Isolation of New Symbiodinium Strains from Tridacnid Giant Clam ...

Mar. Biotechnol. 6, 378–385, 2004 DOI: 10.1007/s10126-004-1800-7

2004 Springer-Verlag New York, LLC

Isolation of New Symbiodinium Strains from Tridacnid Giant Clam (Tridacna crocea) and Sea Slug (Pteraeolidia ianthina) Using Culture Medium Containing Giant Clam Tissue Homogenate Masaharu Ishikura,1 Kiyoshi Hagiwara,1,4 Kiyotaka Takishita,1 Miyuki Haga,1 Kenji Iwai,2 and Tadashi Maruyama1,3 1

Marine Biotechnology Institute, Heita 3-75-1, Kamaishi, Iwate 026-0001, Japan Fisheries Experiment Station, Yaeyama Branch of Okinawa Prefectural Government Laboratory, Kabira 828-2, Ishigakishi, Okinawa 907-0453, Japan 3 Japan Agency for Marine Earth Science and Technology, Marine Ecosystem Research Department, Natsushima 2-15, Yokosuka, Kauagawa 237-0061, Japan 4 Yokosuka City Museum, Yokosuka, Kanagawa 238-0016, Japan 2

Abstract: Recent molecular biological studies have revealed that some photosymbiotic invertebrates dwelling in coral reefs host several genetically different dinoflagellates, Symbiodinium species, as symbionts. However, little is known about the difference in physiologic characteristics among these symbionts living in a single host, because some Symbiodinium strains are difficult to culture in vitro. To isolate some of these Symbiodinium strains, we have developed an agar culture medium plate containing antibiotics and a giant clam tissue homogenate. Using-this medium we isolated two new Symbiodinium strains from two molluscan hosts, Tridacna crocea and Pteraeolidia ianthina, each of which hosted two different Symbiodinium strains belonging to Symbiodinium C and D, respectively. The tissue homogenate was essential for the growth of Symbiodinium D. Although it was not essential for the growth of Symbiodinium C, it did stimulate the initial growth. For the isolation of some Symbiodinium strains, isolation medium containing host homogenate is effective. Key words: host tissue homogenate, isolation, Symbiodinium, symbiosis, zooxanthellae.

INTRODUCTION Most of the symbiotic dinoflagellates (commonly called zooxanthellae) found in many coral-reef-dwelling photosymbiotic invertebrates belong to the genus Symbiodinium.

Received May 16, 2003; accepted December 1, 2003; online publication June 23, 2004. Corresponding author: Tadashi Maruyama; e-mail: [email protected]

Recent molecular analyses have revealed that the Symbiodinium community in these hosts contains many genetically different members, Symbiodinium A to G (Rowan and Powers, 1991b; Baillie et al., 2000; LaJeunesse 2001; Pawlowski et al., 2001; Pochon et al., 2001 Santos et al., 2001;). The diversity of these Symbiodinium symbionts can be seen not only in different host species but also in one colony of coral (Rowan and Knowlton, 1995; Rowan et al., 1997; Baker, 2001; Toller et al., 2001; LaJeunesse, 2002; Santos et al., 2002) and in one giant

Isolation of Symbiodinium Strains

clam individual (Carlos, et al., 2000; Baillie et al., 2000). The Symbiodinium communities of coral colonies composed of different Symbiodinium strains have been shown to change (Rowan et al., 1997; Baker, 2001; Toller et al., 2001), indicating that phylogenetically different Symbiodinium strains have different sensitivities to environmental change. However, little is known about the difference in physiologic characteristics of Symbiodinium strains isolated from the same host, because some of them are difficult to culture. One individual tridacnid giant clam contains Symbiodinium A, C, and other strains (Rowan, 1998; Baillie et al., 2000; Carlos et al., 2000). However, only cultures of Symbiodinium A strains have been established from the tridacnid giant clam Tridacna crocea (Rowan, 1998; Carlos et al., 1999). Although many cultures of Symbiodinium strains have been established (Schoenberg and Trench, 1980; Carlos et al., 1999, Banaszak et al., 2000; Santos et al., 2001), many Symbiodinium strains, especially those from a heterogeneous Symbiodinium community in the same host species, remain to be cultured (Rowan, 1998; Carlos et al., 2000; Santos et al., 2001). We have developed a novel culture medium containing a giant clam tissue homogenate to isolate Symbiodinium strains from the giant clam and other invertebrates. We used this medium to isolate a Symbiodinium C strain from the giant clam Tridacna crocea and a Symbiodinium D strain from the sea slug Pteraeolidia ianthina.

MATERIALS AND METHODS Host Animals Tridacna crocea (2–3 cm), which had been maricultured by the Fisheries Experiment Station of Okinawa Prefectural Government, was transported to Marine Biotechnology Institute (MBI) in Kamaishi and maintained at 25C in an aquarium with running seawater. Light was provided by cool-white fluorescent lamps (approx. 25 to 40 lE m)2 s)1) with a 14:10-hour light–dark cycle. In January 2001 Pteraeolidia ianthina was collected from Hayama Bay off Kanagawa, Japan and maintained in an aquarium in MBI under similar conditions.

DNA Extraction from Symbiodinium Living in the Host Animal The host tissue was disrupted in 400 ll of an AP 1 buffer (Qiagen) with 4 ll of RNase A (100 mg/ll) and about

379

200 ll of 800-lm glass beads in a 2-ml tube by a 3110BX mini-bead beater (Biospec Products) at 5000 rpm for 5 minutes. DNA was extracted from this suspension with a DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions.

Analysis by Denaturing Gradient Gel Electrophoresis The 18S rDNA fragment of Symbiodinium in the host tissue was amplified by polymerase chain reaction (PCR) with the Symbiodinim-specific primer set, zx8 and zPV2R2 (Table 1; Carlos et al., 2000). The DNA was amplified by the AmpliTaq Gold Kit (Applied Biosystems) with the following thermal program: 94C for 12 minutes; 30 cycles of 94C for 30 seconds, 50C for 30 seconds and 72C for 2 minutes; then 72C for 15 minutes. The PCR products were run on 2.0% agarose gel to examine their size (about 370 bp). Denaturing gradient gel electrophoresis (DGGE) was performed with a Dcode TM Universal Mutation Detection System with 16 · 16-cm gel (Bio-Rad). The PCR products were resolved on 6% acrylamide gel (acrylamide–bis, 37.5:1) with a 20% to 40% denaturing gradient (the 100% denaturing solution contained 7 M urea and 40% v/v formamide). The gels were run at 62C and 200 V for 2 hours. After electrophoresis the gel was stained with SYBR Green II according to the manufacturer’s instructions (Molecular Probes). A gel slice containing a DNA band was cut out from the gel and put into a 2-ml plastic tube with a TE buffer (10 mM Tris and 1 mM EDTA at pH 8.0; 150 ll), before being incubated at 30C for 24 hours. The eluted DNA was precipitated with 2.5 times the volume of 99.5% ethanol after adding one tenth the volume of 3 M sodium acetate, washed with 70% ethanol, dried in a vacuum centrifuge, and dissolved in 20 ll of the TE buffer. The purified DNA fragment from the DGGE gel was reamplified with the same primer set under the same PCR conditions. The PCR products were sequenced in both the forward and reverse directions by using the zx8 and zPV2R2 primers (Table 1; Carlos et al., 2000). The amplified DNA fragments were purified with SUPRECTM02 (TaKaRa), before cycle sequencing was performed with an ABI Prism Big Dye Terminator Cycle Sequence Ready Reaction Kit (PE Applied Biosystems) by using the protocol supplied by the manufacturer. The sequencing reaction products were analyzed with an ABI Prism 3700 DNA sequencer (Applied Biosystems).

380 Masaharu Ishikura et al.

Table 1. Primers for PCR of 18S rDNA and ITS Primer

Sequence from 5¢ to 3¢

Target gene

zx8 (forward) zPV2R2 Zpv2R (reverse)

GTCTCAAAGATTAAGCCATG

18S rRNA 18S rRNA 18S rRNA

ss5 (forward) ss3 (reverse) zITSf (forward) ITS4 (reverse) zx14 (forward) zx12 (forward) zx18 (forward) zx19 (forward) zx10 (reverse) zx13 (reverse) zx16 (reverse) zxl7 (reverse)

GGTTGATCCTGCCAGTAGTCATATGCTTG

CTCCGTTACCCGTCATTGCC CC GCCCGCCGCGCGCGG CGGGCGGGGCG GCCACGGGGGGCTCCGTTACCCGTCATTGCC

GATCCTTCCGCAGGTTCACCTACGGAAACC CCGGTGAATTATTCGGACTGACGCAGT TVVTCCGCTTATTGATATGC CAGGGCATCCATGTCTTGTG GATAGGGATAGTTGGGGGCA CACGGGGAAACTTACCAGGT GCATCGTGATGGGGATAGAT ATATACGCTATTGGAGCTGG GTGCAGCCCAGGACATCTAA CCAAGAATTTCACCTCTGAC CTCCACTCCTGGTGGTGCCC

Preparation of the Culture Media with a Giant Clam Mantle Homogenate Mantles of T. crocea and Hippopus hippopus were respectively dissected, cut into pieces with scissors, and homogenized with a Polytron-type homogenizer (Ystral) for 1 minute at 60 V in 10 to 20 ml of filtered (0.22-lm pore size) artificial seawater (Wako Chemical Co.). To remove the tissue debris, the homogenate was centrifuged at 11,000 g for 10 minutes. The supernatant was added to f/2 medium (Guillard and Ryther 1962) at a soluble-protein concentration of 10 lg/ml. Antibiotics (40 mg/L of ampicillin and 30 mg/L of kanamycin) were added to the medium before it was sterilized by passing it through a 0.22-lm membrane filter (GSWP04700, Millipore). The resulting medium containing the T. crocea homogenate is referred to as the Tf/2A medium and that containing the H. hippopus homogenate as the Hf/2A medium.

Isolation of Symbiodinium Strains The tissue containing symbionts was dissected out from the host invertebrate. After washing with filtered sterilized seawater (FSW) through a 0.22-lm membrane filter (GSWP04700, Millipore), the tissue was cut into smaller pieces in 1 ml of FSW with antibiotics (FSWA; 40 mg/L of ampicillin and 30 mg/L. of kanamycin). The symbiont

18S rRNA 18S rRNA ITS ITS 18S rRNA 18S rRNA 18S rRNA 18S rRNA 18S rRNA 18S rRNA 18S rRNA 18S rRNA

was washed with FSWA, harvested by centrifugation (1500 · g for 5 minutes), resuspended in approximately 1 ml of FSW, and inoculated on 1% agar plates containing the Tf/2A or Hf/2A medium. In addition, a single cell of the symbiont was taken by a glass capillary and inoculated into IMK liquid medium (Wako Chemical Co.). After 6 months of incubation at 25C, a single colony of the symbiont appearing on the agar plate was taken out and inoculated into the liquid Tf/2A or Hf/2A medium.

Culture of Symbiodinium Strains The isolated Symbiodinium strains OTcH-1 and HPiH-1 were maintained in an IMK liquid medium under coolwhite fluorescent light (approx. 80 lEm)2 s)1) with a 14:10-hour light–dark cycle at 25C. Strains OTcH-2 and HPiH-2 were grown in either the Tf/2A or Hf/2A liquid medium under the same conditions.

Extraction of DNA from Symbiodinium Strain and Amplification of 18S rDNA and ITS DNA of a Symbiodinium strain was extracted with a DNeasy Plant Mini Kit (Qiagen) as described for DNA extraction from Symbiodinium in the host. The approxi-


mately 1790-bp DNA fragment of the 18S rRNA gene was amplified with the ss5 (forward) and ss3 (reverse) primer set (Table 1; Rowan and Powers, 1991a) of which corresponding sequences were respectively located 4 nucleotides from the 5¢ and 3¢ ends of the 18S rDNA gene sequence of the dinoflagellate Prorocentrummicans(Herzog and Maroteaux, 1986). The DNA was amplified with an Ampli Taq Gold Kit with the following thermal program: 94C for 12 minutes 30 cycles of 94C for 30 seconds, 50C for 30 seconds, and 72C for 2 minutes and 72C for 15 minutes. The internal transcribed sequence (ITS) fragment of the Symbiodinium strain was amplified by the zITSf (forward) and ITS4 (reverse) primer set (Hunter et al., 1997) with the following thermal program: 95C for 10 minutes, 45 cycles of 94C for 30 seconds, 51C for 45 seconds and 72 C for 2 minutes and 72C for 15 minutes. The PCR products were run on 0.8% agarose gel to examine their sizes (about 1790 bp for 18S rDNA and 720 to 770 bp for ITS).

381

Figure 1. Phylogenetic positions of Symbiodinium strains from Tridacna crocea and Pteraeolidia ianthina determined by 18S rDNA fragment NJ analysis. (Numbers at nodes indicate bootstrap percentages of NJ and MP from 1000 replicates; only bootstrap percentages greater than 60% are shown). Strains established in this study are given in boldface.

Sequencing of DNA and Phylogenetic Analysis of the Isolated Symbiodinium Strains

Effect of Host Tissue Homogenate on Growth of Isolated Symbiodinium Strains

The PCR products from the Symbiodinium strains were sequenced in the manner described for the DGGE analysis by using sequencing primers corresponding to the conserved regions in 18S rDNA or those used in the PCR procedure for the ITS fragment. The DNA sequences were aligned with CLUSTAL X Version 1.81 (Thompson et al., 1997) and then manually edited by eye. The alignment data are available on request from the corresponding author. The corresponding sequences reported for Symbiodinium strains in the GenBank database are included in the analysis. The data sets of 18S rDNA and ITS were subjected to analysis by the neighbor-joining (NJ) and maximum parsimony (MP) methods. Support for the clades was tested by bootstrap analysis (Felsenstein, 1985) of 1000 replicates. The NJ tree was constructed by using Kimura’s 2-parameter model (Kimura, 1980). The MP tree was based on the tree-bisectionreconnection (TBR) branch-swapping algorithm with stepwise addition (the closest option) of taxa under the heuristic search method. A bootstrap analysis of 1000 replicates was conducted by the heuristic search method to assess the confidence of branches in the MP tree. PAUP* Version 4.0 was used for all of the phylogenetic analyses.

Cells of the Symbiodinium strain from an axenic culture that had been harvested by centrifugation at l500g for 3 minutes were washed twice with FSW containing antibiotics (40 mg/L of ampicillin and 30 mg/L kanamycin). The washed cells were resuspended in FSW and inoculated into a 24-well dish containing Tf/2A or Hf/2A at a cell density of 2.1 to 3.8 · 104 /ml. After 14, 28 and 58 days of incubation at 25C under cool-white fluorescent light (approx. 80 lEm)2 s)1) with a 14: 10-hour light–dark cycle, the cells were harvested and fixed with 4% formaldehyde in FSW. The cell density was determined by using an improved Neubauer-type hemocytometer counting chamber (Hausser Scientific Company) with at least 10 replicates.

RESULTS Phylogeny of Isolated Symbiodinium Strains A DGGE analysis of the Symbiodinium symbionts of Tridacna crocea and Pteraeolidia ianthina indicated the presence of more than one Symbiodinium strain in each host. The sequences of partial Symbiodinium 18S rDNA (about


Figure 2. Phylogenetic positions of Symbiodinium strains by ITS fragment NJ analysis A: Phytogeny of Symbiodinium A. Clade A2, S. pilosum (AF333506), is designated as the outgroup based on (LaJeunesse 2001). B: Phylogeny of Symbiodinium C and F. Symbiodinium F is designated as the outgroup. C: Phylogeny of Symbiodinium D. Symbiodinium sp. (AF396631) is used as the outgroup. (Numbers at nodes indicate bootstrap percentages of NJ and MP from 1000 replicates; only bootstrap percentages greater than 60% are shown). Strains established in this study are given in boldface.

370 bp) directly amplified from the DNA of Symbiodinium in T. crocea indicated the presence of two types of Symbiodinium, A and C. Likewise, two amplified DNA sequences of Symbiodinium cells directly isolated from P. ianthina belonged to Symbiodinium A and D. No other type of DNA sequence was detected in either of these Symbiodinium communities. The sequence analysis of more than 10 Symbiodinium strains, which had been isolated with IMK liquid medium from T. crocea and P. ianthina, indicated that they all belonged to Symbiodinium A (data not shown). Both Symbiodinium A and C however, were cultured and isolated

from T. crocea when f/2 agar medium containing the T. crocea homogenate (Tf/2A) was used. Symbiodinium A and D strains were cultivated and isolated from P. ianthina by using f/2 agar medium containing the H. hippopus homogenate (Hf/2A). The Symbiodinium A and C strains isolated from T. crocea were named OTcH-1 and OTcH-2, respectively. Similarly the Symbiodinium A and D strains obtained from P. ianthina were named HPiH-1 and HPiH2, respectively. Phylogenetic analysis by 18S rDNA showed that OTcH-1 and HPiH-1 formed a clade with the other Symbiodinium A strains (Figure 1). Their ITS sequences revealed that OTcH-1 and HPiH-1 belonged to clade A3 and clade Al, respectively (Figure 2 A; LaJeunesse, 2001). In the phylogenetic tree of 18S rDNA, OTcH-2 formed a clade with cloned DNA of Symbiodinium C that had been isolated from symbiotic bivalves (Fragum fragum, AB016580; T. gigas, AB016595). The ITS sequence of OTcH-2 is identical with that of the Symbiodinium strain belonging to C2 (Figure 2 B; LaJeunesse, 2001). In the 18S rDNA phylogenetic tree, HPiH-2 formed a clade with DNA clone E0-1 of Symbiodinium D that had been amplified from the coral Montastraea faveolata (Figure 1; Toller et al., 2001). Its ITS sequence did not show significant similarity with any known Symbiodinium D ITS sequences (Figure 2 C). The partial sequences of 18S DNA (about 370 bp) of Symbiodinium A and C, which had been detected in DNA of the T. crocea symbionts by DGGE, were respectively identical with those of the corresponding portion of the 18S rDNA sequences (about 1730 bp) of established Symbiodinium strains OTcH-1 and OTcH-2. The 18S rDNA fragment sequences of Symbiodinium A and D found in the DGGE analysis of P. ianthina were respectively the same as those of established Symbiodinium strains HPiH-1 and HPiH-2.

Effect of Giant Clam Tissue Homogenate on Growth of the Symbiodinium Strains Because the Symbiodinium C and D strains OTcH-1 and HPiH-2 were cultured and isolated only with the agar media containing the giant clam tissue homogenates, we studied the effect of the homogenates on their growth. Irrespective of the host (Tridacna crocea or Pteraeolidia ianthina), the Symbiodinium A strains (OTcH-1 and HPiH1) grew faster than Symbiodinium C (OTcH-2) and Symbiodinium D (HPiH-2) strains in all the media examined (Figure 3). After 28 days of incubation in the f/2 and IMK


383

Figure 3. Effect of giant clam tissue homogenate on growth of different Symbiodinium strains. A: OTcH-1 (Symbiodinium A), B: OTcH-2 (Symbiodinium C), C: HPiH-1 (Symbiodinium A), D: HPiH-2 (Symbiodinium D). Symbiodinium strains shown in A and B were isolated from Tridacna crocea, and those shown in C and D were isolated from Pteraeolidia ianthina. Culture media were IMK (d), f/2 (m), Tf/2A (f/2 containing the T. crocea homogenate) (j), and Hf/2A (f/2 containing the H. hippopus homogenate) (¤). Error bar, standard deviation.

media, the growth of the Symbiodinium A strains reached the stationary phases; their growth was better in IMK medium than in f/2 medium (Figures 3 A and C) Although these Symbiodinium C strain OTcH-2 could not be isolated with IMK liquid medium without the giant clam tissue homogenate, after a long lag phase it grew slowly in the absence of the tissue homogenate (Figure 3 B). It continued to grow even after 58 days in all the media examined. In the initial phase of cultivation (0 to 28 days), the Tridacna tissue homogenate stimulated the growth of OTcH-2, while the effect of Hippopus tissue homogenate was significantly weaker (t test at 14 days P < 0.01; 28 days P < 0.01). The Symbiodinium D strain HPiH-2 scarcely grew in the medium without the giant clam homogenate. In the f/2 medium without giant clam tissue homogenate, the cell density increased slightly and reached the maximum, which was only 1.4-fold the initial density. In the media containing the homogenate, HPiH-2 grew significantly better in the Hf/2A than in Tf/2A (at 58 days P < 0.01). After 28 days of incubation in Hf/2A, the cell density reached the stationary phase (the cell density was 24 times higher than that of the initial density). All 4 strains, OTcH-l, OTcH-2,

HPiH-1 and HPiH-2, grew better in IMK medium than in f/2 medium.

DISCUSSION The Symbiodinium community in T. crocea is composed of two phylogenetically distinct strains that belong to A and C as reported previously (Rowan, 1998; Baillie et al., 2000; Carlos et al., 2000). Pteraeolidia ianthina also hosted two phylogenetically distinct Symbiodinium A and D strains. It has been reported that Symbiodinium C of tridacnid giant clams was uncultivable in liquid culture media such as f/2 (Baillie et al., 2000), ESM (Carlos et al., 1999), and K (Carlos et al., 2000). Rowan (1998) also reported, even though he did not mention the culture medium, that among Symbiodinium A and C detected in T. crocea, only Symbiodinium A was cultivable. In this study we used agar plate medium with antibiotics to isolate axenic Symbiodinium strain. Axenic culture was necessary for the study of the effects of giant clam tissue homogenate to suppress bacterial contamination. Santos et al. (2001) reported that among the heterogeneous Symbiodinium populations in


hospite, only a subset of Symbiodinium symbionts were selectively grown in culture media used for isolation. In IMK medium without giant clam tissue homogenate, only Symbiodinium A strains could be cultured and isolated from T. crocea and P. ianthina. Symbiodinium C from T. crocea (OTcH-2) and Symbiodinium D from P. ianthina (HPiH-2) formed colonies on Tf/2A and Hf/2A agar media, respectively. These results suggest that the giant clam homogenates contained a substance or substances necessary for the growth of these Symbiodinium strains. Although OTcH-2 grew slowly in the liquid IMK and f/ 2 media without giant tissue homogenate, T. crocea tissue homogenate enhanced its initial growth significantly (Figure 3 B). The same concentration of T. crocea tissue homogenate showed less significant effect on HPiH-2 (Figure 3 D). These results indicate that the T. crocea homogenate contained substances that shortened the lag phase of growth of Symbiodinium C (OTcH-2), and that it was more effective for OTcH-2 than for HPiH-2. The same concentration of H. hippopus tissue homogenate was more stimulating to the growth of HPiH-2 than to that of OTcH2. The effective components (growth-stimulating substances) in these giant clam homogenates may be different. The H. hippopus mantle homogenate stimulated growth of HPiH-2 to a level comparable to that of HPiH-1 or OTcH1 in the f/2 or IMK medium (Figure 3 C and D). These results suggest that the P. ianthina tissue contained growth stimulating substances similar to those in H. hippopus homogenate. The slight growth of HPiH-2 in the media without the homogenate may be explained by a residue of the growth stimulation substances in the HPiH-2 cells. Webster et al. (2001) have reported a novel culture medium in which sponge extract was added for isolation of sponge-associated bacteria. The medium containing sponge extract increased the number of novel bacteria that were isolated. This and our present results indicate that addition of host tissue homogenate is effective for cultivation of symbiotic bacteria and symbiotic algae in various invertebrate-bacteria and invertebrate microalgae symbioses. Reported that Symbiodinium C was dominant in T. crocea individuals (Baillie et al., 2000 Carlos et al., 2000;) are in contrast to the slow growth rate of OTcH-2 (Symbiodinium C) we found in the culture media (Figure 3 A and B). Our results suggest that cell densities of phylogenetically different Symbiodinium populations within the host may be regulated by growth-stimulating substances in the host tissue. In contrast to the clear positive effect of the giant clam homogenate on growth in OTcH-2 and HpiH-2,

no significant effect was apparent in OTcH-1 and HPiH-1 (Symbiodinium A). IMK culture medium contained all nutrients required for growth of OTcH-1 and HPiH-1. Symbiodinium A strains OTcH-1 and HPiH-1 did not require those growth -stimulating substances in the giant clam tissue homogenates (Figure 3 A and C). The growth-stimulating activities of the two giant clam tissue homogenates were not affected by a heat treatment at 96C for 10 minutes. A preliminary experiment using ultrafiltration showed that the activity was found in the fraction of molecular weight less than 500 (data not shown). These indicate that the active substances were lowmolecular-weight, heat-stable compounds. The chemical nature and identification of these growth-stimulating substances for Symbiodinium strains remain to be studied.

ACKNOWLEDGMENTS Prof. S. Miyachi is acknowledged for his valuable comments on the manuscript. This work was performed as a part of The Industrial Science and Technology Project for Technological Development of Biological Resources in Bioconsortia supported by New Energy and Industrial Technology Development Organization (NEDO).

REFERENCES Baillie, B.K., Belda-Baillie, C.A., and Maruyama, T. (2000). Conspecificity and Indo-Pacific distribution of Symbiodinium genotypes (Dinophyceae) from giant clams. J Phycol 36:1153–1161. Baker, A. (2001). Reef corals bleach to survive change. Nature 411:765–766. Banaszak, A.T., LaJeunesse, T.C., and Trench, R.K. (2000). The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates. J Exp Mar Bio Ecol 294:219–233. Carlos, A.A., Baillie, B.K., Kawauchi, M., and Maruyama, T. (1999). Phylogenetic position of Symbiodinium (Dinophyceae) isolated from tridacnids (Bivalvia), cardiids (Bivalvia), a sponge (Porifera), a soft coral (Anthozoa), and a free-living strain. J Phycol 35:1054–1062. Carlos, A., Baillie, B.K., and Maruyama, T. (2000). Diversity of dinoflagellate symbionts (zooxanthellae) in a host individual. Mar Ecol Prog Ser 195:93–100. Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791.


385

Guillard, R.R., and Ryther, J.H. (1962). Studies of marine planktonic diatoms, I: Cycotella nana hustedl, and Detonula confervacea (cleve) gran. Can J Microbiol 8:229–239.

Rowan, R., and Powers, D.A. (1991b). A molecular genetic classification of zooxanthellae and evolution of animal-algal symbioses. Science 251:1348–1351.

Herzog, M., and Maroteaux, L. (1986). Dinoflagellate 17S rRNA sequence inferred from the gene sequence: evolutionary implications. Proc Natl Acad Sci U S A 83:8644–8648.

Rowan, R., and Powers, D.A. (1992). Ribosomal RNA sequences and the diversity of symbiotic dinoflagellates (zooxanthellae). Proc Natl Acad Sci U S A 89:3639–3643.

Hunter, C.L., Morden, C.W., and Smith, C.M. (1997). The utility of ITS sequences in assessing relationships among zooxanthellae and corals. Proc Int Coral Reef Symp 2:1599–1602.

Rowan, R., Knowlton, N., Baker, A., and Jara, J. (1997). Landscape ecology of algal symbionts creates variation in episodes of coral bleaching. Nature 388:265–269.

Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120.

Saitou, N., and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425.

LaJeunesse, T.C. (2001). Investigating the biodiversity, ecology, and phylogeny of endosymbiotic dinoflagellates in the genus Symbiodinium using the ITS region: in search of a ‘‘species’’ level marker. J Phycol 37:866–880.

Santos, S.R., Taylor, D.J., and Coffroth, M.A. (2001). Genetic comparisons of freshly isolated versus cultured symbiotic dinoflagellates: implications for extrapolating to the intact symbiosis. J Phycol 37:900–910.

LaJeunesse, T.C. (2002). Diversity and community structure of symbiotic dinoflagellates from Caribbean coral reefs. Mar Biol 141:387–400.

Santos, S.R., Taylor, D.J., Kinzie, R.A. 3rd, Hidaka, M., Sakai, K., and Coffroth, M.A. (2002). Molecular phylogeny of symbiotic dinoflagellates inferred from partial chloroplast large subunit (23S)-rDNA sequences. Mol Phylogen Evol 23:97–111.

Pawlowski, J., Holzmann, M., Fahrni, J.F., Pochon, X., and Lee, J.J. (2001). Molecular identification of algal endosymbionts in large miliolid foraminifera, 2: dinoflagellates. J Eukaryot Microbiol 48:368–373. Pochon, X., Pawlowski, J., Zaninetti, L., and Rowan, R. (2001). High genetic diversity and relative specificity among Symbiodinium-like endosymbiotic dinoflagellates in soritid foraminiferans. Mar Biol 139:1069–1078. Rowan, R. (1998). Diversity and ecology of zooxanthellae on coral reefs. J Phycol 34:407–417.

Schoenberg, D.A., and Trench, R.K. (1980). Genetic variation in Symbiodinium (=Gymnodinium) microadriaticum Freudenthal, and specificity in its symbiosis with marine invertebrates, I: isoenzyme and soluble protein patterns of axenic cultures of Symbiodinium microadriaticum. Proc R Soc Lond B 207:405–427. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997). The CLUSTAL X Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876–4882.

Rowan, R., and Knowlton, N. (1995). Intraspecific diversity and ecological zonation in coral-algal symbiosis. Proc Natl Acad Sci U S A 92:2850–2853.

Toller, W.W., Rowan, R., and Knowlton, N. (2001). Zooanthellae of the Montastrea annularis species complex: Patterns of distribution of four taxa of Symbiodinium on different reefs and across depths. Biol Bull 201:348–359.

Rowan, R., and Powers, D.A. (1991a). Molecular genetic identification of symbiotic dinoflagellates (zooxanthellae). Mar Ecol Prog Ser 71:65–73.

Webster, N.S., Wilson, K.J., Linda, L., Blackall, L.L, and Hill, R.T. (2001). Phylogenetic diversity of bacteria associated with the marine sponge Rhopaloeides odorabile. Appl Envir Microbiol 67:434–444.