Isolation, identification and molecular characterization of potential probiotic bacterium, Bacillus subtilis PPP 13 from Penaeus monodon Prasenjit Barman1, Amrita Banerjee1, Partha Bandyopadhyay2, Keshab Chandra Mondal1, Pradeep Kumar Das Mohapatra1 1
Department of Microbiology, Vidyasagar University, Midnapore, West Bengal 721102, India; Email:
[email protected] 2 Biostadt India Limited, Poonam Chambers ‘A’ Wing, 6th Floor, Dr. A.B. Road, Worli, Mumbai, Maharashtra 400018, India
ABSTRACT The beneficial effects of probiotics have been attributed to their ability to promote the immunological and nonimmunological defense barrier in the gut, normalization of increased intestinal permeability and altered gut microflora. Twelve different intestinal bacterial colonies were isolated from Black Tiger Shrimp (Penaeus monodon). Among them strain PPP 13 was studied and characterized due to antagonistic properties against three target pathogenic bacterial strains of Vibrio alginolyticus, Vibrio harveyi, Vibrio vulnificus. The strain PPP 13 was identified by morphological, physiological, biochemical characteristics and also by 16S rRNA gene sequence data analysis as Bacillus subtilis. The cultivation time and serum bactericidal activity of nonspecific immunity of Bacillus subtilis PPP 13 were also measured. The antagonistic properties of the experimental strain against target pathogen and the results of serum bactericidal activity of non-specific immunity proved that Bacillus subtilis PPP 13 was a potential probiotic for Penaeus monodon. Keywords: probiotics, antagonistic properties, non-specific immunity, Bacillus subtilis, Penaeus monodon
INTRODUCTION During the past 20 years, aquaculture industry has been growing tremendously, especially that of marine fish, shrimps and bivalves. The UN FAO [Food and Agriculture Organization of the United Nations] estimates that half of the world’s seafood demand will be met by aquaculture in 2020, as wild capture fisheries are overexploited and are in decline. Shrimp [or prawn] culture is widespread throughout the tropical world. It is in an industry set for a period of strongly growing demand, and is currently worth around US$10 billion. Penaeus monodon, the black tiger shrimp, is the most widely cultured species. In the present day diseases have frequently affected shrimp culture all over the world. Pathogenic microorganisms implicated in these outbreaks were viruses, bacteria, rickettsia, mycoplasma, algae, fungi and protozoan parasites. For preventing and controlling from infectious microbial diseases a host of antibiotics, pesticides and other chemicals have been used. But antibiotics kill or stop bacterial growth by interfering with essential housekeeping functions (e.g. DNA, RNA and protein synthesis), hence inevitably imposing selection pressure that results in the emergence of antibiotic-resistant microbial pathogens. The concerns about resistance not only call for better use and administration of conventional antibiotics but also prompt scientists to look for new disease control strategies. Now, researchers are trying to use probiotic bacteria in aquaculture to improve water quality by balancing bacterial population in water and reducing pathogenic bacterial load. The probiotic organisms are act as ‘a live microbial adjunct which has a beneficial effect on the host by modifying Research Article, Biotechnol. Bioinf. Bioeng. 2011, 1(4):473-482 © 2011 Society for Applied Biotechnology. Printed in India; ISSN 2249-9075
474
the host associated or ambient microbial community, by ensuring improved use of the feed or enhancing its nutritional value, by enhancing the host response towards disease, or by improving the quality of its ambient environment’ [1-3]. The beneficial effects of probiotics have been attributed to their ability to promote the immunological and non-immunological defense barrier in the gut, normalization of increased intestinal permeability and altered gut microflora [4]. The benefit to the host may arise as a nutritional effect, whereby the bacteria are able to breakdown toxic or otherwise innutritious components of the diet, which the host can then digest [5]. Alternatively, the probiotic may prevent potential pathogens from colonizing the gut by production of antimicrobial compounds, or by outcompeting them for nutrients or mucosal space [5]. Keeping above points into consideration; the present study was therefore undertaken to identify and characterize the potential probiotic bacterium from Black-Tiger Shrimp (Penaeus monodon).
MATERIALS AND METHODS Collection of sample for probiotic bacteria selection A semi intensive culture pond near Contai Town [Rasulpur] practicing Black Tiger shrimp culture was selected for sample collection. The shrimps were fed with pelleted feed [Avanti Feeds Ltd., Kavur, A.P., India] @ 3% of their body weight daily in four installments. Amount of pelleted feed was adjusted in check tray sampling. Black Tiger [BT] Shrimps were caught by cast net. Shrimps of medium size [27 ± 2 g] were taken for analysis assuming that they might have a well established pattern of intestinal microflora. Shrimps were transferred to water collected from the pond and brought into the laboratory in live condition. Ten samples were examined in this study. Upon reaching the laboratory, analysis of the intestinal microflora was done on samples consisting of excised washed intestines pooled from ten BT each. The intestines were gently excised and cut open with a pair of sterile scissors. Gut content were removed by scrapping, and the intestines were washed three times with sterile saline solution to remove non-adherent microflora. The samples were then homogenized with 10 ml distilled water in Stomacher bags [Stomacher, Lab - Blender 400]. Dilution series were prepared from the homogenates. Bacterial counts were determined by the spread plate method using nutrient agar [Hi-Media] and expressed as CFU [colony forming units]. Plates were incubated at 32 ± 1ºC for 48 hours in BOD incubator.
Identification of the isolates The isolates were characterized up to genus level on the basis of Gram stain, spore stain, motility, oxidase, catalase and grouped into various genera as per Kaneko [6]. Morphology of the different isolates was studied by growing them in different temperatures, salinities, pH, aerobic and anaerobic condition. The ability of the isolates to elaborate various hydrolytic enzymes such as amylase, gelatinase was determined by plate assay. Urea splitting ability was determined by inoculating into Christiansen’s urea agar medium. Isolates in nutrient agar slants were maintained in the laboratory at 4ºC throughout the study period.
Selection of probiotic bacteria Different pathogenic strains from Tryptic Soy Agar [TSA] slant were inoculated into different Tryptic Soy Broth [TSB] and incubated at 30ºC for 20 h for growth. The pathogenic strains were diluted 103 times using sterile Normal Saline Solution [NSS] until the concentration of pathogenic strain reached 106 CFU ml-1. The diluted pathogenic cultures were suspended in T S soft agar [0.7%], which were spread over the Nutrient Agar [NA] plates [8 ml plate-1]. Different intestinal
475 microbial suspension then poured [0.1 µl] on the different pathogenic bacterial spread plates. After incubation at 32ºC over night, the intestinal microbial strain, which produced a clear inhibitory zone against the pathogenic strains with a diameter greater than 1mm was judged to be an antibacterial substance producer or probiotic strain [7].
Estimation of bacterial population The population density of the bacteria was measured as optical density at 620 nm spectrophotometrically in different time duration of cultivation following the method of Prosser and Tough [8].
Identification of isolate on the basis of 16s rRNA profile DNA was isolated using QIAamp DNA Purification Kit [Qiagen, Japan] and electrophoresed in agarose gel. Fragment of 16S rDNA gene was amplified by PCR [Eppendorf] using 16S rDNA specific universal forward and reverse primers, 8F [5'AGAGTTTGATCCTGGCTCAG3'] and 1492R [5'ACGGCTACCTTGTTACGACTT3'] respectively. Amplified PCR product was purified using Qiagen Mini elute gel extraction kit (Qiagen, Japan). A single discrete PCR amplicon band of 1500 bp was observed when resolved on 1.2% agarose gel. A sequence of 840 bp 16S rRNA gene was generated from forward and reverse sequence data. This 840 nucleotide sequence was subjected to nucleotide BLAST with nr [non-redundant] database of NCBI. Ten sequences were selected with 100% and 99% maximum similarity score and aligned along with query sequence using multiple sequence alignment software program ClustalX2. The phylogenetic tree was constructed using Phylp 3.69 software and tree [phylogram] visualization was done by TreeViewX.
Determination of immunity levels Preparation of feed samples The probiotic bacterium isolated from the intestine of the Black Tiger Shrimp were grown in 48 hours at 30ºC in shaken bottles with Nutrient agar medium [Hi-media, India]. The cultures were centrifuged at 5000 rpm at 15 minutes in 4ºC, washed thrice with sterile 1.0% NaCl solution and the pellets resuspended in sterile saline water. The prepared feeds were spread in the sterile trays and the absorption was achieved by spraying the suspended probiotic bacteria in the required amount of the deferent experimental feeds. After spraying, the feed was air dried in a vent hood at the room temperature overnight, and the moisture content as well as bacterial concentration in the feeds [CFU 100g-1] was calculated. Finally the feed was stored in vacuumed heavy-duty plastic containers at 4ºC. Six different experimental diets [BT1 - BT6] with probiotic bacterium were prepared having concentration of 0, 1×102, 1×104, 1×106. 1×108, 1×1010, CFU/ 100g of feed, applied on BT Shrimps in different treatment tanks. 20 BT Shrimps [15 ± 0.5 g each] were used in each treatment tank [1000 lit].
Collection of haemolymph After 10 days of feeding trial, haemolymph was obtained from the ventral part of the haemocoel of the second abdominal segment using a 25 gauche needle and an 1 ml syringe filled with 0.2 ml cold modified Alsever’s solution [AS; 19.3 mM Na citrate, 239.8 mM NaCl, 182.5 mM glucose, 6.2 mM EDTA (ethylene diaminetetra-acetic acid); pH 7.2] as an anticoagulant. The AS prevented
476
melanisation and kept haemocytes in a quiescent state [9], which were preserved at -20ºC for further analysis.
Serum bactericidal activity Aliquots of the sera collected were utilized for studying serum bactericidal activity [10]. Serum samples from each group were pooled into three aliquots. Pooled serum samples were diluted three times with 0.1% gelatin-veronal buffer [GVB2+] [pH 7.5, containing 0.5 mM ml-1 Mg-2 and 0.15 mM ml-1 Ca2+]. The bacterium Vibrio harveyi [live, washed cell used earlier] were suspended in the same buffer to 1× 105 CFU ml-1. The diluted sera and bacteria were mixed at 1:1, incubated for 90 min at 25ºC under shaking condition. The number of viable bacteria was calculated by counting the colonies from the resultant incubated mixture on TSA plates in triplicate [three plates per sample] after 24 h incubation.
Statistical analysis As all the above analysis was carried out on pooled samples of a given lot, standard errors of means were calculated. However, for evaluating the immunological parameters Duncan Multiple Range Test [11] through SPSS package.
RESULTS AND DISCUSSION Isolation and selection of probiotic bacteria from Black Tiger Shrimp Intestinal microflora of Black Tiger shrimp were isolated and studied. Among the isolates 12 morphologically different bacterial colonies were found as predominant organisms. All total of 12 isolates were assayed for their ability to inhibit the growth of three target strains Vibrio alginolyticus, Vibrio harveyi and Vibrio vulnificus (Table 1). It was found that the inhibitory effects of intestinal bacterial isolates were varied with different target strains (2.8 to 9.6 mm diameter). The isolate PPP 13 showed the maximum inhibition [9.6 mm in diameter] against the pathogenic strain Vibrio vulnificus and was selected for further study. In the earlier report it was found that the Bacillus sp. has the ability to inhibit the pathogenic strains [12,13]. The experimental results suggested that this intestinal bacterium with antibacterial properties might inhibit the growth of invading bacteria in the intestine of Black Tiger Shrimp. As in India these three pathogenic bacteria are the prime causative agent for pathogenecity in BT shrimps [14]. The probiotics were effective in inhibiting the shrimp larval pathogens, like Vibrio spp. and V. harveyi both in vitro and in vivo [15]. The antibacterial effects of bacteria are generally due to any of the following factors, either singly or in combination: production of antibiotics, bacteriocines, siderophores, lysozymes or protease and alternation of pH values by the organic acid production [16].
Characterization and molecular identification of probiotic bacterial isolate PPP 13 Morphological characteristics of the bacterial isolate PPP 13 were studied through growth on solid media and staining. The colony was round shaped with entire margin and convex elevation with no pigmentation. The gram nature of the isolate was positive with long rod shape in single arrangement. The isolate was motile, endospore former and did not show fluorescence. Physiological characteristics of the bacterial isolate PPP 13 is presented in table 2. The growth temperature of the isolate was observed in between 22-42ºC. It was also observed that the growth of the isolate was in between pH 5-9 and 2.5-8.5% NaCl concentration. It has also been observed that
477
the strain can also grow anaerobically. Biochemical characteristics of the isolate PPP 13 were represented in table 3. From the table it was found that the isolate was able to produce acid from adonitol, arabinose, dulcitol, fructose, galactose, mannose, sucrose, raffinose and xylose, but unable to ferment cellobiose, lactose and sorbitol. The isolate has the ability to hydrolyze starch, casein, citrate but unable to hydrolyze urea. The isolate PPP 13 was identified by 16S rRNA gene sequence data analysis. The identification of the isolate was confirmed by the Nucleotide Division of National Centre for Biotechnology Information [NCBI], Bethesda, Maryland, USA. A BLAST search of the database indicated a close genetic relationship to other isolates of Bacillus subtilis. The phylogenetic tree was constructed using Phylp 3.69 software and tree [phylogram] visualization was done by TreeViewX (Figure 1). Partial 16S rRNA gene sequence data analysis of strain PPP 13 showed high arrangements between traditional and molecular identification as established by traditional characterization earlier, and the isolate was finally identified as Bacillus subtilis PPP 13. The prokaryotic rRNA genes contain highly conserved sequences. The potential utility of conserved regions to identify or amplify the rRNA gene followed by exploitation of more variable regions of the gene spacers to detect or identify bacteria that may be difficult or even impossible to culture has long been recognized [17,18]. The same method was employed in the study of identification of potential probiotic isolate PPP 13 isolated from P. monodon and also phylogenetic relationship showed that the isolate PPP 13 have maximum similarity with B. subtilis.
Effect of cultivation time The experimental probiotic organism B. subtilis PPP 13 was cultivated in nutrient broth at 30ºC temperature with 120 rpm for 18 hours and represented in figure 2. From this curve it was clear that the Lag phase of this strain was from 0-2 h, Log phase was from 2-12 h and stationary phase is from 12-18 h. From the growth kinetic study observed that B. subtilis PPP 13 showed longer stationary phase. It is known that the organism shows lengthier stationary phage has a capability to work more than the others [8].
Serum bactericidal activity The effects of the potential probiotic B. subtilis PPP 13 on non-specific immunity was observed. Significantly [p ≤ 0.05] highest bactericidal activity [8 ± 0.200] × 103 cfu ml – 1 in BT3 and BT4 treated P. monodon and lowest bactericidal activity [19 ± 0.100] × 103 cfu ml – 1 were recorded in feed BT1 treated P. monodon (Table 4). The results obtained in this study not only support the use of probiotic (B. subtilis PPP 13) for better zone of inhibition but also confirmed to be an important immunostimulant in P. monodon. The activation mechanisms involved are known to be related to the polysaccharide from the cell wall. Similar finding were reviewed by Robertsen [19]. Aerobic gram-positive endospore-forming bacteria i.e. Bacillus sp. have been evaluated as probiotics, with uses including the improvement of water quality by influencing the composition of water born microbial populations and by reducing the number of pathogens in the vicinity of the farmed species [20]. Thus, the bacilli are thought to antagonize potential pathogens in the aquatic environments. This is curious because it is generally accepted that laboratory cultures do not survive well when reintroduced into the natural environments; the cells being often outcompeted/antagonized by the natural microflora [21]. Nevertheless, a direct benefit to the use of the bacilli was the reduction in the use of chemicals in the aquatic environment and in enhanced growth of farmed species [20]. Apart from laboratory preparations of bacteria, some workers have used commercially available products. For example, Queiroz and Boyd [22] and Moriarty [23] used commercial preparations containing Bacillus sp. in catfish and shrimps ponds, respectively. They also used mixed cultures
478
Figure 1. Phylogenetic tree of Bacillus subtilis PPP 13.
479
Figure 2. Effect of cultivation time on the probiotic bacterial isolate PPP 13. Table 1. Inhibitory effects of the isolate PPP 13 of Penaeus monodon on different pathogenic bacterial strains (+ + + : < 3 mm diameter, + + + + : < 4 mm diameter). Strain of the isolate PPP 13
Pathogens Vibrio alginolyticus Vibrio harveyi Vibrio vulnificus
Degree of inhibition +++ +++ ++++
Table 2. Physiological characteristics of the isolate PPP 13. Parameter Growth temperatures (ºC) 4 10 15 22 26 30 37 42 55 65 Growth at pH 5.0 5.7 6.8 8.0 9.0 11.0 Growth on NaCl (%) 2.5 5.0 7.0 8.5 9.0 10.0 Growth under anaerobic condition
Results + + + + + + + + + + + + + + +
480
Table 3. Biochemical characteristics of the isolate PPP 13. Tests Indole test Methyle red test Voges Proskauer test Citrate utilization Gas production from glucose Casein hydrolysis Starch hydrolysis Urea hydrolysis Nitrate reduction Nitrite reduction H2S production Catalase test Oxidation/Fermentation (O/F) Gelatin liquefaction Acid production from carbohydrates Adonitol Arabinose Cellobiose Dulcitol Fructose Galactose Inositol Maltose Mannitol Mannose Melibiose Raffinose Rhamnose Salicin Sorbitol Sucrose Trehelose Xylose Glucose Lactose
Result + + + + + + + + F + + + + + + + + + + + + + + + + + + +
consisting mainly of Bacillus sp. to improve the performance of the rotifer, Branchionus plicatilis in water. Furthermore, Kennedy et al. [24] used Bacillus 48 to enhance the quality and viability of common snook, Centropomus undecimalis [Bloch]. These workers found that Bacillus sp. improved the survival of larvae, increased food absorption by enhancing protease levels and gave better growth. Also the probiotic decreased the number of suspected pathogenic bacteria in the gut. It is noteworthy that Chang and Liu [25] used Bacillus toyoi and Enterococcus faecium SF 68 from commercial products to reduce Edwardsiellosis in European eel, Anguilla anguilla [L.]. An extracellular protease producing bacteria Bacillus circulans was isolated by Ghosh et al. [26] from the gut of Labeo rohita, fingerlings, and used as supplement in the diets. The diet containing 1.5 × 105 Bacillus circulans cells per 100 g showed significantly better growth, immune response.
481
Table 4. Effect of Bacillus subtilis PPP 13 and their interaction on serum bactericidal activity on Penaeus monodon. Bactericidal activity Treatments BT1 19 ± 0.100a BT2 9 ± 0.100b BT3 8 ± 0.200c BT4 8 ± 0.200c BT5 12 ± 0.100d BT6 16 ± 0.100e Measure of mean ± SE of the total bacterial count [×103 cfu ml–1] of each group with three number of serum samples plated in triplicate; figures having different letter (superscripted) in the same row are significantly different [p ≤ 0.05].
After 10 days challenge trial of B. subtilis PPP13 with feed, non-specific immunity was observed where 1×104 and 1×106 CFU/ 100g B. subtilis PPP 13 showed significant activity both in vitro and in vivo. There was a statistically significant [p ≤ 0.05] increase of non-specific immunity observed, thus indicating as a potent immunostimulant in P. monodon. B. subtilis, a good probiotic candidate for black tiger shrimp, P. monodon, may be used as an alternative to antibiotics or chemical agents, and may lead to a more sustainable and safe commercial shrimp culture [27]. However, further investigation should be applied by preparing the feeds with different concentrations of this probiotic bacterium. Bacillus subtilis PPP13 isolated from Black Tiger shrimp have the ability as target pacific and non-specific immunity against shrimp pathogens. Also PPP 13 adhered easily in shrimp gut after supplement with feed. Hence, PPP 13 should be a good possible probiotic candidate for Black tiger shrimp Penaeus monodon. Acknowledgements: The authors are thankful to Mr. D.K. Chopra of Biostadt India Limited, Mumbai, India for financial support.
REFERENCES [1] Fuller R. Probiotics: Prospects of use in opportunistic infections. Fuller R, Heidt PJ, Rusch V, Waaij VD. (eds.), Old Herborn University Seminar Monograph, Herborn-Dill, 1995, 1-7. [2] Otles S, Cagindi O, Akcicek E. Asian Pac. J. Cancer Prev. 2003, 4:369-372. [3] O’Sullivan GC, Kelly P, O’Halloran S, et al. F. Curr. Pharm. Des. 2005, 11:3-10. [4] Bandyopadhyay P, Patra BC. Hydrosphere 2002, 7:100-102. [5] Smoragiewicz W, Bielecka M, Babuchowski A, et al. Can. J. Microbiol. 1993, 39:1089-1095. [6] Kaneko T, Colwell RR. J. Biotech. 1973, 113:24-32. [7] Vignolo GM, Suriani F, Holdago APR, et al. J. Appl. Bacteriol. 1993, 75:344-349. [8] Prosser JI, Tough AJ. Critical Rev. Biotech. 1991, 10:253-274. [9] Rodriguez J, Boulo V, Mialhe E, et al. J. Cell Sci. 1995, 108:1043-1050. [10] Kajita Y, Sakai M, Atsuta S, et al. Fish Pathol. 1990, 25:93-98. [11] Duncan DB. Biometrics 1955, 11:1-42. [12] Ozawa K, Yokota H, Kimura M, et al. Jpn. J. Vet. Sci. 1981, 43:771-775. [13] Powedchagun P, Suzuki H, Rengpipat S, et al. J. Sci. Technol. 2011, 33:1-8. [14] Bandyopadhyay P, Ghorai S. Aqua. Intern. 2005, 13:21-25. [15] Ravi AV, Musthafa KS, Jegathammbal G, et al. Lett. Appl. Microbiol. 2007, 45:219-223. [16] Sugita H, Matsuo N, Shibuya K, et al. J. Mar. Biotechnol. 1996, 4:220-223. [17] Barry T, Powel R, Gannon F. Biotechnol. 1990, 8:233-236.
482
[18] Rodicio MR, Mendoza MC. Enferm Infecc Microbiol Clin. 2004, 22:238-245. [19] Robertsen B, Engstad RE, Jorgensen JB. In: Modulators of fish immune responses. Stolen JS, Fletcher TC (eds), Fair Haven, New Jersey, 1994, 83-99. [20] Wang Q, White BL, Redman RM, et al. Aquaculture 1999, 170:179-194. [21] Austin B, Al-Zahram AMJ. J. Fish. Biol. 1988, 33:1-14. [22] Queiroz JF, Boyd CE. J. World Aquacult. Soc. 1998, 29:67-73. [23] Moriarty DJW. Aquaculture 1998, 164:351-358. [24] Kennedy SB, Tucker JW, Neidig CL, et al. Bull. Mar. Sci. 1998, 62:573-588. [25] Chang CI, Liu WY. J. Fish Disease 2002, 25:311-315. [26] Ghosh K, Sen SK, Ray AK. Bamidgeh. 2003, 55:13-21. [27] Umamaheswari G, Srinivasan M, Ramanathan T. Curr. Res. J. Biol. Sci. 2011, 3:73-77.
