Isolation of Genes Associated with Developmentally Competent ...

BIOLOGY OF REPRODUCTION 71, 1813–1821 (2004) Published online before print 30 July 2004. DOI 10.1095/biolreprod.104.032367

Isolation of Genes Associated with Developmentally Competent Bovine Oocytes and Quantitation of Their Levels During Development1 Martyn Donnison and Peter Lance Pfeffer2 AgResearch Crown Research Institute, Ruakura Campus, Hamilton 2001, New Zealand ABSTRACT We have performed suppressive subtraction hybridization (SSH) of populations of developmentally competent and incompetent bovine oocytes from large ($5-mm) and small (#2-mm) follicles to isolate messenger RNA associated with the attainment of developmental competency. RNA was amplified in a linear fashion and then subjected to the SSH procedure to produce a library enriched for genes associated with competency. One thousand clones of this library were subjected to a differential screening approach to identify 31 potentially upregulated isolates. Sequencing revealed these to represent 21 genes. To rigorously identify the degree of upregulation and reproducibility thereof, we examined the expression of these genes in three separate pools of developmentally competent and incompetent oocytes by quantitative real-time PCR. Results indicated that upregulation varied from zero to threefold, showing that accurate quantification is essential for the interpretation of such differential screening experiments. Furthermore, it appears that the molecular causes for poor developmental capacity may be highly complex and be reliant on many small changes. We further characterized a selection of these novel and known maternally expressed genes for their absolute expression levels during maturation in the presence or absence of an inhibitor of transcription and during preattachment development. Last, the effect of nuclear transfer on the levels of these genes was assayed. Nuclear transfer was found to differentially affect transcript levels of genes expressed after embryonic genome activation but did not prevent the degradation of maternal transcripts or result in activation of maternal genes that are silent at blastocyst stages.

bovine, development, early development, embryo, oocyte, oocyte development, subtractive hybridization, transcription

INTRODUCTION

The concept of developmental competence is generally defined as the ability or potential of an oocyte to undergo maturation, fertilization, and development to blastocyst stages or live offspring (see [1–3] for reviews). Developmental competency is acquired progressively during folliculogenesis. Whereas oocytes from preantral follicles are unable to resume meiosis after arresting in prophase I, those from small antral follicles are competent to progress to metaphase I and those from large antral follicles to metaphase II and beyond [4]. However, oocytes competent to Supported by the New Zealand Foundation for Research, Science, and Technology. Correspondence: Peter L. Pfeffer, AgResearch Crown Research Institute, Ruakura Campus, East Street, Hamilton 2001, New Zealand. FAX: 164 7 8385628; e-mail: [email protected]

1

complete nuclear maturation (meiosis) show differences in their ability to develop up to the blastocyst stage, ascribed to differences in their cytoplasmic maturation status [4]. A clear correlation has emerged between follicular size and developmental potential in cattle [5–10]. The conclusion from these studies is that oocytes from follicles with a diameter smaller than 2–3 mm develop in vitro to the blastocyst stage at much lower rates than do those from follicles greater than 4 or 5 mm. Interestingly, this transition from less to more competent oocytes coincides with the folliclestimulating hormone (FSH)-dependent emergence of a cohort of 3- to 5-mm follicles at the start of a follicular wave [11]. The molecular changes that underlie this increase in competence are unknown. Presumably, these changes involve mRNA and protein synthesis, degradation, and modification so as to endow the oocyte with the necessary molecular stores for driving development from meiotic maturation and fertilization to the timepoint of embryonic genome activation at the 8- to 16-cell stage. The most conclusive evidence that stored oocyte-specific determinants are required for developmental competence has come from two loss-of-function studies in the mouse. Loss of maternal mater [12] or zar-1 [13] transcripts causes the arrest of development at embryonic genome activation stages. Transcription drops markedly once the ovarian follicle has grown to 3 mm [9, 14] and the oocyte remains transcriptionally nearly quiescent thereafter [15]. The shutdown of the bulk of transcription at a follicular size corresponding to the observed difference in competency suggests that oocytes from antral follicles smaller than 3 mm have not yet attained the full RNA complement required for developing past the timepoint when embryonic transcription sets in. One study has examined the feasibility of applying PCRbased subtraction techniques to isolate mRNA associated with oocyte maturation and developmental competency based on follicular size [16]. We describe here a novel approach involving linear amplification followed by suppressive subtraction hybridization (SSH) to identify genes with higher levels of transcripts in competent oocytes. We determined the levels of these transcripts in the competent and noncompetent oocyte using real-time reverse transcription-polymerase chain reaction (RT-PCR). Furthermore, the expression of these genes was characterized during meiotic maturation, preattachment development, and after nuclear transfer.

2

Received: 19 May 2004. First decision: 9 June 2004. Accepted: 22 July 2004. Q 2004 by the Society for the Study of Reproduction, Inc. ISSN: 0006-3363. http://www.biolreprod.org

MATERIALS AND METHODS

Collection of Bovine Oocytes and Embryo Culture Cow ovaries from slaughterhouses were collected and kept at 308C in 0.9% saline for 2–4 h before aspiration. For low-competency oocytes, cumulus-oocyte complexes (COC) were collected by aspiration from follicles with a diameter #2 mm and within 2–3 h of slaughter, whereas for high-competency oocytes, follicles $5 mm and a 3.5- to 4.5-h interval

1813

1814

DONNISON AND PFEFFER

between slaughter and collection were used, as described by Blondin et al. [17]. The size classification procedure was verified to be accurate to within 0.5 mm by prior trials comparing estimated follicle size and dissected measured follicle size. Only COCs with a homogeneous or slightly granulated ooplasm and more than four layers of cumulus cells showing no expansion were kept [7]. Cumulus cells were rigorously removed by mechanical aspiration and several washing steps in HEPES-buffered TCM199. Oocytes were flash frozen in liquid nitrogen and stored at 2808C until RNA extraction. In vitro maturation, fertilization, and culture were performed using the synthetic oviduct fluid system [18]. For a-amanitin-treated matured oocytes, a-amanitin was added at a concentration of 20 mg/ml to all media, including the aspiration medium. This treatment resulted in greater than 70% of oocytes not extruding a polar body [19]. Cumulus cells were stripped from matured oocytes destined for freezing as described above. In vitro-produced embryos for collection were examined microscopically for normal morphology and snap frozen in batches according to their developmental stage. Morula refers to the compacted morula stage, blastocyst to prehatching Day 7 expanded blastocysts.

Generation of Nuclear Transfer Blastocysts Nuclear transfer was performed according to standard procedures using skin fibroblasts derived from two different animals (nos. 1 and 2). In vitro maturation of oocytes derived from 3- to 8-mm follicles was performed as described above. Nuclear transfer was performed as described in detail in [20], with an interval of 3–5 h between activation and fusion. Blastocysts were collected before hatching, at Day 7.

RNA Extraction and Linear Amplification RNA was extracted from 500 oocytes using Trizol reagent (Invitrogen, Auckland, New Zealand) according to the manufacturer’s protocol and resuspended in 10 ml H2O. RNA was treated with 1 U RF-DNAaseI at 378C for 30 min in the presence of 5 mM DTT and 1 ml RNasin (Promega, Madison, WI) in a 20-ml reaction. RNA was phenol/CHCl3 extracted, ethanol precipitated, and redissolved in 10 ml H2O. Linear amplification was performed as described [21], with several modifications: First-strand cDNA was synthesized by mixing in a thin-walled PCR tube 9 ml total RNA with 1 ml 0.1 mg/ml PAGE-purified SP6T19 primer [59-CGGCCAGTGAATTGTACATTTAGGTGACACTATAGAAGTAC(T)19VN-39; italicized is SP6 RNA polymerase promoter] and incubation in a PCR machine with heated lid: 3 min 708C; ramp over 10 min to 48C; 5 min 428C to allow primer annealing. For reverse transcription with template switching, 4 ml first-strand buffer (Invitrogen), 2 ml 0.1 M DTT, 2 ml 10 mM dNTP, 1 ml RNacin, 1 ml TempSw1 primer (0.1 mg; 59-AAGCAGTGGTAACAACGCAGAGTACGCGGG), 2 ml Superscript II (Invitrogen) were added and the reaction incubated at 428C for 90 min. For second-strand synthesis, 106 ml water, 15 ml Advantage PCR buffer, 3 ml 10 mM dNTP, 1 ml RnaseH (Promega), and 3 ml Advantage II polymerase (Clontech, Palo Alto, CA) were added and incubated for 20 min 378C, 3 min 948C, 3 min 658C, and 30 min 758C. The reaction was stopped with 7.5 ml freshly diluted 1 M NaOH, 2 mM EDTA for 10 min at 658C, phenol/CHCl3, then CHCl3 extracted and washed three times with 500 ml of H2O on a Microcon YM-100 column (Millipore, North Ryde, Australia), leaving an elution volume of 10–16 ml. The cDNA was amplified-transcribed using the SP6-Megascript kit (no. 1330; Ambion, Austin, TX) in a double (40-ml) reaction and an incubation time of 5 h at 378C. The RNA was desalted on a Microcon YM-100 column as described above, eluting in a volume no greater than 12 ml. One microliter was electrophoresed on a 1.2% agarose gel with an RNA molecular ladder to estimate quantity and quality. The antisense SP6-transcribed amplified RNA (aRNA) was converted to DNA as follows: 12 ml of aRNA and 1 ml (2 mg) of random hexamers (Roche Diagnostics, Auckland, New Zealand) were incubated for 10 min at 708C, rapidly chilled on ice, and equilibrated at room temperature (218C) for 10 min before addition of 5 ml first-strand buffer (53; Invitrogen), 2 ml 0.1 M DTT, 2 ml 10 mM dNTP, 1 ml RNasin, and 2 ml SuperscriptII, left for 5 min at room temperature, and incubated for 90 min at 428C. For second-strand synthesis, 103 ml H2O, 1 ml 0.5 mg/ml SP6T19 primer, 15 ml Advantage PCR buffer, 3 ml 10 mM dNTP, 1 ml RnaseH, and 3 ml Advantage II polymerase were added and incubated at 378C 20 min, 948C 3 min, 558C 3 min, and 758C 30 min. The reaction was phenol/CHCl3, then CHCl3 extracted, washed on a Microcon YM-100 column as before, and analyzed on an agarose gel.

Suppressive Subtractive Hybridization (SSH) and Differential Screening of Cloned Genes SSH was performed using the amplified DNA and the PCR Select kit starting at the RsaI step (protocol #PT1117-1, p16; Clontech). Briefly, tester DNA corresponding to DNA amplified from high-competency oocytes and driver DNA of low-competency oocytes was digested with RsaI to obtain shorter, blunt-ended molecules. The tester was then divided into two portions and each was ligated with a different adaptor having a common stretch of sequence corresponding to the T7RNA polymerase promoter site at the 59 end. This common stretch is required for the amplification suppression effect of unwanted hybrids during the later PCR steps. The critical ligation step was optimized as suggested in the protocol but using primers specific for bovine GAPDH: sense, 59-TATCATCCCTGC TTCTACTG-39; antisense, 59-CTGTTGAAGTCGCAGGAGAC; using an annealing temperature of 658C, giving a product size of 247 basepairs (bp) on cDNA template or 324 bp when using the sense primer in conjunction with the Clontech PCRprimer1 on adaptor-annealed cDNA. In the first hybridization reaction, following a heat-denaturation step, an excess of driver was annealed to each tester, generating tester-driver hybrids for species common to both populations of DNA. Subsequently, the two primary hybridization products were mixed together without denaturation but with more denatured driver, allowing remaining singlestranded adaptor-ligated testers to form double-stranded hybrids bearing a different adaptor at each end. Upon subsequent PCR amplifications using primers specific for each adaptor, these hybrids are the only ones that could be exponentially amplified under the conditions used. Thirty cycles were run in the first PCR reaction, 12 in the second, nested reaction. Positive controls included in the Clontech kit gave us confidence that the subtraction had worked optimally. However, as SSH can only result in an enrichment of differentially expressed DNA, we assessed all clones by differential screening. The PCR products were cloned into the pGEM-T Easy vector (Promega) using 3 ml SSH PCR product and 3 U T4DNA ligase in a 10-ml reaction overnight at 48C. High-competency TOP10 cells (Invitrogen) were transformed as per manufacturer’s instructions and plated on Luria broth (LB)/ampicillin/ X-gal agar plates. White colonies were picked and grown with shaking in 100 ml LB/ampicillin for 4 h at 378C in 96-well plates. Inserts were PCR amplified using 1 ml of the culture and 19 ml of a PCR mastermix containing primers annealing to the adaptors (NP1 and NP2R; Clontech) with the following conditions: 958C 3 min, then 23 cycles of 958C 10 sec, 688C 3 min followed by 10 min at 728C. Five microliters of PCR product was denatured with 5 ml fresh 0.6 N NaOH and 1 ml spotted on each of four Hybond-N membranes (Amersham Biosciences, Auckland, New Zealand). Membranes were hybridized according to standard protocols to one of four radioactively labeled probes: 1) high-competency oocyte amplified DNA, 2) low-competency oocyte-amplified DNA, 3) PCR product from the primary SSH reaction representing DNA enriched for high-competency material, and 4) PCR representing DNA enriched for low-competency material from a SSH reaction in which the tester and driver were exchanged. Adaptors were removed from the probes by RsaI digestion followed by purification on YM30 columns. Only clones showing significantly higher signals with probes 1 and/or 3 were deemed enriched and used for further analysis. Clones were sequenced and identified by blast searches against public and AgResearch databases.

Real-Time Reverse Transcription Polymerase Quantitation RNA isolation was performed as described above but after addition of 400 ml Trizol reagent and 0.1 pg rabbit a-globin mRNA (R-1253, Sigma, Auckland, New Zealand) per oocyte or embryo was added. RNA was subjected to DNAaseI, purified (described above), and redissolved in 11 ml of water. One microliter was kept as reverse transcription control; the other 10 ml were mixed with 1 ml (500 ng) oligo(dT)12–18 primer (Invitrogen) and 1 ml 10 mM dNTP and incubated at 658C for 5 min, then rapidly chilled on ice. Four microliters of first-strand buffer, 2 ml 0.1 M DTT, and 1 ml RNacin were added, and after 2 min at 428C, 1 ml SuperscriptII (Invitrogen) was added and the reaction incubated for a further hour. The reaction was stopped at 708C for 15 min. Real-time PCR was performed on an ABI 7700 using the Applied Biosystems SYBR-Green PCR master mix (AP 4309155; Applied Biosystems, Auckland, New Zealand) in 15-ml reactions. Where possible, primers were designed spanning putative introns, as determined by sequence comparisons with genomic sequences of the human or mouse homologous gene, using the GCG program Prime. The final concentration of primers was 100 nM and cDNA from about half an embryo equivalent was added per reaction. Samples were run in duplicate or triplicate. Sam-

1815

OOCYTE GENES AND DEVELOPMENTAL COMPETENCY TABLE 1. List of clones generated from differential screening and their identities. Clone 1126 219, 285, 620, 643 768, 943, 1009 1008 712 530, 935 13 296, 386, 1001, 1146 1060 1176 455 1151 843, 917 71 231 410 647 725 854 966 1166

Genea

Accession no.b

Apg3p CMAS CyclinA DjA4-like Dnmt2 eIF-1 Msx1 NDFIP1 Oct4/Pou5F1 SLBP TACC3 TRAPPC3/BET3 WDR26 Znf198 Unknown Unknown Unknown Unknown Unknown Unknown Unknown mosd

TC189704 TC126297 X68321 TC198742 NM181812 TC190365 NM174798 X96487 NM174580 AY630919c TC126322 TC206969 TC210686 TC128347 CB170314 TC193067 CN779660c CN779661c AW656138 TC210194 CN779662c AY630920c

a

Unknown refers to a gene that has orthologs in other species but without annotation; Apg3, autophagy Apg3p/aut1p-like; CMAS, cytidine monophosphate N-acetylneuraminic and synthetase; DjA4, heat shock protein 40, DNAJ-like 4; Dnmt2, DNA methyltransferase 2; NDFIP1, NEDD4 interacting protein 1; SLPB, histone stem-loop binding protein; TACC3, transforming, acidic coiled-coil containing protein; TRAPPC3, trafficking protein particle complex 3; WDR26, WD40 repeat protein 26; Znf198, zinc finger protein 198. b Accession numbers refer to NCBI and TIGR databases. c Sequences submitted to GenBank. d Bovine c-mos was isolated independent of differential screen, using degenerate primers.

ples not exposed to reverse transcriptase (RT2) were included as negative controls to monitor DNA contamination. The PCR conditions were 958C 5 min, then 40 cycles of 958C 15 sec, 568C 30 sec, 728C 30 sec, 788C 10 sec. Readings were taken at 728C and 788C. Subsequent to the PCR, a dissociation curve analysis program was run and representative PCR samples were electrophoresed on agarose-TAE gels to ensure the absence of nonspecific PCR products. Standard curves were established as follows. Gel-purified PCR-derived DNA fragments of all genes analyzed were quantitated fluorometrically with Picogreen (Molecular Probes, Eugene, OR) and copy number per x grams of fragment calculated as (x g)(N mol21)/[(L)(350 g/mol)] where N 5 Avogadro’s constant, L 5 length in bases of DNA fragment (see Table 2). Copy numbers of samples were determined from the standard curves, which ranged from 0.5 to 500 fg, each point in duplicate, correlation coefficient range from 0.983 to 0.998. The copy numbers were normalized for RNA recovery and reverse transcription using the Ct values derived for the a-globin spike: correction factor r for sample x of i samples containing n(x) embryo equivalents 5 relative a-globin copy number per average a-globin copy number measured for all samples on a plate: rx 5 [a[402globin

(Ct)x]/n(x)]/[(1/i) i

O(a

[402globin (Ct)i]/n(i))]

where a, the negative slope in a graph plotting Ct against the log of the relative copy number of a-globin was consistently measured to be 1.8 (Table 2). The Ct (minimal threshold value) of a-globin was always measured for each sample on the same plate as the genes of interest. To minimize artifactual variation, samples to be compared and standard curves were run wherever possible on the same plate using a PCR master mix containing all reaction components apart from the sample.

Statistical Analysis Analysis of variance of the log ratio of the expression levels ($5 mm versus #2 mm) was performed and the significance of each mean analyzed by t-test using pooled standard deviations.

RESULTS

A Novel Subtractive Approach for Limited Starting Material

As a bovine oocyte contains only about 2.4 ng total RNA, of which only 1% represents translatable polyA1 mRNA [22, 23], we pooled RNA from 500 oocytes corTABLE 2. Primer design for genes analyzed by globin mRNA-spiked quantitative real-time RT-PCR. Gene/clone

Apg3p CMAS CyclinA DjA4-like elF-1 Msx1 NDFIP1 Oct4 SLBP TACC3 TRAPPC3 Znf198 410 647 725 854 966 1166 b-actin GDF9 BMP15 Mos Spikeb a b

Primer sequence (59 to 39; forward, reverse) CATTTTCTGACTCTTGTTCCC T, TCTTCCTCTTCCTCCTCCTC GTGGGAAGATGGCGTACTACGA, TGGCTGACGAAGGCTGCAAA GGAGAACGTCAATCCCGAGAA, ATAGCAGCAGTGCCCACAA GCCGATCTACAAATCACCTCT, GCCATTTTTCATTGTGCCAACT CGGAATACGGAGAGGTTATTCA, GTTACTAGCCTACATACCCCA AGGACTCCTCAAACTGCCA, ATCTTCAGCTTCTCCAGCTC AGAGCCTGGAGAACCTGAA, ATCCTCTGAGAAACAGGAGAAA CCAGGACATCAAAGCTCTTCA, AAAACCACACTCGGACCA TTAAACCCAAACCAGCCATC, TCATCCCAAAACCCCCAAC AAAGTCGTTCTCCGACCTTTTCA, AAACCTAGACAGACAGACAGACA GCACCGAGAGCAAGAAAA, TCAAAGGCAGAAGGAGCA TACGGCTTTCCTTTGGCAC, CACTGCTACAAAACCCAGAAC GGAAGAGCCCACAGGAGTAA, ATCCCAGTCAGCGTCGGAAA TGGCACACTACCAATCCTT, GCTTTGTGGACAACGTCATTA ACACTCGCAATAAATAGCCTG, CTCTGCACACTCTGCATATTC GAAAGTGAAGAGGCTGGAGTAA, AGGCAAAAAATGGGCGGA ACTGAGCACTTTTTCCCCC, ACACGCCAGAAATGATATTCC GTCCCTCTGCATAGAATATACTCA, CCCCAGATCATATAGGCAGAA TTCTCCTTGATGTCACGCAC, CGCACCACTGGCATTGTCAT TGCTTCTATATCTGAACGACAC, CCTCCTTACACAACACACAC CCACTGTGGTTTACCGCCATC, CAATCATACCCTCATACTCCT GTACGAGGCCACCTACCA, TGACCACGTCTAGGGAGT GCAGCCACGGTGGCGAGTAT, GTGGGACAGGAGCTTGAAAT

PCR effic refers to the amplification efficiency of the PCR reaction. Spike refers to primers for rabbit a-globin gene; nk, not known.

Size (bp)

Introns

PCR effica

526 660 687 340 284 357 509 428 656 435 608 543 362 241 374 405 575 175 205 703 754 314 256

6 3 3 1 1 1 1 3 2 3 3 2 4 nk nk 1 nk nk 0 0 0 0 2

1.9 1.8 1.6 2.2 2.1 1.7 2.0 1.9 1.8 2.0 1.9 1.9 2.0 2.0 2.0 1.9 2.0 2.0 1.9 1.7 2.0 1.8 1.8

1816


dot blot differential hybridization screening assay to obtain a rapid semiquantitative index of the relative abundance of these clones. The probes used for screening were derived from the two amplified cDNA populations (5 and 2) and from the forward (5-enrich) as well as a reverse (2-enrich) subtraction. We compared relative signal intensities in the duplicate blots by eye, taking into consideration the overall intensities of neighboring signals. An example of such blots is shown in Figure 2. Two types of clones were selected— those showing greater signals with the 5 and 5-enrich probes, representing abundant genes associated with competent oocytes, and those yielding a signal primarily with the 5-enrich probe, representing clones that are not abundant enough in the original 5 probe to allow detection. Our subjective, but stringent, judgment led to the selection of only 31 of the 1000 clones examined, or 3%. These were sequenced and compared against public and private databases to determine their identity and are listed in Table 1. Five genes were found 2–4 times, suggesting that the complexity of the library was approached [24]. Analysis of Genes Enriched in Competent Oocytes FIG. 1. Insert size of clones derived by SSH. Representative 2% agaroseTAE gel of SSH-derived clones after PCR with primers flanking the inserts. Sizes, in base pairs, are indicated on the right.

responding to 10 ng of polyA1 RNA, which was needed to perform an amplification step, as SSH requires at least 500 ng of starting material. We chose to use linear amplification, as this has been shown to introduce minimal bias [21]. However, we designed a SP6 promoter-containing primer for initial reverse transcription and used SP6 RNA polymerase for transcription (see Methods) instead of the published T7 RNA polymerase-based protocols, as we intended to use this material for subsequent SSH. The SSH method [24] employs a primer containing a T7 RNA polymerase promoter site, which would have interfered with T7 polymerase-amplified DNA. We obtained 1.8 and 2.2 mg of amplified DNA from 500 oocytes of #2- and $5-mm follicles, respectively, representing an amplification factor of around 200-fold. One thousand clones from the forward subtraction (noncompetent #2 mm subtracted from competent $5-mm population) were picked and PCR amplified (Fig. 1). More than 95% contained an observable insert. The insert size ranged from 100 to 1000 bp, with a mean of 450 6 25 bp. SSH, similar to other subtraction procedures, will also yield false positives. We therefore subjected our isolated clones to a FIG. 2. Dot blot differential hybridization screening assay. Quadruplicate dot blots of the PCR-amplified inserts of SSH clones were hybridized to probes derived from amplified cDNA of (a) competent oocytes from $5-mm follicles (59), (b) noncompetent oocytes from #2-mm follicles (29), and from (c) the forward (5-enrich), as well as (d) a reverse (2-enrich) subtraction. White arrowheads point to a clone more abundant in 59 as well as 5-enrich compared with 29 and 2-enrich cDNA. The black arrows point to a rare transcript not detectable in the starting population of oocyte cDNA (a, b) but selectively detectable with a probe enriched for competent oocyte cDNA (compare c and d).

Considering that the differential screen is based on the premise that no bias has occurred during linear amplification and/or the subtractive hybridization, we subjected the identified clones to a detailed quantitative analysis using fluorescent (SYBR-green)-based real-time RT-PCR. As the abundance of housekeeping genes often used as internal standards can be misleading, samples were also spiked with a fixed amount of rabbit a-globin RNA per oocyte (or for subsequent studies, per embryo), allowing correction for RNA recoveries and reverse transcription efficiencies. The slopes of nearly all the standard curves were comparable and within 10% of the ideal amplification efficiency of 2.0 (Table 2). Three batches of oocytes from #2-mm and $5mm follicles were split in two, with one half of the oocytes collected for real-time PCR analysis, whereas the other half was scored for development to the blastocyst stage (Fig. 3). The developmental competency varied slightly from batch to batch (Fig. 3A); however, the difference in competency between small and large follicles was always at least threefold. Apart from clone 410, all genes isolated showed greater expression in oocytes from $5-mm follicles, indicating that the method used had been successful (Fig. 3B). Interestingly, few of the genes showed more than a twofold (100%) increase in expression in oocytes that were at least threefold enriched for developmental competency (Fig. 3, A and B). We determined the absolute number of transcripts in the

OOCYTE GENES AND DEVELOPMENTAL COMPETENCY

1817

FIG. 3. Quantitative real-time PCR analysis of transcript levels in three batches of oocytes derived from #2- and $5-mm follicles. A) The competency of half of the three batches of oocytes used for subsequent studies was measured as the percentage developing in vitro to the blastocyst stage. The number of oocytes used are indicated on the bars. Cleavage rates for these batches were (#2; $5) 1, (46%; 76%); 2, (52%; 61%); 3, (46%; 75%). B) The percentage increase or decrease of RNA levels seen in competent relative to noncompetent oocytes for the genes depicted. Stars refer to statistical significance; **, P , 0.01; *, P , 0.05. C, D) The absolute mean levels of transcripts per oocyte assuming a RNA recovery and reverse transcription efficiency of 100%, thus representing a minimal estimate. Error bars indicate SEM.

oocytes of the genes we had isolated to examine whether we had only selected abundantly expressed genes. These estimates of the absolute number of transcripts represent a minimum value, as we have corrected for intersample differences but have not measured absolute RNA recoveries and reverse transcription efficiencies. The abundance as determined crudely by the differential screen correlated well with the levels seen by real-time PCR. The ranges in abundance of messages differed widely (Fig. 3, C and D), ranging from several hundred copies (clone 1166) to around 73 000 copies per embryo (SLBP), thus demonstrating that rare as well as abundant messages had been enriched for. Notably, Cyclin A and NDFIP1, which are expressed at only around 1500 copies per oocyte, were isolated multiple times in the subtractive screen and indeed showed 100% and 75% increased expression in developmentally enriched oocytes. We also examined the differential expression and abundance of three genes not isolated in our differential screen. GDF9 and BMP15 (also known as GDF9B) are two highly related oocyte-specific members of the TGFb superfamily of growth factors that have been implicated in folliculogenesis. Whereas GDF9 mRNA was found to be twice as abundant in oocytes of larger follicles (Fig. 3B), BMP15 transcripts exhibited slightly higher levels in smaller, less competent oocytes. Though GDF9 message was abundant at 55 000 copies per oocyte, BMP15 transcripts were more than 20-fold as abundant. We further isolated bovine c-mos, using degenerate primers, as a candidate gene for differential expression in competent versus noncompetent cells. C-mos was expressed very consistently at a 50% increased level in competent oocytes. Regulation of Maternally Stored Genes During Early Embryogenesis

We further analyzed the expression of four of the known genes showing significant enrichment in competent oocytes

and two randomly selected unknown genes, as well as the growth factors GDF9 and BMP15, and b-actin during in vitro maturation and early embryogenesis (Fig. 4). All maternal transcripts examined, apart from BMP15, are 2- to 11-fold reduced after in vitro maturation, indicating that transcripts are degraded and/or deadenylated, thereby escaping our oligo-dT primed reverse transcription (Figs. 3, B and C, and 4). The differential behavior of GDF9 (11fold decrease) and BMP15 (no change) is noteworthy. We next examined the influence of de novo RNA transcription during this period by inhibiting RNA polymerase II-mediated transcription with a-amanitin, added already upon aspiration of cumulus oocyte complexes. No change in transcript levels was seen in most of the genes. However, for BMP15, severalfold less RNA was detected when transcription was inhibited. In marked contrast, the precipitous drop in GDF9 transcripts during maturation is significantly reduced when transcription is inhibited. Examination of RNA levels during preimplantation stages indicated that, for all genes examined, maternal messages disappeared, reaching background levels by the 12- to 16-cell stage (Fig. 4). After the 12- to 16-cell stage, as embryonic transcription gains momentum, those genes required for further development are transcribed and accumulate always to higher levels in Day 7 blastocysts than in morula stages. The transcription of clones 410 and 725 as well as oocyte growth factors GDF9 and BMP15 is not reactivated, suggesting that the high levels seen in the oocyte reflect a specific function at the oocyte or early cleavage stages. In contrast, Oct4 and NDFIP1 RNA levels are more abundant in the blastocyst than in the MII-stage oocyte (Fig. 4) in spite of the known restriction of Oct4 to inner cell mass tissue. The b-actin profile is also of interest. This gene shows a dramatic rise in transcription between the morula and blastula stages, a result very similar to that seen by others [15].

1818


FIG. 4. Expression profile of selected genes from the MII-stage oocyte to blastocyst and in nuclear transfer-derived blastocyst. Expression levels are means 6 SEM in thousand of copies. MII, Meiosis metaphase II-stage oocytes; 1A, MII oocytes matured in the presence of a-amanitin; 2C and 4C, two- and four-cell embryo; 8C, six- to eight-cell embryos; 16C, 12- to 16cell embryos; M, morula; B, Day 7 blastocyst; NT, nuclear transfer Day 7 blastocyst from animal 1 or 2.

Effect of Nuclear Transfer on Gene Expression at the Blastocyst Stage

We found that those maternal genes that are not reactivated upon embryonic genome activation also remain transcriptionally silent after nuclear transfer (Fig. 4, clones 410 and 725, GDF9, and BMP15). However, the nuclear transfer-derived blastocysts exhibited markedly higher variation in expression. Whereas b-actin and NDFIP1 levels are very similar in the three populations of blastocysts; Oct4, Znf198, and SLBP expression is upregulated two- to fourfold in one or both of the nuclear transfer-derived batches of embryos. DISCUSSION

RNA polymerase) with SSH, thereby avoiding the bias introduced when amplifying small amounts of starting material using PCR-based methods [26]. The success of this method was verified by the observation that 90% of the isolated clones were at least 30% more abundant in three batches of developmentally competent oocytes with one unknown gene showing a greater than 200% enrichment (threefold more abundant). Furthermore, by measuring the absolute copy number per embryo for these genes, we could show that this procedure does not select only abundant messages, as we isolated genes expressed at levels ranging from hundreds to tens of thousands of copies per oocyte.

A New Differential Strategy

Maternal Genes Associated with Developmental Competency

Many studies, including the present one, have highlighted the observation that oocytes derived from bovine antral follicles smaller than 2–3 mm are less likely to develop to the blastocyst stage than those from follicles larger than 3 mm. From the 3-mm follicle stage until embryonic genome activation at the eight-cell stage, oocytes/embryos have been shown by 3H-uridine incorporation to be transcriptionally practically quiescent [9, 14, 15]. This suggests that, if maternal RNA stores contribute to developmental competency, significant qualitative and/or quantitative differences must exist between the RNA of oocytes from follicles larger than 3 mm and that of the small-follicle oocyte. Methods based on subtractive procedures (SSH, differential display) allow the enrichment for such differentially expressed genes and have been applied to populations of bovine oocytes [16] or early cleavage-stage embryos [25] differing in developmental competency. However, the lists of genes derived by such procedures have to be treated with caution, as a more quantitative analysis of three likely candidates of the isolated genes revealed that only one showed an increase (100%) in abundance [25]. Bearing this in mind, we have rigorously tested the expression levels of all the genes isolated in our screen by quantitative real-time PCR. Furthermore, we have developed a new method combining linear amplification (but using SP6 instead of T7

Among the eight known genes for which we found the transcripts to be significantly enriched in competent oocytes are three coding for transcription factors, namely Oct4, Msx1, and Znf198. The homeobox-containing genes Oct4 and Msx1 are not very abundant at less than 2000 copies per oocyte, unlike the zinc-finger containing Znf198 transcripts, which are present at 10 times higher copy number. Loss of function of Oct4 in the mouse leads to preimplantation lethality [27] and mouse Msx1 homozygous mutants die at birth [28], thus precluding studies of the maternal role of these genes. Znf198, containing a zinc-finger DNA binding motif, has not been studied much but was recently found to bind Smad2/3 [29]. These Smads are the nuclear effectors of TFGb and activin signaling. Both TGFb and activin have important roles during folliculogenesis and on nuclear maturation [3], thus suggesting that the accumulation of Znf198 may be of functional significance. Apg3p, NDFIP1, and CMAS are involved in the posttranslational modification of proteins. Though all three were seen to be more abundant in competent oocytes, only NDFIP1 was significantly enriched (P , 0.05). NDFIP1, also known as N4WBP5, binds to the ubiquitin-protein ligase Nedd4, acting as an adaptor to control ubiquitin-dependent protein sorting and trafficking [31, 32]. The enrichment of factors involved in protein modifications is in-

OOCYTE GENES AND DEVELOPMENTAL COMPETENCY

teresting considering that early embryos have to rely on nontranscriptional regulatory mechanisms to control development before embryonic genome activation. Cyclin A2 mRNA, though not very abundant at around 1000 copies/oocyte, was twice as abundant in competent oocytes. In the mouse, maternal cyclin A2 was shown to be required for the regulation of S-phase during the first mitotic cell division [33]. The regulation of the cyclin A2 protein was controlled by selective polyadenylation of the maternal mRNA, in the absence of which DNA replication was arrested at the one-cell stage. If a similar control takes place in cattle, an accumulation of Cyclin A2 RNA would be expected to correlate with an increase in developmental competency. The stem-loop binding protein (SLBP) is a RNA binding protein that plays a central role in the stabilization and translation of mRNAs encoding the replication-dependent histones [34]. SLBP protein has been shown in the mouse to accumulate during oocyte meiotic maturation and via its effect on histone mRNA control the availability of histone proteins necessary for repackaging the sperm chromatin and subsequently the replicated DNA [35]. This increase in protein is dependent on translation of SLBP RNA stored in the oocyte [35]. In this context, the identification of the bovine homologue of histone stem loop binding protein SLBP as being transcriptionally enriched by 75% in developmentally competent oocytes is intriguing. Furthermore, the levels of SLBP RNA in such oocytes are very high, in excess of 70 000 copies. Hence, the accumulation of stored SLBP mRNA may be paramount to achieving developmental competency by allowing the subsequent regulation of histone protein, essential to chromatin remodeling occurring from fertilization stages onward. The present collection of 10 maternally expressed genes (clone 1166, CycA, Dja4, Msx1, NDFIP1, Oct4, SLBP, Trappc, Znf198, and GDF9), which are significantly more abundant in oocytes of large follicles, represents the largest assembly of maternal bovine genes verified to be associated with developmental competency. Yet apart from clone 1166, the changes in expression level tend not to exceed 100% or twofold. How do these changes compare with those of genes known to be required for folliculogenesis or meiotic maturation? C-mos translation and/or activation is required for the suppression of interphase between meiosis I and II and later for the metaphase arrest at meiosis II [36]. We isolated bovine c-mos and showed that, while its RNA is 1.5-fold as abundant in oocytes of larger follicles, this increase was not statistically significant. This correlates with observations that c-mos activity in the mouse is regulated mainly at the level of protein and RNA translation as opposed to transcription [36]. The closely related TGFb growth factors GDF9 and BMP15 are essential for folliculogenesis in the mouse and sheep, respectively [37, 38]. Whereas GDF9 was indeed upregulated in competent oocytes, BMP15 was present at slightly reduced levels, suggesting that some genes do not accumulate in the 2- to 5-mm antral follicle window of development. In line with our results, no differences in BMP15 transcript levels were found in developmentally superior and inferior two-cell embryos [25]. We noticed a remarkable abundance of BMP15 mRNA. BMP15 transcripts were more than 20-fold as abundant as those of GDF9, itself expressed at substantial levels. This is interesting in view of the observation that sheep homozygous for the null mutations in the BMP15 gene do not phenocopy

1819

BMP15 knockout mice but instead resemble GDF9 knockout mice [39]. We suggest that this difference in phenotype may simply be due to a species-specific difference in relative expression levels of these two closely related genes. In conclusion, though this is a small representation of all genes expressed in the oocyte, our results suggest that developmental competency may be a quantitative trait, being dependent on small changes in the RNA levels of many genes. In the future, microarray approaches may yield further insights into this question; however, presently, the dearth of bovine maternal and preattachment cDNAs make such an approach unfeasible. Furthermore, the use of available heterologous cDNA arrays from humans or mice is of limited use, as linearly amplified RNA is biased to 39 sequences, which are not well conserved among different species. Developmental Profile of Maternal Genes Associated with Competency

We analyzed the fate of some of the isolated maternal messages during meiotic maturation and development up to the blastocyst stages. In the mouse, global measurements have indicated that more than half the mRNA is deadenylated (thereby making RNA refractile to oligo-dT-mediated reverse transcription) or degraded during meiotic maturation [40, 41]. Both RNA degradation and deadenylation prevent translation, thus precluding protein synthesis. Similar to the mouse, all the genes we examined, apart from BMP15, exhibited reduced transcript levels/polyadenylation between germinal vesicle-stage (.5-mm follicle-derived) and MII-stage (in vitro-matured) oocytes. The maintenance of BMP15 RNA levels is likely to be due to continued transcription during maturation, as BMP15 RNA levels dropped dramatically (sixfold) when transcription was inhibited during maturation. Seven other genes analyzed were unaffected by the presence of the transcriptional inhibitor a-amanitin in line with the documented transcriptional near quiescence of such oocytes [9, 14]. In contrast, transcriptional inhibition during maturation resulted in threefold higher levels of GDF9 RNA, reflecting either a reduction in RNA degradation and/or an increase in the proportion of GDF9 RNA that is polyadenylated. This effect appears to be specific to GDF9 and may depend on the activity of a factor that is normally actively transcribed during meiotic maturation. We see a decrease of the polyadenylated mRNA of all nine genes analyzed from MII-stage oocytes to the 12- to 16-cell embryo stage. Transcripts are barely detectable by the 12- to 16-cell stage. Oct4, Znf198, NDFIP1, and SLBP are reexpressed at levels that increase from morula to blastula stages. In contrast, GDF9 and BMP15 and the unknown genes, clones 410 and 725, are not reexpressed significantly at morula or blastocyst stages, indicative of oocyte-specific genes. Interestingly, all nine genes examined show the same pattern of degradation during embryogenesis whether their messages are enriched in developmentally competent oocytes (Oct4, Znf198, NDFIP1, SLBP, GDF9) or not (clones 410, 725, and BMP15). We examined the effect of nuclear transfer (NT) on the expression of the characterized oocyte-specific genes as well as on those maternal genes normally reexpressed by the blastocyst-stage embryo. NT embryos derived from the transfer of two different sources of fibroblast donor nuclei did not contain RNA at the blastula stage of the oocytespecific genes GDF9, BMP15, clone 410, and 725. This

1820


indicates, first, that the degradation of maternal RNA stores has occurred normally and, second, that these genes were not reexpressed erroneously after the process of nuclear transfer. Considering that the maternal nucleus has been replaced by a differentiated nucleus, these results suggest that the degradation/poly- and deadenylation events driving the stability of maternal RNAs is controlled by cytoplasmic as opposed to nuclear components. Examining those genes that are normally reexpressed in NT blastulae, we noted excessive Oct4 and SLBP expression in the NT2 and NT1 pools. Upregulation and ectopic trophoblast expression of Oct4 has been noted before in mouse NT embryos [42]. Misregulation of Oct4 is likely to lead to embryonic lethality, as both the levels and location of Oct4 expression are critical for correct embryonic development [27]. In this small set of genes examined, one of five genes shows grossly altered levels (over threefold), yet this is not the same gene in the two NT experiments. This differential behavior in gene expression from nuclear transfer to nuclear transfer experiment probably reflects the incomplete and stochastic nature of reprogramming of the fibroblast donor nuclei upon nuclear transfer [42]. ACKNOWLEDGMENTS We thank Dr. David Wells for the donation of nuclear transfer-derived embryos, Neil Cox for statistical help, and Dr. Jim Peterson for critical reading of the manuscript.

15. 16. 17. 18.

19. 20. 21. 22. 23. 24.

25.

REFERENCES 1. Duranthon V, Renard JP. The developmental competence of mammalian oocytes: a convenient but biologically fuzzy concept. Theriogenology 2001; 55:1277–1289. 2. Sirard MA. Resumption of meiosis: mechanism involved in meiotic progression and its relation with developmental competence. Theriogenology 2001; 55:1241–1254. 3. Trounson A, Anderiesz C, Jones G. Maturation of human oocytes in vitro and their developmental competence. Reproduction 2001; 121: 51–75. 4. Eppig JJ. Coordination of nuclear and cytoplasmic oocyte maturation in eutherian mammals. Reprod Fertil Dev 1996; 8:485–489. 5. Pavlok A, Lucas-Hahn A, Niemann H. Fertilization and developmental competence of bovine oocytes derived from different categories of antral follicles. Mol Reprod Dev 1992; 31:63–67. 6. Lonergan P, Monaghan P, Rizos D, Boland MP, Gordon I. Effect of follicle size on bovine oocyte quality and developmental competence following maturation, fertilization, and culture in vitro. Mol Reprod Dev 1994; 37:48–53. 7. Blondin P, Sirard MA. Oocyte and follicular morphology as determining characteristics for developmental competence in bovine oocytes. Mol Reprod Dev 1995; 41:54–62. 8. Hagemann LJ, Beaumont SE, Berg M, Donnison MJ, Ledgard A, Peterson AJ, Schurmann A, Tervit HR. Development during single IVP of bovine oocytes from dissected follicles: interactive effects of estrous cycle stage, follicle size and atresia. Mol Reprod Dev 1999; 53:451–458. 9. Fair T, Hyttel P, Greve T. Bovine oocyte diameter in relation to maturational competence and transcriptional activity. Mol Reprod Dev 1995; 42:437–442. 10. Yang X, Kubota C, Suzuki H, Taneja M, Bols PE, Presicce GA. Control of oocyte maturation in cows—biological factors. Theriogenology 1998; 49:471–482. 11. Mihm M, Crowe MA, Knight PG, Austin EJ. Follicle wave growth in cattle. Reprod Domest Anim 2002; 37:191–200. 12. Tong ZB, Gold L, Pfeifer KE, Dorward H, Lee E, Bondy CA, Dean J, Nelson LM. Mater, a maternal effect gene required for early embryonic development in mice. Nat Genet 2000; 26:267–268. 13. Wu X, Viveiros MM, Eppig JJ, Bai Y, Fitzpatrick SL, Matzuk MM. Zygote arrest 1 (Zar1) is a novel maternal-effect gene critical for the oocyte-to-embryo transition. Nat Genet 2003; 33:187–191. 14. Crozet N, Kanka J, Motlik J, Fulka J. Nucleolar fine structure and

26. 27.

28. 29. 30. 31.

32.

33.

34.

35.

36. 37.

RNA synthesis in bovine oocytes from antral follicles. Gamete Res 1986; 14:65–73. De Sousa PA, Watson AJ, Schultz GA, Bilodeau-Goeseels S. Oogenetic and zygotic gene expression directing early bovine embryogenesis: a review. Mol Reprod Dev 1998; 51:112–121. Robert C, Barnes FL, Hue I, Sirard MA. Subtractive hybridization used to identify mRNA associated with the maturation of bovine oocytes. Mol Reprod Dev 2000; 57:167–175. Blondin P, Guilbault LA, Sirard MA. The time interval between FSHP administration and slaughter can influence the developmental competence of beef heifer oocytes. Theriogenology 1997; 48:803–813. Thompson JG, McNaughton C, Gasparrini B, McGowan LT, Tervit HR. Effect of inhibitors and uncouplers of oxidative phosphorylation during compaction and blastulation of bovine embryos cultured in vitro. J Reprod Fertil 2000; 118:47–55. de Wit AA, Kruip TA. Bovine cumulus-oocyte-complex-quality is reflected in sensitivity for alpha-amanitin, oocyte-diameter and developmental capacity. Anim Reprod Sci 2001; 65:51–65. Wells DN, Misica PM, Tervit HR. Production of cloned calves following nuclear transfer with cultured adult mural granulosa cells. Biol Reprod 1999; 60:996–1005. Wang E, Miller LD, Ohnmacht GA, Liu ET, Marincola FM. Highfidelity mRNA amplification for gene profiling. Nat Biotechnol 2000; 18:457–459. Bilodeau-Goeseels S, Schultz GA. Changes in ribosomal ribonucleic acid content within in vitro-produced bovine embryos. Biol Reprod 1997; 56:1323–1329. Picton H, Briggs D, Gosden R. The molecular basis of oocyte growth and development. Mol Cell Endocrinol 1998; 145:27–37. Rebrikov DV, Branova OV, Gurskaya NG, Lukyanov KA, Tarabykin VS, Lukyanov SA. Mirror orientation selection (MOS): a method for eliminating false positive clones from libraries generated by suppression subtractive hybridization. Nucleic Acids Res 2000; 28:E90. Fair T, Murphy M, Rizos D, Moss C, Martin F, Boland MP, Lonergan P. Analysis of differential maternal mRNA expression in developmentally competent and incompetent bovine two-cell embryos. Mol Reprod Dev 2004; 67:136–144. Puskas LG, Zvara A, Hackler L Jr, Van Hummelen P. RNA amplification results in reproducible microarray data with slight ratio bias. Biotechniques 2002; 32:1330–1334, 1336, 1338, 1340. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, Scholer H, Smith A. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998; 95:379–391. Satokata I, Maas R. Msx1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat Genet 1994; 6:348–356. Warner DR, Roberts EA, Greene RM, Pisano MM. Identification of novel Smad binding proteins. Biochem Biophys Res Commun 2003; 312:1185–1190. Driancourt MA, Thuel B. Control of oocyte growth and maturation by follicular cells and molecules present in follicular fluid. A review. Reprod Nutr Dev 1998; 38:345–362. Jolliffe CN, Harvey KF, Haines BP, Parasivam G, Kumar S. Identification of multiple proteins expressed in murine embryos as binding partners for the WW domains of the ubiquitin-protein ligase Nedd4. Biochem J 2000; 351(pt 3):557–565. Harvey KF, Shearwin-Whyatt LM, Fotia A, Parton RG, Kumar S. N4WBP5, a potential target for ubiquitination by the Nedd4 family of proteins, is a novel Golgi-associated protein. J Biol Chem 2002; 277:9307–9317. Fuchimoto D, Mizukoshi A, Schultz RM, Sakai S, Aoki F. Posttranscriptional regulation of cyclin A1 and cyclin A2 during mouse oocyte meiotic maturation and preimplantation development. Biol Reprod 2001; 65:986–993. Wang ZF, Whitfield ML, Ingledue TC 3rd, Dominski Z, Marzluff WF. The protein that binds the 39 end of histone mRNA: a novel RNAbinding protein required for histone premRNA processing. Genes Dev 1996; 10:3028–3040. Allard P, Champigny MJ, Skoggard S, Erkmann JA, Whitfield ML, Marzluff WF, Clarke HJ. Stem-loop binding protein accumulates during oocyte maturation and is not cell-cycle-regulated in the early mouse embryo. J Cell Sci 2002; 115:4577–4586. Abrieu A, Doree M, Fisher D. The interplay between cyclin-B-Cdc2 kinase (MPF) and MAP kinase during maturation of oocytes. J Cell Sci 2001; 114:257–267. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM.

OOCYTE GENES AND DEVELOPMENTAL COMPETENCY Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 1996; 383:531–535. 38. Galloway SM, McNatty KP, Cambridge LM, Laitinen MP, Juengel JL, Jokiranta TS, McLaren RJ, Luiro K, Dodds KG, Montgomery GW, Beattie AE, Davis GH, Ritvos O. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat Genet 2000; 25:279–283. 39. Yan C, Wang P, DeMayo J, DeMayo FJ, Elvin JA, Carino C, Prasad SV, Skinner SS, Dunbar BS, Dube JL, Celeste AJ, Matzuk MM. Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol Endocrinol 2001; 15:854–866.

1821

40. Paynton BV, Rempel R, Bachvarova R. Changes in state of adenylation and time course of degradation of maternal mRNAs during oocyte maturation and early embryonic development in the mouse. Dev Biol 1988; 129:304–314. 41. Paynton BV, Bachvarova R, Rempel R. Polyadenylation and deadenylation of maternal mRNAs during oocyte growth and maturation in the mouse. Mol Reprod Dev 1994; 37:172–180. 42. Boiani M, Eckardt S, Scholer HR, McLaughlin KJ. Oct4 distribution and level in mouse clones: consequences for pluripotency. Genes Dev 2002; 16:1209–1219.