Isolation and Sequence of cDNA Clones Encoding Rat Phosphatidy1i ...

Vol. 264, No. 28. Issue of October 5, pp. 16557-16564.1989 Printed in U.S.A.

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1989 by The American Society for .Biochemistryand Molecular Biology, Inc.

Isolation and Sequenceof cDNA Clones Encoding Rat Phosphatidy1i:nositol TransferProtein* (Received for publication, May 30,1989)

S. Kent Dickeson, Charlotte N. Lim, Gregg T. Schuyler, Timothy P. Dalton, George M. IHelmkamp, Jr., and Lynwood R. YarbroughS From the Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas66103

Phosphatidylinositol1 (PtdIns) transfer protein is a cytosolic protein that catalyzes the transfer of PtdIns between membranes. :Itis expressed in organisms from yeast to man, andactivity has been found in allanimal tissues examined. Using antibodies prepared against bovine brain PtdIns transfer protein, Xgtll rat brain cDNA libraries were screened and several clones isolated. DNA sequence analysis showed that the cDNAs encoded a polypeptide of 271 amino acids with a mass of 31,911 Da. Comparison of the deduced amino acid sequence with N-terminal sequence data obtained for the intact purified bovine brain protein and rat lung phospholipid transfer protein verified that the cDNAs were PtdIns transfe:r protein clones. The predicted protein shows no significant sequence similarity to other known (phospholipid)-binding proteins. DNA blot hybridization suggests that the rat genome may contain more than onte gene encoding PtdIns transfer protein. RNA blot hybridization reveals that the PtdIns transfer protein gene is expressed at low levels in a wide variety of rat tissues; all tissues examined showed a major mRNA component 1.9 of kilobases and a minor componentof 3.4 kilobases. The isolation of clones encoding rat PtdIns transfer protein will greatly facilitate studies of the structure and function of PtdIns transfer proteins and their role in lipid metabolism.

Phospholipid transfer proteins aremembers of a diverse set of cytosolic proteins that are thought to be involved with the transport of phospholipids between various subcellular membranes. Their function maybe associated with membrane biogenesis, repair, and maintenance of specific phospholipid compositions of subcellular membranes (1). Phospholipid transfer proteins have been found to vary considerably with regard to their size, isoelectric point, amino acid composition (2,3), andperhaps most importantly their phospholipid specificity (4). Some phospholipid transfer proteins are very specific, whereas other can transport a wide variety of phospholipids. Nonspecific lipid transfer proteins catalyze the trans-

* This work wassupponed by National Institutes of Health Grant GM24035 and in part by a grant from the American Heart Association,Kansas Affiliate. Computer resources for protein and DNA analysis were provided by the Bionet National Computer Resource for Molecular Biology, which is funded by the National Institutes of Health Grant P41RR016Eb5.The costs of publication of this article were defrayed in part by .the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. The nucleotide sequence(s) reported in thispaperhas been submitted to the GenBankTM/EMBLDataBankwith accession number(s) M25758. $. To whom correspondence and reprint requests may be addressed Tel.: 913-588-6960.

port of phosphatidylethanolamine,phosphatidylcholine (PtdCho)’ phosphatidylserine, phosphatidic acid, sphingomyelin, phosphatidylinositol (PtdIns), and cholesterol. PtdCho transfer protein is specific for PtdCho (5). PtdIns transfer-protein exhibits a dual specificity: it catalyzes the transport of PtdIns aswell as PtdCho. Relative rates of PtdIns transfer protein-mediated transfer of PtdIns and PtdCho have been found to vary between 5 and 20 (6). PtdIns is synthesized in the microsomal fraction of mammalian cells, with most of the synthetic activity being localized to the endoplasmic reticulum. Relatively small amounts of synthesis have been reported to occur in the Golgi (7). Conflicting descriptions of PtdIns synthesis localized to plasma membrane have also appeared (8, 9). The distribution of PtdIns among subcellular membranes is quite distinct from the distribution of the synthetic machinery (10). This leads to the assumption that some form of intracellular translocation from the site (or sites) of synthesis must be present. Mechanisms that have been postulated include ( a ) spontaneous transport; ( b ) vesicle traffic; and ( c ) protein-facilitated transport (11, 12). Spontaneous transport is unlikely due to the low solubility of phospholipids in water. Vesicle traffic would most likely result in the transport of a mixture of of a specific phospholipid molecules rather than the transport phospholipid such as PtdIns. It follows that PtdIns transfer protein may beresponsible for the specific transport of PtdIns to the plasma membrane. Its dual specificity may render it particularly useful in thisrespect since it could carry aPtdIns molecule from the endoplasmic reticulum to theplasma membrane and return with a molecule of PtdCho. Based on its transfer characteristics, PtdIns transfer protein may be well suited to function in replenishing PtdIns in the plasma membrane following stimulatedturnover of phosphoinositides which occurs in response to many receptor-mediated cell activation events (13, 14). PtdIns transfer activity has been measured in cytosolic fractions from 17 rat tissues, and PtdIns transfer protein has been purified to homogeneity from whole rat brain tissue (15). It had an apparentmolecular weight of 36,000 on electrophoresis under denaturing conditions and showed immunologic cross-reactivity with a rabbit polyclonal antibody that had been raised against the bovine brain protein. This antibody was also capable of recognizing a protein of similar size in the cytosolic fractions of tissues from several other mammalian sources (15). Primary structuresof several animal phospholipid transfer proteins have been reported PtdCho transfer protein from bovine liver (16); nonspecific lipid transfer protein from bovine liver (17); and nonspecific lipid transfer protein (sterol The abbreviations used are: PtdCho, phosphatidylcholine; PtdIns, phosphatidylinositol; SDS, sodium dodecyl sulfate; bp, base pair(s); kb, kilobase(s).

16557

16558 carrier protein 2) from rat liver (18). Primary structures have also been reported for nonspecific phospholipidtransfer proteins from severalplant sources includingspinach leaves (19), castor bean seeds (20, 21), and maize (22). Studies of the structure and function of PtdIns transfer proteins have been difficult in some cases due to the small amounts of protein obtainable. To date, there have been no reports of isolation of genesencoding a specific transfer protein such as PtdIns transfer protein or PtdCho transfer protein. Since the analysis of the structural, functional, and evolutionary relationships of the specific transfer proteins wouldbe greatly facilitated by genetic analysis, we have undertaken the isolation and sequencing of cDNAclones encoding rat PtdInstransfer protein. Using immunoscreening techniques, full length cDNAclonesencoding rat PtdIns transfer protein have been isolated and sequenced. The predicted PtdIns transfer protein primary structure shows no significant similarity to other lipid-bindingproteins. MATERIALS ANDMETHODS

cJXVA Library Screen~ng-~ndom oligonucleotide- prim^ and oligo(dT)-primed hgtll rat brain cDNA libraries were screened according to the method of Young and Davis (23) with a polyclonal antibody that had been raised against purified bovine brain PtdIns transfer protein(24). A random oligonucleotide-primedlibrary (DT2) constructed from the brains of 2-week-old rats was a gift from Dr. N. Davidson of the California Institute of Technology; an oligo(dT)primed library prepared from adult rat brains was a gift from Dr. R. Dunn of the University of Toronto. Over a million clones were

screened, and one positive clone was isolated from each library. PI10 was isolated from the random oligonucleotide-primed library and was approximately 1100base pairs fbp) in length. A larger clone (PI11)was isolated from the oligo-(dT)-primed library and sequenced. It contained a 1424-bp insert and was incomplete since it lacked a protein synthesis initiation codon. To obtain a full Iength clone, a 260-bp EcoRI-PstI fragment from the 5’ end of Pi-11 was isolated, labeled, and used to rescreen the oligo(dT)-primed library. Three of four additional larger cDNA clones isolated from the oligo(dT)primed library were approximately 1650 bp in length. One of these clones, PI-12, was usedto obtain the 5’ portion of the sequence which was missing in PI-11. Subcloning and Nucleotide Sequence Determination-The insert from PI-11 was subcloned into the EcoRI site of pIBI-76 (International Biotechnologies, Inc.,New Haven, CT) and propagated in Escherichia coli strain HBlOl. The insert from PI-12 was subcloned inta the EcoRI site of pGEM7”Zf(+) (Promega Biotec, Madison, WI) and propagated in E. coli strain JM109. A series of unidirectional deletion mutants was constructed from each end of PI-11, using exonuclease I11 as described by Henikoff (25). Plasmid RNA was sequenced using the dideoxy termination method of Sanger et ai. (26) with [cr-%3]dATP (1350 Ci/mmol) obtained from Du Pont-New England Nuclear. The reported nucleotide sequence was determined on both strands. Protein SequenceAnalysis-The sequence of the N-terminal region of PtdIns transfer protein, purified from fresh bovine brain by published procedures (27, 28), was determined by gas phase protein sequence analysis using a Biosystems 470A analyzer, as described by Wu and Yarbrough (29). Blot Hybridization of Rat Genomic DNA-High molecular weight genomic DNA was prepared from rat brain as described by Strauss (30).Rat brain DNA wasdigested using BarnHI, HindIII, EcoRI, and

YVITTCGGGCGGGAGGTGGCGAGGCCAGGGCAGGGT~CAGAAGCCCGCGCGGCGACCGCAGCGAGAGCA~GGGGACAGAGCAGACCACAACGAAGGCGCACAGGCAGCGGGG

Met Val Leu Leu Lys Glu Tyr C C G G G C C G G G C C A C C G G G A G A G C G G C C A C C G G G A A G C G G G C G G G A G G C C G G G C T G G C A G C T G G C A G C C G C C G A G C C G C ~ G C ~ CTG T G CTC AAG GAA TAT

114 7

221

Arg Val Ile Leu Pro Val Ser Val Asp Glu Tyr Gln Val Gly Gln Leu Tyr Ser ValLys Ala AsnGlu GluAla ThrSer Gly Gly36 CGG GTC ATC CTG CCT GTG TCT GTA GAT GAG TAT CAA GTG GGG CAG CTG TAC TCT GTG GCT GAA GCC AGT AAA AAT GAA ACT GGT GGT 308 Gly Glu Gly Val Glu Leu Val Val Asn Glu Pro Tyr Glu Lys Asp Asp Gly Glu Lys Tyr Gly Thr Gln His Lys Ile TyrHis Leu 65 GGG GAA GGT GTG GAG GTC CTG GTG AAC GAG CCC TAC GAG AAG GAT AAA GAT GGC GGC CAG GAG TAC ACA CAC AAG ATC TAC CAC TTA

395

Gln SerLys Val Pro Thr Phe Val Arg Met Leu Ala Pro Glu Gly Ala Leu His Asn Glu Ile Lys AlaTrp Asn Ala Tyr Pro Tyr 94 CAG AGCAAA GTT CCC ACGTTT GTT CGA ATG CTG GCC CCA GAA GGC GCC CTG AAT ATA CAT GAG AAA GCC TGG AAT GCC TAC CCT TAC 482 Gln Cys Arg Thr Val Ile Thr Asn Glu Tyr Met Lys Glu Asp Phe Leu Ile Lys His Ile Lys Glu Pro Thr Asp Trp Leu Gly Thr 123 TGC AGA ACC GTT ATT ACA AAT GAG TAC ATG AAG GAA GAC TTTAAA CTC ATTATT GAA ACC TGG CAC AAG CCA CTT GACGGC ACC CAG569 Glu Asn ValHis Lys Leu Glu Pro Glu Ala Trp His LysVal Glu Ala Ile Tyr Ile Asp Ile Ala Asp Ser Gln Arg Val Leu Ser 152 GAG AAT GTG CAT AAA CTG GAG CCT GAG GCA AAA TGG CAT GTG GAA GCT ATA TAT ATA GAC ATC GCT GAT CGA AGC CAA 656 GTA

CTT

AGC

Lys AspTyr Lys Ala Glu Glu Asp Pro Ala Lys Phe Lys Ser Ile Lys Thr Gly Arg Gly Pro Leu Gly Pro Asn 181 Trp Lys AAG GAT TAC AAG GCA GAG GAA GAC AAA CCA TTT GCAAAA TCT ATCAAA ACA GGA CGA GGA CCA TTG GGC CCG AAT TGG AAG 7CAA 43 GAA

Leu Val Asn Gln Lys Asp Cys Pro Tyr Met Cys Ala Tyr Lys Leu Val Thr Val Lys Phe Lys Trp Trp Gly Leu Gln As CTT GTC AAT CAG AAG GAC TGC CCA TAT ATG TGTAAA GCA CTGTAC GTT ACT GTC AAG TTC AAG TGG TGG GGC TTGAAA CAG GTGAAC830 Glu AsnPhe Ile His Lys Gln Glu Lys Arg Leu Phe Thr His Asn Arg PheGln Leu Phe Cys Trp Leu Asp Lys Trp Val 239 Asp Leu GAA AAC TTT ATA CAT AAG CAA GAG AAG CGT CTG TTT ACA AAC TTT CAC AGG CAG CTG TTCAAA TGT TGGTGGGTTCTTGATGATCTG 917 Thr Met Asp ACT ATG GAT Ala GCA

Asp Arg Ile Arg Met Glu Glu Glu Thr Lys Arg Leu Gln Asp Glu Met Arg Gln Lys Pro Asp Val Lys Gly Met Thr 268 GAA ATG GAA GAG ACG AAG AGA CAG CTG GAT GAGCARATG AAG AGA GAC CCC GTG AAA GGA ATG ACA 1004 GAC ATT CGG AGG

271 Asp Asp term GAT GAC TAG CGCTACCGCCCTTTCTGCACTTTTTGCAAGACAGTGGTCCACAGGAAGGCCCAGCAGCTCCACCCTCCTGAGTGGCAGGCCATCTTTGGACGCAGCCTT 1115

TCTGTGCTCATTCTTCAGGCAACTTTCAGTCCCTTACTATAGCTATTTCTAGATGCCCTTTAACATTGTGAACAAATAGACCGTCTGGTATTATAAAGCCTGTGTGTGCGGGAGC 1230

CTGATCCTCTAAGATATATGGTGTATGCTGCTGTATTTACAGCTCATCCTCTCTCCATTGTGCCCTGACCCATTTCTGTATGCCCTCCCCCTTTATTTCCAAGTGACGTTCTCAT 1345 TCTTTCAAATGTGCTGCCTTTGTGATGTGATTATTTAAGCTCACTTATTTCAGCCTTGGGATAAGCTGAGCTATTTTGCTTCCTGGGCAGATCTTTGGCAATGTTGAATATTCAC 1460

TTGGGGAGAGAGGAGGAGTT~TACAGAGACACCTACCCTAGCTCCTCACAATAGGAATGTGGCTTCAG~CCCTGACCTCTGCTCCTAGTAACCTCTTGTTCGCGTGCTCT 1575 AAGCACCAAGAAGGCACCCAAGGCCCAGCCAGTCTAAG~TTTAGCAAAT~~~TAACCCCTACTC~

FIG.1. Nucleotide sequence and predicted protein sequence of the rat PtdIns transfer protein cDNA. Numbering commences with the first nucleotide of the 8-bp5‘ EcoRI linker used in cloning. The signal sequence for initiation of translation at position 198-204 is underlined (35). The polyadenylation signal sequence (AATAAA) is shown in a larger font size and bold (36).

1668

16559

Phosphatidylinositol 1"ransferProtein cDNA Pstl in separate reactions. Eight pg of digested DNA was fractionated per lanein 0.7% agarose gels and blotted to nitrocellulose as described (800 Ci/mmol) by Southern (31). Probes labeled with [cY-~'P]~CTP were prepared using the random oligonucleotide-priming method of Feinberg and Vogelstein (32, 33). Following transfer, blots were hybridized with the following probes prepared from PI-12 (a) full length cDNA probe; (b) 5'probe prepared from a 382-bp EcoRI-BglII fragment (nucleotides 1-38,2);and (c)3' probe prepared from a 504bp XboI-EcoRI fragment (nucleotides 1163-1667). The blots were hybridized a t 65 "C with these probes (2 X lo6 cpmlml) in 6 X SET (0.15 M NaCl, 30 mM TrislHCl (pH 8.0), 2 mM EDTA) containing 0.2% polyvinylpyrrolidone, O.% Ficoll, and 0.2% bovine serum albumin. They were rinsed twice with 3 X SSC (0.15 M NaC1,0.015 M sodium citrate) 0.1% SD8, washed three timesat thesame temperature and with the same solution for 30 min each, and exposed to Kodak X-Omat AR-5 film for 1-2 days. RNA Blot ~ y ~ ~ d i z a t i o n - R Nwas A extracted from tissue homogenates using a phenol-SDS procedure described by Andrews et al. (34). Eight pg of RNA was electrophoresed in 1.5% agarose-formaldehyde gels and blotted to nitrocellulose. Filters were hybridized for 16 h at 65 "C in 3 X SET with 1 X lo6 cpm/ml of a 32P-labeled antisense cRNA probe transcribed from PI-11. They were washed (65 "C) for 1 h in 1 X SSC + 0.1% SDS then in 0.1 X SSC + 0.1% SDS for 30 min. In some cases, filters were digested for 10 min a t 37 "C with pancreatic rib,onuclease (10 pglml). Filters were then subjected to autoradiography for 1-2 days. In Vitro Transcription Of the Full Length cDNA and Transhtwn in a Rabbit Reticulocyte Lysate-PI-12 was linearized with BamHI and transcribed with T7 RNA polymerase (Promega Biotec). Sense RNA was translated using a rabbit reticulocyte lysate according to the manufacturer's protocol (Promega Biotec). [3SS]Methionine(1200 Ci/mmol) was obtained from Du Pont-New England Nuclear. The products were analyzed by SDS-polyacrylamide gel electrophoresis and fluorography. Immunoprecipitation competition by unlabeled bovine brain PtdIns transfer proteinwas performed as follows. Three pl of the in vitro translation reaction was incubated for 12 h at 4 "C with 40 pg of an IgG fraction against bovine brain PtdIns transfer protein in thepresence of increasing amounts of bovine brain PtdIns transfer protein. Samples were in a reaction volume of 200 pl in a buffer containing 20 mM Tris/HCl, pH 7.5; 60 mM EDTA, 1%Triton X-100;0.5% sodium deox,ycholate,0.1% SDS and phenylmethylsulfonyl fluoride; and 10 pg/ml aprotinin, leupeptin, and pepstatin A. Following incubation, 20 ,ul of a 50% slurry of protein A-Sepharose CL-4B was added and mixed for 2 h at room temperature. The beads were isolated by centrifugation, washed once with incubation buffer lacking protease inhibitors and washed three times with incubation buffer containing 100 mM NaCl in lieu of 60 mM EDTA. Protein bound to thebeads was eluted by heating a t 90 "C for 3 min in SDSpolyacrylamide gel electrophoresis sample buffer. Samples were separated by polyacrylamide gel electrophoresis (12% gels) and analyzed by fluorography.

+

isolated in the initial screening of the libraries. PI-10 was isolated from a random oligonucleotide-primed library (DT2) and contained a 1.1-kb cDNA insert. PI-11 was isolated from an oligo(dT)-primed library and contained a 1.4-kb cDNA insert. Fusion proteins synthesized by the two clones were analyzed by immunoblotting using the above antibody. PI-10 produced a 140-kDa fusion protein; PI-11 produced a 150kDa fusion protein (data notshown). The insert from PI-11 was sequenced as described under "Materials and Methods." Analysis of the sequence data revealed that the1424-bp insert from PI-11 lacked an initiating methionine and was therefore incomplete. Consequently, the oligo(dT)-primed library was rescreened using a 5' probe prepared from PI-11 as described earlier. Three clones of about 1650 bp were obtained. The 5' part of each clone was sequenced and shown to overlap perfectly with the 5' terminus of PI-11. Two of the clones contained an in-phase initiator methionine codon 45 bp upstream of the 5' terminus of PI11, thereby specifying an additional 15amino acids. The third clone contained a GTG instead of an ATG at this position; we presume that it most likely was produced by an error of the reverse transcriptase. The 3' terminus of the three clones TABLE I Amino acid compositionpredicted for rat PtdIns transfer protein and determined for bovine brain PtdIns transfer protein

Ala Arg Asn ASP Asx CYS Gln Glu Glx OlY His Ile Leu LYS Met Phe Pro Ser Thr Trp TYr Val

RESULTS

~ S o ~ ~ iand o nSequeacing of cDNAs Encoding Rut PtdIns Transfer Protein-Clones were isolated from random oligonucleotide-primed andl oligo(dT)-primed rat brainXgtll cDNA libraries by imnlunoscreeNng with a p'&'clonal antibody against purified bovine brain PtdIns transfer protein. As noted under "Materials and Methods," two clones were 1 Rat Lung Rat Brain

2

3

4

5

6

7

8

9

No. of residues

Amino acid Rat"

Bovine'

13 11 11 18 29 4 13 27 40 14 8 12 21 29 8 8 12 7 13 8 13 21

16 13 NDc ND 33 4

ND ND 45 19

6 10 25 27 7

9 14 12 15

ND 11 17

a The number of residues is that predicted by the cloned rat cDNA. The mass of the predicted protein is 31,911 Da. bThe number of residues was calculated from the data of Helmkamp et al. (24) for the bovine brain protein by correcting to a mass of 31,900 Da. e ND, not determined.

10

11

12

13

14 15 16 17

18

19 20

21

Val1 Leu Leu Lys Glu Tyr A r g Val Ile Leu Pro (Val) H i s Val A s p Glu Tyr Gln Val Gly

..

..

..

..

..

..

..

..

..

..

..

Met Val Leu Leu Lys GluTyr Arg Val Ile Leu Pro -

*

.*

..

.-

..

..

Val

..

..

..

..

..

..

.

.

.

.

.

..

S e r Val Asp Glu Tyr Gln Val

.

..

Gly

..

Bovine Brain Lys Glu Tyr Ser Val Ile Leu Arg Ser Gly Val Glu Glu Tyr Gln Val Gly FIG. 2. Comparison of the amino acid sequence of the rat lung and bovine brain PtdIns transfer protein with the sequence of the rat protein predicted from the cDNA. The rat lung sequence is that reported by Funkhouser (38). The sequence of the bovine protein was determined by gas phase sequence analysis. The first three cycles did not show any identifiable amino acids. Thus, the N-terminal methionine is missing as was found for the ratlung protein. Double dots represent identical amino acids. Single dots represent conservative substitutions.

Phosphatidylinositol Transfer Protein cDNA

16560

A

3

0

100

50

150

200

250

AminoAcidResidue

B 10

20

40

30

50

60

70

90

80

M v L L E c E y R v I L p V s v D E Y Q Y ~ K ~ ~ E ~ ~ ~ ~ D G E K ~ Y ~ I ~ Q S AAAmA " &F!E!!!AAAAAAAAAAAIUUUL BBBBBBBBBBB BBBBBBB BBBBBB BBEBBBBBBBB BBBBBBBBB BB TWTTTTT TTTT TTTTTTT TTTT

-

-

100 110 120 130 140 150 160 170 180 AYPYCRTVITNa~DFLIKIETIQBKPDLCT~~P~~IYIDIADRS(rVLSICDYKAEEDP~KSIKTCRCPLCP~Q

E

BBBBBBBBBBBBBB TTTT

E

L

190 ~ Q

AliAA

BBBBB

BBBBB T'ITC

BEBBBBB

!rTTT

K

200 D

C

210 P ~

~

AAA mu#%AA B W B BBBBBBBBBBBB BBBBBE BBBBBB TTTTTTTTTITTTTT

-

220 ~ ~

G

230 ~

N

mT

240 P '

I

TTTTTTTFS

T!R'T

250 I ~

~

260 ~

Q

270 ~ ~

~~

BBBBBBBBBSBEEBBB BBBBBB TTTT

TTTTTT

FIG. 3. Predicted structural analysis of rat PtdIns transfer protein. A , the hydropathy index is shown on the vertical axis, with positive numbers indicating hydrophilicity and negative numbers indicating hydrophobicity. The procedure of Hopp and W d s (41) was used with a window of 8 residues. B, the secondary structure i n erepresent ~ predicted by Chou-Fasman analysis: AAAA, cu-helix; BB3B, @-sheet;TTTT, @-turn.U ~ e ~ ~regions strongly amphipathic a-helicesor @-sheets.

was sequenced fora distance of about 300 bpfrom the poly(A) tail. They were found to be similar if not identical to PI-11. One of the clones (PI-12) was used for further studies. The composite DNA sequence determined from PI-11 and PI-12 and thepredicted PtdIns transferprotein sequence are shown in Fig. 1. The sequence is 1668 bpin length (including the 8-bp EcoRI linker used in cloning) and contains a single open reading framethat encodes a polypeptide of 271 amino acids with a mass of 31,911 Da. The ATG that is present at the 5' end of the reading frame is present in the sequence GACATGG,whichcomparesfavorably with the optimum translation initiation sequence (ACCATGG) and is consistent with the minimal requirement of (PuXXATGG) (35). The AATAAA polyadenylation signal sequence occursat position 1628 and is 19 nucleotidesupstream of the poly(A) tail (36). The aminoacidcomposition of bovine PtdIns transfer protein has been determined (24, 37). Table I shows a com-

parison of the composition predicted for the rat protein and that determined for bovinebrain protein (24). Glutamic acid, aspartic acid,lysine,or arginine represent almost a third (31%)of the rat protein amino acids; another third (38%)are hydrophobic amino acids: alanine, methionine, tyrosine, p h e ~ y l a l ~ i ntryptophan, e, leucine, isoleucine,or valine. The rat and bovine proteins show a high degree of similarity in composition for most amino acids, suggesting that the sequences of the rat andbovine proteins are similar. To verify that PI-12 did encode a PtdIns transfer protein, the amino acid sequence that was deduced from it was compared with N-terminal protein sequence data obtained for the intact bovine brain PtdIns transfer protein and withNterminal protein sequence data obtained by Funkhouser (38) for a phospholipid transfer protein purified fromrat lung (Fig. 2). The sequence obtained for the rat lung protein differs from that predicted for the rat brain protein by only two amino acids: histidine instead of serine, at position 14 and

~

L

~

Phosphatidylinositol Protein Transfer 16561 cDNA

23.19.4-

6.54.3-

~

C

B

A

--

2.00

1 2 3 4

1 2 31 42 3 4 FIG.4. Rat genomic DNA blot hybridization. Rat brain genomic DNA was digested with BarnHI (I), HindIII ( 2 ) , EcoRI ( 3 ) , and PstI ( 4 ) in separate reactions. Digests were separated in 0.7% agarose gels, transferred to nitrocellulose (in triplicate), and hybridized with either the 5’ probe ( A ) ,the full length probe ( B ) ,or the3’ probe (C). Hybridization and washing were performed as described under “Materials and Methods.”

-28s -18s

1

2

3

4

5

FIG.5. Blot hybridization of total RNA from rat tissues. Total RNA from the indicated rat tissues was separated in a 1.5% agarose gel, transferred to nitrocellulose, and probed with an antiA major component of sense cRNA probe labeled with [cY-~*P]GTP. 1.9 kb and a minor component of 3.4 kb are found in all tissues.

the N-terminal methionine that is absent in the rat lung protein. The sequence of the bovine brain PtdIns transfer protein was also used for comparison since initial experiments to obtain N-terminal sequence data for the rat brain PtdIns transfer protein were not successful, due in part to the small amounts of protein available. Seventeen residues (amino acids 4-20) were identified by gas phase Edman degradation of the intact bovine brain protein. Residues at positions 1, 2, and 3 were not identifiable since they were obscured by contaminating glycinepeaks.Twelve of the 17 amino acids were identical to amino acid residues contained in positions 5-21 in the deduced rat protein sequence. An additional 3 of the 17 amino acids represent conservative substitutions. Analysis of the sequences with the FASTA program of Pearson and Lipman (39) gives a 73% similarity score. These data confirm that PI-12 is an authentic PtdIns transfer protein clone and verify the position of translation initiation. The amino acid that was identified in the fourth position of the bovine protein corresponds to thefifth amino acid in the deduced rat protein sequence. This is probably dueto the subsequent removal of the N-terminal amino acid by an N-terminal methionine

aminopeptidase since N-terminal methionine removal has been shownto occur whenalanine, glycine, proline, serine, or valine is penultimate (40). Protein Structural Analysis and Relatedness to Other Proteins-Hydropathy measurements were performed according to the method of Hopp and Woods (41) with the programs available on Bionet using a windowof 8 residues. The hydropathy plot showsthe presence of three strongly hydrophilic regions (Fig.3A). These can be seen at positions 47-57,144171, and 240-271. These strongly hydrophilicregions are likely to contain the major antigenic determinants present in the protein. Surprisingly, there are no extended regions of highly hydrophobicamino acids. Fig. 3B shows the secondary structure predicted by Chou-Fasman analysis. The protein is predicted to contain significant amounts of a-helix, some of which are clearly amphipathic. The C terminus, which is highly hydrophilic, has a relatively high probability of being in an a-helical conformation. Some regionsof amphipathic j3sheet structure are also predicted. Regions witha high probability of turns (>1.30) are found at residues 34-37, 51-54, and 170-178. A computer search of the National Biomedical Research Foundation (PIR) and the Swiss-Protein data bases available on Bionet was conducted using the FASTA programs described by Pearson and Lipman with a ktup of l (39). No protein had a score equal to or greater than 6 standard deviations above the mean, the value usually taken as the cutoff for probable significance. The PtdIns transfer protein was also compared directly with the following lipid-binding proteins using the FASTA program:endonexin, spinach nonspecific transfer protein, rat nonspecific transfer protein, bovine nonspecific transfer protein, maize nonspecific transfer protein, and bovine PtdCho transfer protein. Only three proteins, bovine and ratnonspecific transfer proteins and the bovine PtdCho transfer protein, had scores above a cutoff value of 33.These proteins were compared withPtdIns transfer protein using the Pearson and Lipman RDF2 program (39), which randomizes the comparison sequence and compares it with the protein to be tested. This comparison showed that any observed similarities were not significant. The relatedness to other DNA sequences inthe GenBank database was also examined,and no apparently significant similarities were found. Consequently, it appears that ratPtdIns transferprotein represents a new structural class of phospholipid transfer proteins. DNA Blot Hybridization Analysis-DNAblot hybridization was performedto obtain information about the possible presence of more than one gene encodingPtdIns transferprotein. Three cDNA probes, full length, 5’-specific, and 3’-specific, were prepared as described under “Materials and Methods.” Rat genomic DNA was digested in separate reactions with BamHI, HindIII, EcoRI, and PstI, transferred to nitrocellulose, and probed with each of the three probes. The autoradiographs are shown in Fig. 4. The 382-bp 5‘probe was found to hybridize with two bands after digestion by four enzymes (BamHI, EcoRI, HindIII, and PstI),which do not cut within the probe. A probe to the3‘-untranslated region also hybridized with multiple bands, as did the full length probe. In some instances, a fragment that appears to be the same size hybridizes with both the 5‘- and 3’-specific probes (the larger BamHI and smaller EcoRI fragments hybridizing with the 5‘ probe). Thus, the datasuggest the presence of multiple genes and/or introns. Expression of the PtdIns Transfer Protein Gene in Various Tissues-Total RNA was isolated from rat liver, kidney,heart left ventricle, brain, and testis. It was then fractionated by

Phosphatidylinositol Transfer ProteincDNA

16562

B

A -

3520

-

"

-

"

-.

1 2 3 4 5 6 7 1

2

3

FIG. 6. Immunoblot analysis of protein produced by in vitro transcription/translation.Samples were separated by polyacrylamide gel electrophoresis and analyzedby fluorography as described. A , unfractionated in vitro translation products: lane I, brome mosaic virus RNA standard thatencodes proteins of 20 and 35 kDa; lane 2, RNA produced by transcription of PI-12; lane 3, no added RNA. B, competition of immunoprecipitation of lane I , PtdInstransferprotein produced by in uitro translation withbovine brainPtdInstransferprotein: precipitation by control preimmune serum; lane 2, translation lackingRNA; lune 3, immune serum with no competitor PtdIns transferprotein: lanes 4-7 contained, respectively, 0.25, 0.5, 1, and 2 pg of bovine brain PtdIns transfer protein as competitor.

gel electrophoresis, transferred to nitrocellulose, and hybrid- known, however, about the ligand-binding sites of proteins ized with a "P-labeled antisense cRNA probe. Two bands that bind phospholipids. Wirtz and co-workers (43-45) have were observed with RNA from all tissues (Fig. 5). The most characterized the binding of phospholipids to PtdChotransfer prominent band represented a 1.9-kb transcript; a second, protein by fluorescence spectroscopy and affinity labeling. weaker band could be detected a t about 3.4 kb. RNA from Using fluorescent phospholipids containing parinaric acid, testis showed the most intense hybridization. Densitometric they observed a different rotationalcorrelation time when the analysis of the autoradiogram indicated that the brain con- fluorophore was attached to the sn-1 position than when tained about50% of the levels in testis, the heartleft ventricle attached to thesn-2 position. They concluded that there are about 25% that of the testis, and thekidney 10-15%. Although separate binding sites for the two acyl chains and thatthese liver contained less than 10% of the levels found in testis, binding sites arelocated nearly orthogonal to each other (45). bothbands became visible on longer exposure. Thus, all Somerharju et al. (45) have shown that PtdCho molecules tissues examined show mRNA encoding PtdIns transfer pro- containing pyrene at the sn-1 and sn-2 positions also show tein. It should be noted that even in testis, the levels were different binding properties which they interpret assupportrelatively low, since a 24-h exposure was usually required to ing a two-site model. Similar observations have also been obtain good intensity in autoradiograms. To ensure that the made for the PtdIns transfer protein (46, 47), and two acyl probe was not binding nonspecifically, poly(A)' RNA was chain binding sites have been proposed. isolated from brain and testis and analyzed by blot hybridiPhospholipids containing photoreactive adducts have been zation. Both the 1.9- and 3.4-kb bands were observed with used to determine the regions of PtdCho transfer protein poly(A)+ RNA and were resistant to ribonuclease digestion. interacting with the fattyacyl chains (43,48). With a photoWe conclude that the larger band is not due to nonspecific reactive group at thesn-2 position of PtdCho, the major sites hybridization to ribosomal RNA. of coupling were Tyrs4 and the hydrophobic peptide (I7lValI n Vitro TranscriptionlTranslation-Using BarnHI-linear- Phe-Met-Tyr-Tyr-Phe-A~p'~~) (48). Based on predictive ized PI-12 as a template, sense RNA was transcribed using structural analysis, it was suggested that thispeptide may be T 7 RNA polymerase. The RNA was added to a rabbit retic- part of an antiparallel @-sheetstructure that binds the twoulocyte lysate containing [3sS]methionine.Following transla- acyl chain. To date, there have been no reports of similar tion, 500 pg of protein from the reaction was fractionated by affinity labeling studies of the PtdIns transferprotein; howpolyacrylamide gel electrophoresis and analyzed by fluorog- ever, the procedures developed for study of the PtdCho transraphy. A protein that co-migrated with purified rat brain fer proteinshould be readily applicable to the PtdIns transfer PtdIns transferprotein was synthesized when PtdIns transfer protein. protein sense RNA was added; it was not present in controls We have examined the sequence of PtdIns transferprotein lacking RNA (Fig. 6A). The 36-kDa protein that was synthe- to determine whether asequence similar to thatfound for the sized was precipitated with antibody to bovine brain PtdIns binding site of PtdCho transferprotein is present. No related transfer protein; precipitation was prevented by the addition sequence was found. This may reflect a lack of specificity for of increasing amounts of purified bovine brain PtdIns transferamino acids forming a hydrophobic site or pocket which can protein (Fig. 6B). bind phospholipids. Alternatively, it could reflect different evolutionary origins of these proteins. Further studies of the DISCUSSION primary sequences of other phospholipid-binding proteins Ligand-binding sites of functionally related proteins are may provide information aboutthe evolution of phospholipidoften strongly conserved. For example, several proteins that binding sites. bind GTP have regions of highly conserved structure which Specific amino acid sequences have been correlated with form part of the GTP-binding site (42). These conserved substrate binding in a numberof other lipid-binding proteins. The sequence Gly-X-Ser-X-Gly preceded by 4 hydrophobic sequences are found in the ras oncogene protein,protein synthesis elongation factor-2 and initiation factor-2, trans- residues has been found in pancreatic lipase, lecithin-cholesducin, and other members of the G protein family. Less is terol acyl transferase, lingual lipase, gastric lipase, and hepatic

16563 lipase (49). Several lipo’cortin-likeproteins from the human, served throughout the evolution of higher eukaryotes. Bovine proteins have similar amino acid rat, and pig contain five regions of sequence homology which and rat PtdIns transfer may be involved with phospholipid binding (50). Endonexin composition profiles, and thelimited sequence data forbovine If, protein 11, and calpactin I show similarity to thelipocortins brain protein reveal that theN termini of the rat and bovine (51). However, none of the above protein shares any obvious proteins are very similar. Moreover, rat PtdIns transfer prosimilarity with PtdIns transfer protein. It should be noted tein cDNA hybridizes with genomic DNA of Drosophila melthat nonspecific transfer proteins differ in a number of ways anogaster and all higher eukaryotes that we have examined. from PtdIns transfer protein and PtdCho transfer protein We have isolated clones encoding human PtdIns transfer (22). Nonspecific transfer proteins contain few or no aromatic protein and found that thesequence is very similar to thatof amino acids, whereas PtdIns and PtdCho transfer proteins therat, in both the coding and 3‘ untranslated regions.* contain many aromatic residues. Nonspecificproteins are also Similar conservation has been found for the 3”untranslated generally much smaller (10 kDa) than eitherPtdIns or regions of a-tubulin genes (53). The significance of this conPtdChotransfer protein. Predictive methods suggest that servation is presently unclear; however, it will be of interest nonspecific lipidtransfer proteinscontain little orno &-helical to determine whether the conservation among mammalian regions, whereas PtdIns transfer protein likely contains sig- PtdIns transfer proteins can be extended to the more widely divergent Drosophila. Further evidence for the conservation nificant amounts of &-helix. The c D ~ A - p r e primary ~ ~ d sequence of rat PtdIns trans- of at least part of the sequence of PtdIns transfer protein analysis of cytosolic fractions from fer protein yields a molecular weight of 31,911. This value is comes from immunological considerably less than thevalue of 36,000 calculated from the several species. Rabbit antibody to bovine PtdIns transfer migration of the denatu.red rat protein as well as othermam- protein reacts with a protein of about 35-36 kDa present in malian PtdIns transfer proteins onpolyacrylamide gels (15). cytosolic fractions from mammalian, avian, reptile, amphibIn contrast, the predicted value is greater than thatobserved ian, and insects? The strong conservation of structure beon molecular sieve chromatography under native conditions tween widely divergent organisms suggests that the PtdIns where molecular weights in the range of 24,000-28,000 have transfer protein has an important cellular function(s). The been observed for PtdIns transfer proteins isolated from bo- availability of cDNAclones willallow characterization of vine brain (27), bovine heart (37), and human platelets (28). phenotypic effects produced by overexpressing or underexThe addition of 1 mo1of PtdIns or PtdCho/moi of protein, pressing the protein and facilitate definition of the role of the the native state of PtdIns transfer protein (47), would only PtdIns transfer protein in lipid metabolism. increase the predicted polypeptide weight to a value less than A c ~ ~ ~ ~ d g ~ nthank ~ s -Dr. WR.e Dunn of the University of 33,000, but thisshould not influence the behavior on electrophoresis. It is significant that the rat cDNA that provided the Toronto and Dr. N. Davidson of theCalifornia Institute of Technology for their generous gifts of the rat brain cDNA libraries. William primary sequence data can be transcribed and translated to R. Pearson kindly provided copies of the FASTA programs for seproduce a polypeptide that possesses a larger than predicted quence analysis. molecularweight(Fig. 6A). The cause of the anomalous chromatographic and electrophoretic mobility of PtdIns REFERENCES transfer protein which ‘has beenreported by different labora1. Helmkamp, G. M., Jr. (1986) J. Bioenerg. Biomembr. 1 8 , 71-91 tories remains obscure. 2. Kader, J.-C., Douady, D., and Mazliak, P. (1982) in Phospholipids The DNA-blotting experiments showed two hybridizable (Hawthorne, J. N., and Ansell, G. B., eds) pp. 279-311, Elsevier Science Publishing Co., Amsterdam fragments with four different restriction enzymes when the 5’ EcoRI-PuuII fragment was used as a probe. This could be 3. Wirtz, K. W. A. (1982) in Lipid-Protein Interactions (Jost, P. C., and Griffith, 0. H., eds) pp. 151-231, Wiley-Interscience, New explained by the presence of an intron within the probe region York which has sites for all Ifour enzymes. Alternatively, the pres4. Somerharju, P. J.,Van Paridon, P. A., and Wirtz, K. W. A. (1983) ence of two different genes could give rise to the observed 3iochim. Bwphys.Acta 731, 186-195 hybridization patterns. As noted earlier, the N-terminal se5. Westerman, J., Kamp, H. H., and Wirtz, K. W. A. (1983) Methods Enzymol. 98,581-586 quence reported by Funkhouser (38) for a phospholipid trans6. Van Paridon, P. A., Gadella, T.W. J., Jr., Somerharju, €3.J., and fer protein from rat lung differs by 1 amino acid from that Wirtz, K. W. A. (1987) Biochim. Biophys. Acta 903,68-77 predicted for at PtdIns transfer protein. Based on the nearly 7. Bishop, W. R., and Bell, R. M. (1988) Annu. Reu. Cell 3 w l . 4, identical N-terminal sequence, comparable molecular weight, 579-610 substrate specificity, and generally similar amino acid com8. Imai, A., and Gershengorn, M. C. (1987) Nature 3 2 5 , 726-728 9. Monaco, M. E. (1987) J. Biol. Chem. 262,13001-13006 position (52), we suggest that the protein characterized by Funkhouser and associates is the PtdIns transfer protein 10. White, D. A. (1973) in Form and Function of the Phospholipids (Ansell, G. B., Dawson, R. M. C., and Hawthorne, J. N., eds) described in our paper. It is possible, however,that there are pp. 441482, Elsevier Science Publishing Co., Amsterdam two genes encoding highlysimilar but not identical proteins. 11. Helmkamp, G. M., Jr. (1985) Chem. Phys. Lipids 38, 3-16 Studies with small (25 bp) oligonucleotide probes and isola- 12. Dawidowicz, E. A. (1987) Annu. Reu. Biochem. 56,43-61 tion of genomic clones s,hould provide more information about 13. Berridge, M. J. (1986) J. Cell Sci. Suppl. 4 , 137-153 14. Hokin, L. E. (1985) Annu. Reu. Biochem. 54,205-235 the possible presence of multiple genes for PtdIns transfer 15. Venuti, S. E., and Helmkamp, G. M., Jr. (1988) Biochim. Biophys. protein. Acta 946,119-128 All rat tissues examined show the presence of a band of 16. Akeroyd, R., Moonen, P., Westerman, J., Puyk, W. C.,and Wirtz, about 3.4 kb in RNA blot hybridizations. This appears to be K. W. A. (1981) Eur. J.Biochem. 114,385-391 specific hybridization, in that itis also observed with poly(A)+ 17. Westerman, J., and Wirtz, K.W.A. (1985) Biochem. Biophys. Res. Commun. 127,333-338 RNA. In rat testis, there is a protein of about 41 kDa which 18. Pastuszyn, A., Noland, B. J., Bazan, 3. F., Fletterick, R. J., and reacts with antibody against bovine brain PtdIns transfer Scallen, T.J. (1987) J. Biol. Chem. 2 6 2 , 13219-13227 protein (15). Studies are underway which should clarify the 19. Bouillon, P., Drischel, C., Vergnolle, C., Duranton, H., and Kader, relationship, if any, between the larger mRNA species and the larger immunoreacl~iveband found in testis. L. R. Yarbrough, unpublished data. The structure of PtclIns transfer proteins is strongly conG. M. Helmkamp, Jr., Unpublished data.

~ h o s ~ ~ ~ ~ dTransfer y ~ i Protein ~ o ~ cDNA ~ ~ o l

16564

J.-C. (1987)Eur. J. B~mhem.166,387-391 37. DiCorleto, P. E.,Warach, J. B., and Zilversmit, D. B. (1979)J. Bid. Chem. 264, 7795-7802 20. Takishima, K., Watanabe, S., Yamada, M., and Mamiya, G. 38. Funkhouser, J. D. (1987)Bioehem. Biophys. Res. Commun. 146, (1986)Biochim. Biophys. Acta 870,248-255 1310-1314 21. Takishima, K., Watanabe, S,, Yamada, M., Suga, T., and Ma39. Pearson, W. R., and Lipman, D. J. (1988)Proc. NaU Acad. Sci. miya, G. (1988)Eur. J. Biochem. 177,241-249 U. S. A. 85,2444-2448 22. Tchang, F., This, P., Stiefel, V., Arondel, V., Morch, M.-D., Pages, M., Puigdomenech, p., Grellet, F., Delwny, M., Bouillon, p., 40. Flinta, c., PerSSOn,B., Jornvall, H., and VOn Heijne, G- (1986) Eur+J. B i o e h e ~164,193-196 . Huet, J.-C., Guerbette, F,, Beauvais- can^, F., Duranton, H., pernollet, J.-C., and Kader, J.-C. (1988)J , fjiol. them. 263, 41. HOPP, T. p.3 and woods, K. R. (1981)proc. Noti. A d . sei. u. S. A. 78,3824-3828 16849-16855 T. E., Glynias, M. J., and Merrick, W. C . (1987)Proc. 23. Young, R. A., and Davis, R. W. (1983)Proc. Natl. Acad. Sci. U. 42. Dever, Natl. Acad. Sci. U. S. A. 84,1814-1818 S. A. 80,1194-1198 43. Moonen, P., Haagsman, H. P., Van Deenen, L. L. M., and Wirtz, 24. Helmkamp, G.M., Jr., Nelemans, S. A., and Wirtz, K.W. A. K. W. A. (1979)Eur. J. Bwchem. 99,439-445 (1976)Biochim. Biophys. Acta 424,168-182 44. Berkhout, T.A., Visser, A. J. W. G., and Wirtz, K. W. A. (1984) 25. Henikoff, S. (1984)Gene (Amst.)28,351-359 Biochemistry 23,1505-1513 (1987) 26. Sanger, F.9 Milken, s., and Coulson, A. R. (1977)prm. Natl. 45. Somerharju, p. J., van Loon, D., and Wirtz, K.W.A. Acad. S C ~U. . S. A. 74,5463-5467 Biochemistry 26,7193-7199 27. Helmkamp, G. M., Jr., Harvey, M. s., Wiaz, K. w. A., and van 46. Van Paridon, P. A., Gadella, T.W. J., Jr., Somerharju, P. J., and Deenen, L. L. M. (1974)J. Bioi. Chem. 249,6~2-6389 Wirtz, K. W. A. (1988)B ~ ~ m i27,6208-6214 s t ~ 28. George, P. Y.,andHelmkamp, G. M.,Jr. (1985)Biochim. Biophys. 47. Van Paridon, P. A., Visser, A. J. W. G., and Wirtz, K. W. A. Acta (1987) 836,176-184 Biochim. Biophys. Acta 898,172-180 29. Wu, J., and Yarbrough, L. R. (1987)Gene (Amst.)61,51-63 48. Van Loon, D., Berkhout, T. A., Demel, R. A., and Wirtz, K. W. 30. Strauss, W. M. (1987)in Current Protocols in ~ o & c u ~ r B i o ~ g y A. (1985)Chem. Phys. Lipids. 38,29-39 (Ausubel, F. M,, Brent, R. M., Kingston, R. E., Moore, D. D., 49. Holm, c., Kirchgessner, T. G., Svenson, K. L., Fredrikson, G., Nilsson, S., Miller, C . G., Shively, J. E., Heinzmann, C., Seidman, J. G., and Struhl, K., eds) Wiley-Interscience, New Sparkes, R. S., Mohandas, T., Lusis, A. J., Belfrage, P., and York Schotz, M. C . (1988)Science 241,1503-1506 31. Southern, E.M. (1975)J. Mol. BioL 98,503-517 32. Feinberg, and Vogelstein, B, (1983)~ ~~ i o~ ~ hl132, e ~. 6. 50, PePhSkY, R. BYTiZmd, R., Mattaliano, R. J-, Sinclak L. K*s Miller, G. T., Browning, J. L., Chow, E. P., Burne, C., Huang, 13 K.-S., Pratt, D., Wachter, L., Hession, C., Frey, A. Z., and 33. Feinberg, A., and Vogelstein, B. (1984)Anal. Biochem. 137,266Wallner, B. P. (1988)J. Biol. Chem. 263,10799-10811 267 51. Kaplan, R., Jaye, M., Burgess, W. H., Schlaepfer, D. D., and 34. Andrews, G. K., Huet, Y. M., Lehman, L. D., and Dey, S. K. Haigler, H. T. (1988)J. BioL Chem. 263,8037-8043 52. Read, R. J., and Funkhouser, J. D. (1983)Biochim. Biophys. Acta (1987)Development 100,463-469 35. Kozak, M. (1986)Cell 44,283-292 762,118-126 36. Proudfoot, N, J., and Brownlee, G. G. (1976)Nature 263, 211- 53. Cowan, N. J., Dobner, P. R., Fuchs, E. V., and Cleveland, D. W. (1989) 214 Mol. Cell. Biol. 3, 1738-1745 A+,