alkaline phosphatasepositive aggregates (Fig. 1B, right panel), and no positive stain for alkaline phosphatase was observed in control cells cultured with normal medium (Fig. 1B, left panel). In addition, alkaline phosphatase activity was significantly increased (from 0.11 ⫾ 0.01 pM/minute for control to 0.73 ⫾ 0.01 nM/minute; n ⫽ 44; p ⬍ .01). Figure 1C shows the adipogenic differentiation of rat MSCs. The oil red O staining for the lipid accumulation was significant in rat MSCs treated with adipogenic supplements, whereas no lipid staining was observed in control rat MSCs. These results suggest that rat MSCs exhibit the potency to differentiate into bone cells or adipocytes in vitro. Figure 2 illustrates families of membrane currents in undifferentiated rat MSCs. The currents were recorded with the voltage protocol as shown in the inset (Fig. 2A). A gradually activating current like a delayed rectifier K⫹ current (IKDR) was recorded in a representative rat MSC upon the depolarizing voltage steps, and a significant noisy oscillation like Ca2⫹activated K⫹ current (IKCa) was observed at ⫹40 to ⫹60 mV, suggesting that two types of currents (IKDR and IKCa) are co-expressed in this cell. Figure 2B displays current traces recorded in a typical experiment, showing an inward current followed by IKDR with a significant tail current, whereas Figure 2C shows a transient outward current recorded in another cell, similar to transient outward K⫹ current (Ito) observed in cardiac


1522

Figure 1. Images of cultured mesenchymal stem cells from rat bone marrow. (A): Images showing cells from primary culture (for 8 days, left panel), and cells from passage 1 on day 10 (right panel). (B): Images showing significant phosphatase-positive aggregates in cells grown in osteogenic medium (right panel) but not in cells grown in control medium (left panel). (C): Oil red O staining images showing the lipid accumulation in cells treated with adipogenic medium (right panel) but not in control cells cultured with control medium (left panel).

and neuronal cells [16 –18]. Almost all rat MSCs investigated (168 of 184 cells, from different dishes of passages 2– 4) demonstrated IKDR currents activated by the voltage protocols; cells with significant noisy-like current were found in 33% (61 of 184 cells), and Ito was found in 10% (18 of 184 cells) of rat MSCs. Inward current was coexistent with outward currents (e.g., IKDR or Ito) in 16% of rat MSCs (30 of 184 cells). Mean value of membrane capacitance was 45 ⫾ 12 pF. In addition, rat MSCs were found to have membrane potentials between ⫺13 and ⫺55 mV in current clamp made.

Inward Currents Figure 3A illustrates current traces recorded in a representative cell with K⫹ pipette solution in Tyrode’s solution. A significant inward current was followed by gradually activating IKDR. Tetrodotoxin (TTX; 100 nM) abolished the inward current, and the effect recovered upon the drug washout for 5 minutes, suggesting that the inward current may be TTX-sensitive INa. Figure 3B displays the time course of INa recorded under K⫹-free conditions in a representative rat MSC with 30-ms voltage steps, as shown in the inset, in the absence and presence of 100 nM TTX. TTX reversibly suppressed INa. Original

Figure 2. Families of membrane currents recorded in rat mesenchymal stem cells (MSCs) (passage 2) with 300-ms voltage steps from ⫺80 to between ⫺60 and ⫹60 mV and then back to ⫺30 mV as shown in the inset (0.2 Hz). (A): Two components of outward currents are present in a rat MSC, one rapidly activating current, such as delayed rectifier K⫹ current (IKDR), at potentials from ⫺20 to ⫹30 mV, and another with noisy oscillation, such as Ca2⫹-activated K⫹ current, at potentials from ⫹40 to ⫹60 mV. (B): A significant inward current was followed by IKDR with significant tail current recorded from another rat MSC. (C): Transient outward K⫹ current was observed in a different rat MSC.

current traces at corresponding time points are shown at the right of the panel. TTX-sensitive INa (INa.TTX) was recorded in five of 26 cells. We found that a TTX-resistant inward current, sensitive to inhibition by the ICa.L blocker nifedipine (10 ␮M; Fig. 3C), was present in two of 26 cells (8%), suggesting that dihydropyridinesensitive ICa.L, as recently reported in human MSCs [19], is present in a small population of rat MSCs.

Ito in Rat MSCs Ito was detected in a small population (⬃10%) of rat MSCs. Figure 4A shows Ito traces recorded in a typical experiment. 4-Aminopyridine (4-AP) at 5 mM substantially suppressed Ito. Figure 4B displays the I-V relationships of Ito mean values in the absence and presence of 4-AP. Ito was significantly inhibited by


Figure 3. Inward currents in rat MSCs. (A): Current traces were recorded in a rat mesenchymal stem cell (MSC) (passage 1) with the voltage protocol as shown in the inset of Figure 2A during control, after the application of 100 nM TTX for 5 minutes, and after drug washout for 5 minutes. TTX reversibly abolished the inward transient without affecting outward current, suggesting that the inward current is a TTXsensitive Na⫹ current (INa.TTX). (B): Time course of INa.TTX recorded under K⫹-free conditions by 30-ms voltage step from ⫺100 to ⫺10 mV (inset) in a representative cell (passage 2) in the absence and presence of 100 nM TTX. Original current traces at corresponding time points are shown in the right inset. (C): Two components of inward currents were observed under K⫹-free conditions in a rat MSC (passage 2) with a 300-ms step from ⫺80 to ⫺10 mV, one rapidly inactivated current and another slowly inactivated component (control). TTX at 100 nM inhibited the fast component, and the remaining slow component was inhibited by 10 ␮M nifedipine, suggesting the copresence of INa.TTX and ICa.L. Abbreviations: Nif, nifedipine; TTX, tetrodotoxin.

5 mM 4-AP at test potentials from ⫺20 to ⫹60 mV (n ⫽ 8; p ⬍ .05 or p ⬍ .01). The inhibition recovered by 94% after washout of the drug for 10 minutes.

IKCa in Rat MSCs Three types of IKCa have been described in different types of cells and defined by the use of selective IKCa channel blockers [20 –23]. IKCa was studied in rat MSCs showing significant noisy oscillation current. Figure 5A shows current traces recorded in a representative cell with the voltage protocol shown in the inset. The noisy oscillation current was remarkably reduced, and the total membrane current was partially inhibited by www.StemCells.com

1523

Figure 4. Transient outward K⫹ current (Ito) in rat MSCs. (A): Ito current recorded in a representative cell (passage 3) with the protocol as shown in the inset in the absence and presence of 5 mM 4-AP. (B): I-V relationships of Ito density in the absence and presence of 5 mV 4-AP. Ito was substantially inhibited by 4-AP (p ⬍ .05 or p ⬍ .01 at ⫺20 to ⫹60 mV vs. control), and the effect was reversed by washout. Abbreviations: 4-AP, 4-aminopyridien; TP, test potential.

application of 100 nM iberiotoxin (Alomone, Jerusalem, Israel, http://www.alomone.com), a blocker of big conductance IKCa, and the remaining current was substantially inhibited by 5 mM 4-AP. Inhibition fraction of the membrane current was 14% by iberiotoxin and 74% by 4-AP (n ⫽ 9), suggesting that big conductance IKCa was co-existent with IKDR in rat MSCs. In some rat MSCs, iberiotoxin had no effect on the membrane current; however, clotrimazole (a relatively selective inhibitor of intermediate conductance IKCa channels [23]) showed an inhibitory effect. Figure 5B displays I-V relation curves recorded in another cell by a 2-second voltage ramp from ⫺120 to ⫹60 mV (holding potential, ⫺40 mV). Iberiotoxin at 100 nM had no effect on the inward and outward components of the membrane current elicited by the ramp protocol, whereas 1 ␮M clotrimazole partially decreased both inward and outward components of the currents. Co-application of clotrimazole with 5 mM 4-AP substantially suppressed the remaining current. Similar results were obtained in 11 of 20 cells, suggesting that intermediate conductance IKCa, not big conductance IKCa, is copresent with IKDR in these rat MSCs. In addition, we found that in a few of cells (n ⫽ 3) the membrane currents showed inhibitory response to both iberiotoxin and clotrimazole, and the remaining current was suppressed by 5 mM 4-AP. In another set of experiments, the small conductance IKCa inhibitor apamin (Alomone) was applied to test whether small conductance IKCa would be present in rat MSCs. Apamin at 100


1524

Figure 5. Ca2⫹-activated K⫹ channel (IKCa) in rat mesenchymal stem cells (MSCs). (A): Membrane currents were recorded in a rat MSC (passage 3) with the 300-ms voltage steps as shown in the inset in the absence (control) and presence of 100 nM IbTX (a blocker of bigconductance IKca channels), and with coapplication of iberiotoxin and 4-AP. (B): I-V relation curves recorded in a rat MSC (passage 3) by a ramp (⫺120 to ⫹60 mV) protocol during control, in the presence of 100 nM iberiotoxin or 1 ␮M CLT (a blocker of intermediate conductance IKCa), and in the presence of clotrimazole plus 4-AP. (C): I-V relation curves recorded in another cell (passage 3) by the ramp protocol as in (B) during control, after application of the ionophore ionomycin (1 ␮M), coapplication of ionomycin with iberiotoxin, ionomycin with 1 ␮M clotrimazole, or clotromazole with 4-AP. Abbreviations: 4-AP, 4-aminopyridine; CLT, clotrimazole; IbTX, iberiotoxin; iono, ionomycin.

nM had no effect on the membrane current in all cells tested (n ⫽ 6). These results suggest that big and/or intermediate conductance IKCa, but not small conductance IKCa, are heterogeneously co-expressed with IKDR in rat MSCs. IKCa was further studied in rat MSCs by the application of the ionophore ionomycin in bath solution to increase intracellular Ca2⫹. Figure 5C shows the membrane current recorded in a typical experiment with the ramp protocol as in Figure 5B. Ionomycin at 1 ␮M remarkably enhanced both inward and outward components of the membrane current with weak inward rectification and shifted the reversal potential to hyperpolarization. The current was not affected by iberiotoxin but was completely reversed by application of 1 ␮M clotrimazol, and the remaining current was inhibited by 5 mM 4-AP. Density of the membrane current at ⫹60 mV was 13.6 ⫾ 3.3 pA/pF (n ⫽ 6) during control, 27.2 ⫾ 5.8 pA/pF after application of 1 ␮M

Figure 6. Properties of delayed rectifier K⫹ current (IKDR) in rat mesenchymal stem cells (MSCs). (A): IKDR recorded in a rat MSC (passage 2) with the voltage protocol shown in the inset in the absence and presence of 5 mM TEA. (B): I-V relationships of IKDR tail current (IKDR.tail) and step current (IKDR.step). (C): Activation conductance (g/gmax) of IKDR was determined by normalizing IKDR.tail and fitted to Boltzmann distribution: g/gmax ⫽ 1/{1 ⫹ exp[(Vm ⫺ V0.5)/S]}, where Vm is membrane potential, V0.5 is the midpoint, and S is slope. V0.5 of IKDR activation was ⫹1.5 ⫾ 0.2 mV, whereas S was 9.1 ⫾ 0.3 (n ⫽ 18). (D): IKDR traces recorded from a rat MSC (passage 3) with 4-second depolarization steps from ⫺80 to between ⫺60 and ⫹60 mV showing significant inactivation. (E): Mean values of voltage-dependent time constant of IKDR inactivation. Abbreviations: TEA, tetraethylammonium; TP, test potential.

ionomycin (p ⬍ .01 vs. control), 26.6 ⫾ 4.8 pA/pF with ionomycin and 100 nM iberiotoxin (p ⫽ N.S. vs. ionomycin), 10.8 ⫾ 2.5 pA/pF with ionomycin and 1 ␮M clotrimazole (p ⬍ .01 vs. ionomycin), and 1.7 ⫾ 0.8 pA/pF with clotrimazole and 5 mM 4-aminopyridine (p ⬍ .01 vs. ionomycin plus clotrimazole). These results suggest that the current activated by ionomycin is most likely intermediate conductance IKCa. In addition, membrane potential (measured in current clamp) was increased from ⫺41.2 ⫾ 2.4 mV of control to ⫺65.6 ⫾ 1.7 mV (n ⫽ 6; p ⬍ .01 vs. control) with ionomycin and recovered to ⫺43.1 ⫾ 3.1 mV (p ⬍ .01 vs. ionomycin) by co-application of clotrimazole, suggesting that activation of intermediate conductance IKCa hyperpolarizes membrane potential significantly.

IKDR in Rat MSCs Figure 6A shows IKDR traces recorded with high EGTA (5 mM) pipette solution in a typical experiment with the voltage protocol shown in the inset in the absence and presence of 5 mM tetraethylammonium (TEA). IKDR was reversibly suppressed by TEA. Concentration-response relationship of TEA effect on

Li, Deng, Sun et al. IKDR was assessed in nine cells with 0.1, 0.3, 1, 3, and 10 mM TEA and fitted to the Hill equation: E ⫽ Emax/[1 ⫹ (IC50/C)b], where E is the inhibition of IKDR in percent at concentration C, Emax is the maximum inhibition, IC50 is the concentration for half-maximum action, and b is the Hill coefficient. The IC50 was 3.2 ⫾ 0.2 mM with a b of 1.2 ⫾ 0.1 on the basis of cell-by-cell fits. In addition, 4-AP also suppressed IKDR (Fig. 5) in a concentration-dependent manner (0.1–10 mM; n ⫽ 10). The IC50 was 2.2 ⫾ 0.3 mM, and b was 1.3 ⫾ 0.1. To study the properties of IKDR, we analyzed voltage and time dependence of the current. Figure 6B displays the I-V relationships of IKDR tail current measured at ⫺30 mV and step current in rat MSCs under control conditions. The current activated at potentials positive to ⫺20 mV, and showed a linear I-V relation of step current. The tail current reached a steady-state level at ⫹40 and ⫹60 mV. The activation conductance g/gmax of IKDR was obtained by normalizing tail current (Fig. 6C) and fitted to Boltzmann distribution. Midpoint (V0.5) of IKDR activation was ⫹1.5 ⫾ 0.2 mV, and slope factor was 9.1 ⫾ 0.3 (n ⫽ 18). IKDR exhibited a slow inactivation when a longer depolarization voltage step (4 s) was applied (Fig. 6D). Data for inactivation process of the current elicited by 4-s voltage steps to between ⫺10 and ⫹60 mV from ⫺80 mV was fitted to mono-exponential functions. The averaged values for voltage dependence of inactivation time constant are shown in Figure 6E; they suggest that the inactivation time constant increases as the current amplitude augments (p ⬍ .01; n ⫽ 16). The voltage protocol and representative recordings used to assess voltage-dependent inactivation (availability) of IKDR are illustrated in Figure 7A. Figure 7B illustrates availability curves of IKDR with 1-s and 4-s conditioning potentials. The current was inactivated to maximal at 0 mV (but incompletely even with 4-s conditioning pulses) and rebounded at potentials positive to 0 mV, showing an “U-shaped” inactivation curve with 1-s or 4-s conditioning potentials, which is similar to that observed in cloned Kv2.1 channels [24]. The decline limb of the inactivation curve with 4-s conditioning pulses was fitted to Boltzmann distribution with V0.5 of ⫺27.6 ⫾ 0.6 mV, and the slope factor was ⫺11.7 ⫾ 0.2 (n ⫽ 18). Figure 7C illustrates the current traces and voltage protocol used to determine recovery kinetics of IKDR from inactivation, and Figure 7D shows the mean data of recovery of IKDR from inactivation fitted to a bi-exponential function. On the basis of cell-by-cell fits, the recovery time constants for recovery of IKDR from inactivation were 85.2 ⫾ 5.2 and 989.7 ⫾ 51.2 ms for ␶1 and ␶2, respectively (n ⫽ 17). Figure 7E displays representative IKDR traces recorded with a 300-ms pulse from ⫺80 to ⫹50 mV in a rat MSC from the 1st, 5th, 10th, and 20th pulses at 1 Hz. IKDR was clearly smaller during the 5th, 10th, and 20th pulses than during the first pulse. Figure 7F shows mean values of changes in IKDR during each beat expressed as a function of the first pulse at each frequency. Significant use-dependent reduction of IKDR was noted at frequencies ⬎0.1 Hz (n ⫽ 15; p ⬍ .01 for 0.5, 1, and 2 Hz).

Messenger RNA Expression of Functional Ion Channel Currents Figure 8A and 8B displays mRNA expression for ion channel ␣-subunits related to functional outward and inward currents. Significant mRNA levels of SCN2a1 (likely responsible for www.StemCells.com

1525

Figure 7. Kinetics of delayed rectifier K⫹ current (IKDR). (A): Protocol and superimposed IKDR traces were used for determining voltage-dependent inactivation (availability) of IKDR. (B): Currents (I) at ⫹60 mV after 1-s (n ⫽ 21) or 4-s (n ⫽ 18) conditioning pulses from ⫺80 to between ⫺100 and ⫹60 mV were normalized by maximum current (Imax). I/Imax for 4-s conditioning pulses was fitted to Boltzmann distribution. V0.5 of availability was ⫺27.6 ⫾ 0.6 mV, and slope factor was ⫺11.7 ⫾ 0.2 (n ⫽ 18). (C): Superimposed recordings of IKDR recovery from inactivation obtained with the protocol illustrated in the inset: P1, a 300-ms pulse from ⫺80 to ⫹60 mV, to 0 mV for 4-s, and then to ⫺80 mV; P2, a 300-ms pulse from ⫺80 to ⫹60 mV. P1-P2 pulses were delivered at varying P1 and P2 interval. (D): Recovery curve was determined by normalizing P2 current by P1 current, and plotted against P1-P2 interval. The curve was fitted with bi-exponential functions with time constants of 85.2 ⫾ 5.2 and 987.7 ⫾ 51.2 ms for ␶1 and ␶2, respectively (n ⫽ 17). (E): IKDR traces recorded with a 300-ms step from ⫺80 to ⫹50 mV at 1 Hz in a rat MSC (passage 2) from the 1st, 5th, 10th, and 20th pulses. (F): Mean values of changes in IKDR during each beat expressed as a function of the first pulse at each frequency. Significant use-dependent reduction of IKDR was noted at frequencies ⬎0.1 Hz (n ⫽ 15; p ⬍ .01 for 0.5, 1, and 2 Hz). Abbreviations: CP, conditioning potential; P, pulse.

INa.TTX), CCHL2a (likely responsible for ICa.L), Slo and KCNN4 (likely responsible for IKCa), Kv1.4 and Kv4.2 (likely responsible for Ito), and Kv1.2 and Kv2.1 (likely responsible for IKDR) were detected in rat MSCs. When RNA was directly amplified by PCR without reverse transcription, the bands for the positive genes disappeared (Fig. 8C), suggesting that the genes detected were not false-positive signals from genomic DNA contamination. The relative levels of the specific mRNA to the housekeeping gene GAPDH are summarized in Figure 8C and 8D. These results provide possible molecular basis for the functional ionic currents (i.e., INa.TTX, ICa.L, IKCa, Ito, and IKDR) observed in rat MSCs.

1526

Figure 8. Messenger RNA (mRNA) of ion channel subunits related to the functional ionic currents was amplified by RT polymerase chain reaction (PCR). (A, B): Original gel showing significant levels of SCN21a, CCHL2a, Slo, KCNN4, Kv1.4, Kv1.2, and Kv2.1. (C): When RNA was directly amplified by PCR without reverse transcription, the bands for the positive genes as shown in (A) and (B) disappeared. (D, E): Summary of amplification of cDNA derived from mRNA with rat MSCs (n ⫽ 5; times of RT-PCR experiments from different cells of 2– 4 passages as used in ion channel study) relative to the housekeeping gene GAPDH. Abbreviations: bp, base pair(s); CACNA1, T-type calcium channel ␣-1 subunit; CCHL2a, L-type calcium channel ␣-2 subunit; EAG, ether-a-go-go potassium channel; GAPDH, glyceraldehyde-3phosphate dehydrogenase; KCNN3, calcium-activated potassium channel SK3; KCNN4, intermediate conductance calcium-activated channel; Kir, inward rectifier potassium channel; Kv, voltage-gated potassium channel; RT, reverse transcription; SCN1a, Na(v)1.1; Scn2a1, Na(v)1.2; Slo, big-conductance calcium-activated potassium channel.

DISCUSSION In the present study, we found that rat MSCs from bone marrow showed the potential to differentiate to bone cells and fat cells as reported previously [5, 25]. Importantly, we demonstrated that multiple ionic currents were present in undifferentiated rat MSCs from bone marrow, including voltage-gated INa, ICa.L, Ito, IKDR, and IKCa. IKDR was inhibited by 4-AP or TEA, Ito was blocked by 4-AP, and IKCa was suppressed by iberiotoxin and/or clotrimazole, whereas INa was blocked by TTX, and ICa.L was blocked by nifedipine. RT-PCR revealed the evidence for mRNA species that likely encodes each of these ion channels.

Ionic Currents in Rat MSCs MSCs were used for a number of years in the investigation of cell therapy and differentiation [4, 8, 26, 27]; however, information for ionic channel expression has not been well documented. Kawano et al. [28, 29] first demonstrated ionic homogeneity in human MSCs and found that Ca2⫹ oscillations regulated by Na⫹-Ca2⫹ exchanger and plasma membrane Ca2⫹ pump could induce fluctuations of membrane current and potentials in human MSCs. In addition, they found that IKCa was present in most of the cells and that nifedipine-sensitive ICa.L was present in a small population (15%) of human MSCs [29]. The evidence for the expression of big conductance of IKCa and ICa.L in human MSCs was further supported by Heubach et al. [30]. Our recent study demonstrated that in addition to IKCa and ICa.L, three more functional ionic channel currents (i.e., Ito, INa.TTX, and heag1) were present in undifferentiated human MSCs [19]. The present observation demonstrated the additional information that multiple ion channel currents were also present in undifferentiated rat MSCs. INa in rat MSCs was recorded in a small population of cells, and was sensitive to blockade by TTX (Fig. 3). Therefore, the current would be TTX-sensitive INa (INa.TTX). The presence of mRNA expression for the TTX-sensitive Na⫹ channel gene SCN2a1 further supported the observation that INa.TTX was expressed in rat MSCs (Fig. 8). ICa.L was found in 2 of 26 (8%) rat MSCs, and the current was sensitive to inhibition by nifedipine (Fig. 3C). Moreover, CCHL2a mRNA was significant in rat MSCs (Fig. 8). These results indicate that INa.TTX and ICa.L, as in human MSCs [19], are present in a small population of rat MSCs. Ito in rat MSCs was sensitive to inhibition by 4-AP (Fig. 4) as observed in neuronal, smooth muscle, and cardiac cells [16 –18, 31]. It is generally believed that Ito is encoded by Kv1.4, Kv4.2, and/or Kv4.3. A significant level of Kv1.4 mRNA was found in rat MSCs (Fig. 5), suggesting that Ito in rat MSCs may be encoded by Kv1.4. However, contribution of Kv4.2 could not be excluded. Ito in human MSCs was found to be mainly encoded by Kv4.2 [19]. We found that IKCa was not a single component in rat MSCs (Fig. 5). The currents showed characteristics of 1) noisy-like current traces at more-positive potentials, and 2) sensitivity to inhibition by the specific big conductance IKCa blocker iberiotoxin (Fig. 5A) and/or the intermediate conductance IKCa blocker clotrimazole (Fig. 5B). In addition, the current elicited by the ionophore ionomycin showed weak inward rectification and inhibition by clotrimazole, typical of intermediate conductance IKCa. Significant expression of Slo and KCNN4 mRNA (Fig. 8) supports the notion that two types of IKCa (i.e., big and intermediate conductance Ca2⫹-activated K⫹ channels) are heterogeneously present in some rat MSCs; however, they usually co-exist with IKDR in these cells. IKDR in rat MSCs (Figs. 6, 7) was sensitive to inhibition by TEA or 4-AP, and showed significant inactivation, slow recovery from inactivation, and “U-shaped” voltage-dependent inactivation. These properties are similar to those observed in cloned Kv2.1 channels [24]. RT-PCR further revealed high-level expression of Kv1.2 and Kv2.1 mRNA (Fig. 8), suggesting that Kv1.2 and Kv2.1 possibly contribute to IKDR in rat MSCs. Taken collectively, INa.TTX, ICa.L, and Ito in rat MSCs, as in human MSCs [19], were detected in a small population of cells, whereas IKDR was found in most rat MSCs. However, IKDR in rat MSCs was clearly different from that in human MSCs [19].


1527

The IKDR in rat MSCs showed remarkable inactivation with longer depolarization steps, “U-shaped” inactivation, and slow recovery from inactivation. Nevertheless, the IKDR in human MSCs had no time- and voltage-dependent inactivation [19]. The possible molecular base of IKPR is Kv1.2 and Kv2.1 for rat MSCs, whereas for human MSCs it is heag1 [19]. In addition, big conductance IKCa was present in most of human MSCs [19], whereas both big and intermediate conductance IKCa were heterogeneously present in some rat MSCs. These differences likely imply species variation. Cell transplantation is believed to be a promising treatment strategy for myocardial regeneration. MSCs have been currently used as a cell source for this purpose [10, 13, 14, 32]. However, studies have raised concerns as to whether observed arrhythmic events are a consequence of the intervention or the natural history of underlying disease [33, 34]. Understanding ion channel expression in undifferentiated MSCs will be helpful in seeking possible biological solutions to these concerns and medical challenges. The present observation focused on ion channel expression and demonstrated that multiple ion channels were present in rat MSCs, which provides a base for future investigations to avoid the possibility of threatening the promising treatment program. Ionic channels modulate cell cycling in proliferative cells [1]. It was reported that INa could play a role in the proliferation of astrocytes [35] and cancer cells [36, 37]. K⫹ channel expression was found to be changed with cell cycle progression [3], and K⫹ channel blockade was antiproliferative in numerous types of proliferative cells, such as cancer cells [1, 3], Tlymphocyte [38], and vascular smooth muscle cells [20].

However, little information is available in the literature regarding physiological roles of ion channels in MSCs, which remains to be studied in the future. Differential expression of the inward and outward currents in individual cells likely suggests the cells investigated are not from a homogeneous population of rat MSCs but are from, for example, cells at different phases of the cell cycle. It was reported that ion channel expression changed with cell cycle progression [3, 39]. In addition, fractions of more or less of committed progenitor cells would also affect the expression pattern of ion channels [30, 40]. The heterogeneous expression of ion channels was also described recently in human MSCs [19, 30]. The mechanisms underlying the heterogeneity of ion channels in both human and rat MSCs remain to be studied. In summary, the present study demonstrates for the first time that five distinct ion channel currents are found in undifferentiated rat MSCs, including three types of outward currents (IKCa, Ito, and IKDR) and two types of inward currents (INa.TTX and ICa.L). The information obtained from the present study provides strong basis for investigating how these functional ion channels regulate biological and physiological activity and differentiation of MSCs in the future.

REFERENCES

13 Blatt A, Cotter G, Leitman M et al. Intracoronary administration of autologous bone marrow mononuclear cells after induction of short ischemia is safe and may improve hibernation and ischemia in patients with ischemic cardiomyopathy. Am Heart J 2005;150:986.

1

Wonderlin WF, Strobl JS. Potassium channels, proliferation and G1 progression. J Membr Biol 1996;154:91–107.

2

Korr H. Proliferation of different cell types in the brain. Adv Anat Embryol Cell Biol 1980;61:1–72.

3

MacFarlane SN, Sontheimer H. Changes in ion channel expression accompany cell cycle progression of spinal cord astrocytes. Glia 2000; 30:39 – 48.

ACKNOWLEDGMENTS This study was supported by a RGC grant (HKU 7,347/03M) from Research Grant Council of Hong Kong. We thank Prof. T.M. Wong in the Department of Physiology for support.

DISCLOSURES The authors indicate no potential conflicts of interest.

14 Beeres SL, Atsma DE, van der Laarse A et al. Human adult bone marrow mesenchymal stem cells repair experimental conduction block in rat cardiomyocyte cultures. J Am Coll Cardiol 2005;46:1943–1952. 15 Hung SC, Chen NJ, Hsieh SL et al. Isolation and characterization of size-sieved stem cells from human bone marrow. STEM CELLS 2002; 20:249 –258.

4

Caplan AI, Bruder SP. Mesenchymal stem cells: Building blocks for molecular medicine in the 21st century. Trends Mol Med 2001;7:259–264.

5

Jiang Y, Jahagirdar BN, Reinhardt RL et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41– 49.

16 Li GR, Feng J, Yue L et al. Transmural heterogeneity of action potentials and Ito1 in myocytes isolated from the human right ventricle. Am J Physiol 1998;275:H369 –H377.

6

Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.

17 Nerbonne JM. Molecular basis of functional voltage-gated K⫹ channel diversity in the mammalian myocardium. J Physiol 2000;525:285–298.

7

Reyes M, Dudek A, Jahagirdar B et al. Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 2002;109:337–346.

18 Ohya S, Tanaka M, Oku T et al. Molecular cloning and tissue distribution of an alternatively spliced variant of an A-type K⫹ channel alphasubunit, Kv4.3 in the rat. FEBS Lett 1997;420:47–53.

8

Deans RJ, Moseley AB. Mesenchymal stem cells: Biology and potential clinical uses. Exp Hematol 2000;28:875– 884.

9

Reyes M, Lund T, Lenvik T et al. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 2001;98: 2615–2625.

10 Orlic D, Kajstura J, Chimenti S et al. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701–705.

19 Li GR, Sun H, Deng X et al. Characterization of ionic currents in human mesenchymal stem cells from bone marrow. STEM CELLS 2005;23: 371–382. 20 Kohler R, Wulff H, Eichler I et al. Blockade of the intermediateconductance calcium-activated potassium channel as a new therapeutic strategy for restenosis. Circulation 2003;108:1119 –1125.

11 Sussman M. Cardiovascular biology. Hearts and bones. Nature 2001; 410:640 – 641.

21 Jensen BS, Hertz M, Christophersen P et al. The Ca2⫹-activated K⫹ channel of intermediate conductance: a possible target for immune suppression. Expert Opin Ther Targets 2002;6:623– 636.

12 Tomita S, Li RK, Weisel RD et al. Autologous transplantation of bone marrow cells improves damaged heart function. Circulation 1999; 100(suppl 19):II247–II256.

22 Jensen BS, Strobaek D, Christophersen P et al. Characterization of the cloned human intermediate-conductance Ca2⫹-activated K⫹ channel. Am J Physiol 1998;275:C848 –C856.

www.StemCells.com

1528


23 Alvarez J, Montero M, Garcia-Sancho J. High affinity inhibition of Ca(2⫹)-dependent K⫹ channels by cytochrome P-450 inhibitors. J Biol Chem 1992;267:11789 –11793.

32 Cahill KS, Toma C, Pittenger MF et al. Cell therapy in the heart: Cell production, transplantation, and applications. Methods Mol Biol 2003; 219:73– 81.

24 Klemic KG, Shieh CC, Kirsch GE et al. Inactivation of Kv2.1 potassium channels. Biophys J 1998;74:1779 –1789.

33 Peters NS. Arrhythmias after cell transplantation for myocardial regeneration: Natural history or result of the intervention? J Cardiovasc Electrophysiol 2005;16:1255–1257.

25 Peter SJ, Liang CR, Kim DJ et al. Osteoblastic phenotype of rat marrow stromal cells cultured in the presence of dexamethasone, beta-glycerolphosphate, and L-ascorbic acid. J Cell Biochem 1998;71:55– 62. 26 Bruder SP, Jaiswal N, Haynesworth SE. Growth kinetics, self-renewal, and the osteogenic potential of purified human mesenchymal stem cells during extensive subcultivation and following cryopreservation. J Cell Biochem 1997;64:278 –294. 27 Janderova L, McNeil M, Murrell AN et al. Human mesenchymal stem cells as an in vitro model for human adipogenesis. Obes Res 2003;11: 65–74. 28 Kawano S, Shoji S, Ichinose S et al. Characterization of Ca(2⫹) signaling pathways in human mesenchymal stem cells. Cell Calcium 2002;32: 165–174. 29 Kawano S, Otsu K, Shoji S et al. Ca(2⫹) oscillations regulated by Na(⫹)-Ca(2⫹) exchanger and plasma membrane Ca(2⫹) pump induce fluctuations of membrane currents and potentials in human mesenchymal stem cells. Cell Calcium 2003;34:145–156. 30 Heubach JF, Graf EM, Leutheuser J et al. Electrophysiological properties of human mesenchymal stem cells. J Physiol 2004;554:659 – 672. 31 Amberg GC, Koh SD, Imaizumi Y et al. A-type potassium currents in smooth muscle. Am J Physiol Cell Physiol 2003;284:C583–C595.

34 Zhang YM, Hartzell C, Narlow M et al. Stem cell-derived cardiomyocytes demonstrate arrhythmic potential. Circulation 2002;106: 1294 –1299. 35 Pappas CA, Ritchie JM. Effect of specific ion channel blockers on cultured Schwann cell proliferation. Glia 1998;22:113–120. 36 Roger S, Le Guennec JY, Besson P. Particular sensitivity to calcium channel blockers of the fast inward voltage-dependent sodium current involved in the invasive properties of a metastastic breast cancer cell line. Br J Pharmacol 2004;141:610 – 615. 37 Abdul M, Hoosein N. Voltage-gated sodium ion channels in prostate cancer: Expression and activity. Anticancer Res 2002;22:1727–1730. 38 Rader RK, Kahn LE, Anderson GD et al. T cell activation is regulated by voltage-dependent and calcium-activated potassium channels. J Immunol 1996;156:1425–1430. 39 Czarnecki A, Dufy-Barbe L, Huet S et al. Potassium channel expression level is dependent on the proliferation state in the GH3 pituitary cell line. Am J Physiol Cell Physiol 2003;284:C1054 –C1064. 40 Muraglia A, Cancedda R, Quarto R. Clonal mesenchymal progenitors from human bone marrow differentiate in vitro according to a hierarchical model. J Cell Sci 2000;113:1161–1166.